ID: 1143241215

View in Genome Browser
Species Human (GRCh38)
Location 17:5444727-5444749
Sequence AAACTACCGCCTGTGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241209_1143241215 9 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG 0: 1
1: 1
2: 0
3: 2
4: 49
1143241210_1143241215 8 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG 0: 1
1: 1
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241215 Original CRISPR AAACTACCGCCTGTGAAGGT AGG Intronic
902499592 1:16900850-16900872 AAACTAACTCCTGAGAAGATAGG + Intronic
904447912 1:30589384-30589406 AAACCAAGGCCTGGGAAGGTTGG - Intergenic
911970531 1:104429826-104429848 ACACGACGGCCTGTGAAGGTTGG + Intergenic
912408070 1:109458654-109458676 AAACTAGCTCCTGTTAAGATAGG + Intergenic
917563923 1:176191655-176191677 TAACTGCTGCCTGTGAAGATTGG - Intronic
1068578383 10:58710173-58710195 AAACTAAAGCCAGTAAAGGTAGG + Intronic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1072521562 10:96234455-96234477 AAACTACCACCTGTGCACTTTGG - Intronic
1073476742 10:103758736-103758758 AAAATACCTCCAGTGGAGGTTGG + Intronic
1084760842 11:71269745-71269767 GAACAATGGCCTGTGAAGGTTGG + Intergenic
1084815645 11:71644432-71644454 AAAGTGCTGCCTGTGCAGGTTGG + Intergenic
1092818303 12:12330243-12330265 AAACTGCTTCCTGGGAAGGTAGG - Exonic
1116147089 14:41088041-41088063 TATCTACCCCCTGTGAAGGGAGG - Intergenic
1125851648 15:42909335-42909357 ATACTACTGACTTTGAAGGTGGG - Intronic
1126216826 15:46165016-46165038 AAATTACTGTCTGTGAAGATTGG + Intergenic
1129675368 15:77630409-77630431 AAACAACCTCTTGTGGAGGTGGG - Intronic
1137415217 16:48270706-48270728 AAACTTCCTCTTATGAAGGTTGG + Intronic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1143992748 17:10980471-10980493 ATTCTACCGTATGTGAAGGTTGG + Intergenic
1146449386 17:32960494-32960516 AAACTACATTCTGTGAAGCTGGG - Intergenic
1149238389 17:54619093-54619115 AAACTACAGCCTGCAAAGGTAGG + Intergenic
1151209845 17:72536390-72536412 AGACTCCTGCCTGTGACGGTGGG + Intergenic
1155086701 18:22466007-22466029 AAACTACCCCCAGAGAAGCTGGG - Intergenic
1163247955 19:16109002-16109024 AAACTGCGGCCTGGGAAGCTTGG + Intergenic
927162735 2:20283747-20283769 AAACTACAGGCTATGAAGGAAGG + Intronic
928766855 2:34656594-34656616 CAACTACCTCCCATGAAGGTTGG - Intergenic
942239858 2:173951702-173951724 AAACTGCCACCTGTTAAGTTTGG - Intronic
946470723 2:219958097-219958119 TAACCACCGCCTGTGAATTTGGG + Intergenic
1174901283 20:54503849-54503871 AAACTGCAGCCTATGAAGATGGG + Intronic
1175613933 20:60376536-60376558 AAAGTAAGCCCTGTGAAGGTAGG - Intergenic
1181873031 22:25917229-25917251 AAACTACCTCCTGTTAACTTTGG + Intronic
957072075 3:75575316-75575338 AAAGTGCTGCCTGTGCAGGTTGG - Intergenic
963226280 3:142865614-142865636 AAACAACATCCTGTGAAGGATGG + Intronic
966749730 3:183310509-183310531 AAATTACCGGGTGTGATGGTGGG + Intronic
974667770 4:64987288-64987310 CAAATACATCCTGTGAAGGTAGG + Intergenic
977211301 4:94221409-94221431 AAATTACCACCTGTCAAGTTTGG + Intronic
985630321 5:1010571-1010593 CATCTAACGCCTGTGATGGTGGG + Intronic
989966879 5:50475284-50475306 AAACTTCTGCCTGTAAAGGCAGG - Intergenic
995714295 5:115067104-115067126 AAACTTCCCACTGTGAAGGCTGG + Intergenic
995910542 5:117181780-117181802 ATACGACCTCTTGTGAAGGTAGG - Intergenic
1000778860 5:165454231-165454253 AATCTAACCCCTGTGAAGGAAGG - Intergenic
1003737294 6:8890979-8891001 AAAATACTGTCTATGAAGGTGGG + Intergenic
1013146377 6:107398083-107398105 AAACTACCACCTGTCAAATTTGG + Intronic
1020562135 7:9741688-9741710 TAACTACCTCTTGTGAAGGAAGG - Intergenic
1022467317 7:30660636-30660658 AAACCAGCACCTGTGAAGATGGG + Exonic
1033221317 7:139527860-139527882 AAACTACCAAATGTGAAGTTTGG - Intronic
1042157382 8:65859604-65859626 AAACTACCATTTGTGAAGTTTGG + Intergenic
1044556898 8:93572505-93572527 AAACTCCCAACTGTGAAGCTAGG + Intergenic
1059491582 9:114672091-114672113 AAAGTAGCTCCTGTGAAGCTAGG + Intergenic
1060563570 9:124568763-124568785 AAACTACCTCCTGTGAAGGTGGG + Intronic
1185931890 X:4212762-4212784 ATACTACAGCCTGGGAAGGGTGG - Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1201712622 Y:17009347-17009369 ATACTACAGCCTGGGAAGGGTGG - Intergenic