ID: 1143241214

View in Genome Browser
Species Human (GRCh38)
Location 17:5444723-5444745
Sequence AGGGAAACTACCGCCTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241210_1143241214 4 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 63
1143241209_1143241214 5 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241214 Original CRISPR AGGGAAACTACCGCCTGTGA AGG Intronic
908175623 1:61552595-61552617 AGAGAAACTATTGCCTTTGAAGG - Intergenic
911125156 1:94334530-94334552 AGGGAAACTACCACCTTGGAAGG + Intergenic
911329809 1:96513931-96513953 AGGGAATTTACTCCCTGTGAAGG + Intergenic
920845411 1:209589302-209589324 AGGGACACTAGTGCCTGGGATGG - Intronic
1062801087 10:380952-380974 AGGGAAACTTCCCTCTGTGCGGG - Intronic
1064937452 10:20693940-20693962 AGGCAAACTATAGACTGTGATGG - Intergenic
1073755419 10:106575909-106575931 AGGGCAATTTCCTCCTGTGACGG - Exonic
1080932701 11:36829359-36829381 AGGGAAACTACCATCAGAGAAGG - Intergenic
1081866519 11:46363381-46363403 AGGGAAACTGAGGCCCGTGAGGG + Intronic
1085385051 11:76152824-76152846 AAGGAAGCCACCGCATGTGATGG + Intergenic
1090418776 11:126559065-126559087 AGGGAAACTACCCCTGGGGAAGG + Intronic
1104849116 12:131862848-131862870 AGTGAAACTGCCCCATGTGATGG - Intergenic
1114387902 14:22274058-22274080 AGGGAAACTACCACCCCTGTTGG + Intergenic
1116889039 14:50249557-50249579 AGGGAACCTACTGCCTTGGAGGG + Intronic
1119418811 14:74493904-74493926 TGGGAAACTAAGGCCTGTGGGGG + Intronic
1121337073 14:93083960-93083982 AGGGAAATTGCCGGCTTTGATGG - Intronic
1127356081 15:58201335-58201357 AGGGAAATAGCAGCCTGTGAAGG + Intronic
1128562089 15:68675398-68675420 AGGGAAAGTAAAGCCTCTGAGGG + Intronic
1139340009 16:66262408-66262430 AGGGACACTCCCACCTGTGAAGG + Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1146936099 17:36813530-36813552 TGGGAAGCTACAGCCTGAGAAGG + Intergenic
1162666802 19:12220420-12220442 AGGGAACCTACCGCCTTGAAGGG - Intergenic
1163557320 19:18000127-18000149 GGGGAAACTAAGGCCTGAGAAGG + Intergenic
926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG + Intergenic
931021342 2:58047416-58047438 AGGGAAACGACAGCCTCTCAGGG - Intronic
932340864 2:70961834-70961856 AGGGAAACTGAGGCCTGGGAAGG + Intronic
935593996 2:104865716-104865738 AGGGAAACTTCCAGGTGTGAGGG + Intergenic
935666845 2:105519580-105519602 AGGGAACCTGCGGTCTGTGAAGG - Intergenic
938122521 2:128644059-128644081 AGGGAAATTACACCCTGTAATGG + Intergenic
941230358 2:162904272-162904294 AGGAAAACTACAGCTTCTGAAGG + Intergenic
944078720 2:195760339-195760361 AGGGAAACTGACTGCTGTGAAGG + Intronic
946413980 2:219530166-219530188 AGGGAAGGTGCTGCCTGTGATGG + Intronic
1184835632 22:47019423-47019445 ACAGAAACTACAGCCAGTGACGG - Intronic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
953843748 3:46410425-46410447 AAGGAAAGTGCCTCCTGTGAAGG - Intronic
955759071 3:62258822-62258844 TGGGAAACTACTCCCTGGGAAGG - Intronic
959263946 3:104114219-104114241 AAGGTAACTACCCCCTGGGATGG + Intergenic
964987806 3:162766136-162766158 AGGGAAGCTGCCCCATGTGAAGG - Intergenic
968373530 4:17615-17637 AGGAAAACTACAGCCTTTGTGGG + Intergenic
978922453 4:114200874-114200896 AGGGAACCTACTGCCTTGGAGGG - Intergenic
982633130 4:157857785-157857807 AAGAAAACAACCACCTGTGATGG + Intergenic
983308897 4:166030444-166030466 AGTGAAAATACAACCTGTGAAGG - Intronic
984238617 4:177192169-177192191 AGGGAAGCTTCGGCCTGAGACGG - Intergenic
985461863 4:190114936-190114958 AGGAAAACTACAGCCTTTGTGGG - Intergenic
985583957 5:717564-717586 AGGGAGACTATAGCATGTGATGG - Intronic
985597464 5:801864-801886 AGGGAGACTATAGCATGTGATGG - Intronic
986512458 5:8522772-8522794 AGGGAAACTACTGCATTTGCTGG - Intergenic
986778634 5:11044144-11044166 AGGGAAAGGACCTCCTGTCACGG - Intronic
1006376237 6:33673159-33673181 GGGGAAACTGAGGCCTGTGAGGG - Intronic
1006424562 6:33956120-33956142 AAGGAAGCTACCCCCTGGGATGG - Intergenic
1007701074 6:43766999-43767021 AGGGAAACTCTCGCCTGTGTGGG - Intergenic
1011598357 6:89037659-89037681 AGGGAAACTACTGCCTTGAAGGG + Intergenic
1011851044 6:91629164-91629186 AAGGAAACTTCCCTCTGTGAAGG - Intergenic
1012103161 6:95117721-95117743 AAGGATACTAACGTCTGTGAAGG + Intergenic
1013420865 6:109965589-109965611 ATTGAGACTACAGCCTGTGACGG - Intergenic
1018252221 6:161882426-161882448 AGGGAAGCTGCCGCCTGGGCTGG - Intronic
1019647712 7:2139941-2139963 AGGGAAACTGAGGCCTGTGGGGG - Intronic
1020355390 7:7270008-7270030 AGGAAAAGTAGCCCCTGTGATGG + Intergenic
1022898413 7:34776805-34776827 AGGGAAACTACTGCCTTGAAGGG - Intronic
1027652337 7:80884586-80884608 AGGGAAACTTCAGCTTTTGAGGG + Intronic
1039275244 8:35927678-35927700 ATGGAACCTACTGCATGTGATGG + Intergenic
1042971555 8:74414959-74414981 AGGGAAAATAACTCCAGTGATGG + Intronic
1050014182 9:1216326-1216348 AGGGAAACCAAGGCATGTGATGG - Intergenic
1058308350 9:103471047-103471069 ACGGATACTAGCGCCTGTGCAGG + Intergenic
1060563568 9:124568759-124568781 ACATAAACTACCTCCTGTGAAGG + Intronic
1187385577 X:18845628-18845650 ACGGAAACTATCACCTTTGATGG + Intergenic
1192203515 X:69081896-69081918 TGGGAAACTACCCCCTGTGGTGG + Intergenic
1194153750 X:90361400-90361422 AGGGAAACTATAGTCAGTGATGG - Intergenic
1197306274 X:124845737-124845759 AGGGAAATTACAGGGTGTGATGG + Intronic
1200500100 Y:3938280-3938302 AGGGAAACTATAGTCAGTGATGG - Intergenic