ID: 1143241215

View in Genome Browser
Species Human (GRCh38)
Location 17:5444727-5444749
Sequence AAACTACCGCCTGTGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241210_1143241215 8 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG 0: 1
1: 1
2: 0
3: 2
4: 49
1143241209_1143241215 9 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG 0: 1
1: 1
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241215 Original CRISPR AAACTACCGCCTGTGAAGGT AGG Intronic