ID: 1143241216

View in Genome Browser
Species Human (GRCh38)
Location 17:5444728-5444750
Sequence AACTACCGCCTGTGAAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241210_1143241216 9 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241216 17:5444728-5444750 AACTACCGCCTGTGAAGGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48
1143241209_1143241216 10 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241216 17:5444728-5444750 AACTACCGCCTGTGAAGGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48
1143241213_1143241216 -10 Left 1143241213 17:5444715-5444737 CCAGAAACAGGGAAACTACCGCC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1143241216 17:5444728-5444750 AACTACCGCCTGTGAAGGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241216 Original CRISPR AACTACCGCCTGTGAAGGTA GGG Intronic
903891527 1:26573345-26573367 ACCTACAGCTTGTGAAGGTATGG + Exonic
908175622 1:61552590-61552612 AACTATTGCCTTTGAAGGAAAGG - Intergenic
910771196 1:90834464-90834486 AACTGCCGCCTGAAAAGGGATGG - Intergenic
911970532 1:104429827-104429849 CACGACGGCCTGTGAAGGTTGGG + Intergenic
913041820 1:115034338-115034360 CTCTAACGCCTGTGTAGGTATGG - Intergenic
918140460 1:181715375-181715397 AACATCCGCCTTAGAAGGTAAGG + Exonic
921421949 1:214958566-214958588 AACAACCACCTGTCAAGGGAGGG + Intergenic
1070274436 10:74991945-74991967 AAATCCAGCCTTTGAAGGTAGGG + Intronic
1071732978 10:88267596-88267618 AACTACCCCCTGTCAAGGAGTGG + Intergenic
1075025302 10:118979626-118979648 TACTACGGCCTGAGAAGGAATGG + Intergenic
1078895324 11:15592276-15592298 AACTTCTGCCTGACAAGGTATGG - Intergenic
1079649071 11:22903941-22903963 TACTAGGGCCTGTGCAGGTAGGG - Intergenic
1088453128 11:110003236-110003258 GACTACCACCTATGAAGATAAGG - Intergenic
1090875695 11:130786750-130786772 ACCTGCCGCCTGTGATGGAAAGG - Intergenic
1092818302 12:12330242-12330264 AACTGCTTCCTGGGAAGGTAGGG - Exonic
1096722754 12:53536117-53536139 ATTTACCTCCTGTGAAGGAATGG - Intronic
1102011429 12:109621465-109621487 AACTACCACTTGTGAAGATCTGG + Intergenic
1108352023 13:49596520-49596542 AGCTACACCCTGAGAAGGTACGG + Intergenic
1111538436 13:89636002-89636024 AACTACCACCTGTCAAGTTTTGG - Intergenic
1111619069 13:90700257-90700279 AACTATGGCCTGTGATGGGAGGG - Intergenic
1116155685 14:41201960-41201982 AACTAACGCCTGAGGAGGTAAGG - Intergenic
1118501984 14:66370507-66370529 AACTACCACCTGTGGACTTAAGG + Intergenic
1122249179 14:100426032-100426054 AACTACCCCATGTGAAGCTGTGG - Intronic
1129767510 15:78179544-78179566 AACTACCGGCTGTACAGGTGAGG - Exonic
1143241216 17:5444728-5444750 AACTACCGCCTGTGAAGGTAGGG + Intronic
1145284908 17:21498114-21498136 AACTGCCTCCTATCAAGGTATGG + Intergenic
1146936101 17:36813535-36813557 AGCTACAGCCTGAGAAGGGAAGG + Intergenic
1147588472 17:41666449-41666471 AGCTGCCGCCTGTGAAAGAAGGG - Intergenic
1151253354 17:72855103-72855125 AGCAACCGCCTTTGAAAGTACGG + Intronic
1157757474 18:50231549-50231571 AACTACCACCTGTTCAGGTGAGG + Intronic
1163557321 19:18000132-18000154 AACTAAGGCCTGAGAAGGAAAGG + Intergenic
927162736 2:20283748-20283770 AACTACAGGCTATGAAGGAAGGG + Intronic
927214586 2:20660878-20660900 ATCTGCCGCCTGGGAAGATAGGG - Intergenic
942150717 2:173074081-173074103 AACAAGTGCCTCTGAAGGTAAGG + Intergenic
1172929693 20:38577155-38577177 AACCAGCGCCTGGTAAGGTATGG - Exonic
956879654 3:73498054-73498076 AAGTTCCGCCAGAGAAGGTAAGG + Intronic
963826339 3:149958367-149958389 AACTACTGGCTTTGAAGATAGGG - Intronic
965936065 3:174114181-174114203 AACTAAAGCCTGTGCAGGCATGG - Intronic
966901534 3:184490316-184490338 AAATCCTGCTTGTGAAGGTAAGG + Intronic
968602940 4:1519080-1519102 TACTACCGCCTTTGAGGGGATGG - Intergenic
995910541 5:117181779-117181801 TACGACCTCTTGTGAAGGTAGGG - Intergenic
1023806086 7:43874070-43874092 TACTAGCGCCTGTGTAGGAATGG - Intronic
1030712693 7:112769892-112769914 AACTACTGTGAGTGAAGGTATGG + Intronic
1031155619 7:118107569-118107591 AACTACAGCCTGTAAAATTAAGG + Intergenic
1039587518 8:38719587-38719609 AACTACTGACTGTAAAGGGAGGG - Intergenic
1045048465 8:98301522-98301544 AACTACAACCTGGGAAGGCAGGG + Intergenic
1045121570 8:99043118-99043140 AACTTCGTCCTGTGAAAGTATGG - Intronic
1051664949 9:19460127-19460149 AACTAGTGCCTGTGTTGGTATGG - Intergenic
1059058526 9:111010537-111010559 TACTACCGCCTTTCAAGATAAGG + Intronic
1060563571 9:124568764-124568786 AACTACCTCCTGTGAAGGTGGGG + Intronic
1061578401 9:131522208-131522230 AGCGACCACCTGTGCAGGTACGG + Exonic
1188172428 X:26943830-26943852 CACAACCACATGTGAAGGTATGG + Intergenic
1196095408 X:111792959-111792981 AGCTACAGCCTGAGAAGGTATGG + Intronic