ID: 1143241217

View in Genome Browser
Species Human (GRCh38)
Location 17:5444732-5444754
Sequence ACCGCCTGTGAAGGTAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241209_1143241217 14 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241217 17:5444732-5444754 ACCGCCTGTGAAGGTAGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 91
1143241213_1143241217 -6 Left 1143241213 17:5444715-5444737 CCAGAAACAGGGAAACTACCGCC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1143241217 17:5444732-5444754 ACCGCCTGTGAAGGTAGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 91
1143241210_1143241217 13 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241217 17:5444732-5444754 ACCGCCTGTGAAGGTAGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241217 Original CRISPR ACCGCCTGTGAAGGTAGGGC TGG Intronic
900286972 1:1906471-1906493 ATGGGCTGTGAAGGTTGGGCAGG + Intergenic
900507702 1:3037896-3037918 GCCGCCTGTGCAGCTGGGGCTGG + Intergenic
900536986 1:3183577-3183599 ACCGCCGGGGAAGGGAGGCCGGG + Intronic
903597235 1:24503627-24503649 GCCGCCTGGACAGGTAGGGCAGG + Intronic
903690210 1:25167935-25167957 ACAGCACGTGAAGGCAGGGCTGG + Intergenic
904319771 1:29689351-29689373 ACCTACTGTGAAGCTAGGGCAGG + Intergenic
904774609 1:32899111-32899133 CCGGCATGTGCAGGTAGGGCTGG - Intronic
905626626 1:39493763-39493785 ACCATCTGTGAAGCTGGGGCTGG + Intronic
905670264 1:39786693-39786715 ACCATCTGTGAAGCTGGGGCTGG - Intronic
906587706 1:46994376-46994398 AGTGCCTGTGCAGTTAGGGCTGG + Intergenic
915348695 1:155211534-155211556 GGAGCCTGGGAAGGTAGGGCAGG + Intronic
915351887 1:155232160-155232182 GGAGCCTGGGAAGGTAGGGCAGG + Intergenic
916605183 1:166335390-166335412 ACCTCCTGAGAAGGTGGAGCGGG - Intergenic
923525279 1:234767814-234767836 ACTGCCTCTGAAGGGAGGTCAGG - Intergenic
1067087899 10:43252489-43252511 CCTGCCTGGGAAGGAAGGGCAGG + Intronic
1072294391 10:93995052-93995074 ACCCCCCGTAGAGGTAGGGCAGG + Intronic
1072813765 10:98484948-98484970 TCCTCCTTTGAAGGTGGGGCTGG - Intronic
1073208487 10:101780933-101780955 AGGGCCTGTGAGGGCAGGGCGGG - Intergenic
1076522041 10:131087567-131087589 ACCACCTGTGAAGAAACGGCAGG + Intergenic
1077060936 11:617618-617640 ACCGCCTGGGGAGGCAGGGCCGG + Exonic
1077610787 11:3642140-3642162 TCCGCCTGAGAGGGGAGGGCCGG + Exonic
1078520415 11:12058485-12058507 ACCTCATGTGAAGAAAGGGCAGG - Intergenic
1083395541 11:62389183-62389205 ACCGCCTGTGGAGGTTGCGTAGG - Exonic
1083954822 11:65977486-65977508 GCCGCCTGAGAAGGCAGAGCAGG - Intronic
1102457156 12:113077910-113077932 GGCGCCTGTGAAGGTGGCGCTGG - Exonic
1110225788 13:73117943-73117965 ACCTCTTGTGAAGGTGGGGAGGG + Intergenic
1111707891 13:91774475-91774497 ATAGCCTGTGAAGGATGGGCTGG + Intronic
1116147088 14:41088036-41088058 ACCCCCTGTGAAGGGAGGCCAGG - Intergenic
1119421378 14:74509724-74509746 ACTGCCTGTGAAGGTAACCCTGG - Exonic
1124407435 15:29404815-29404837 GCCTCCTGTGGAGGTAGGGCAGG - Intronic
1124641860 15:31400819-31400841 ACTGCCTGTGAGGGTCTGGCTGG + Intronic
1127973333 15:63979141-63979163 TCTCCCTGTGAAGGTTGGGCTGG - Intronic
1131975863 15:97945342-97945364 GCCACCTGAGAAGGTAGGGCTGG + Intergenic
1132733040 16:1372419-1372441 ACAGCCTTGGAAGGCAGGGCTGG - Intronic
1132814513 16:1819332-1819354 AATGCCCGTGAAGGTGGGGCAGG + Intronic
1132842673 16:1985848-1985870 ACAGCCTGTGTAGGGAGAGCAGG - Exonic
1132846992 16:2005248-2005270 TGCGCCTGTGAGGGTCGGGCTGG - Intronic
1133403372 16:5504749-5504771 TCCTCCTCTGAAGGTGGGGCTGG - Intergenic
1137433026 16:48433689-48433711 GCAGCCTGTGAAGGAAGGACAGG - Intronic
1142239617 16:88939276-88939298 ACCACCTGTGAAGCCAGGGCTGG - Intronic
1143035118 17:3990659-3990681 ACCGGCTGTGCAGGTAGCGAGGG - Intergenic
1143241217 17:5444732-5444754 ACCGCCTGTGAAGGTAGGGCTGG + Intronic
1144703626 17:17353750-17353772 ACCCCATGGGAAGGTAGGGCAGG + Intergenic
1146611971 17:34314211-34314233 ACGGTCTGTGAATGAAGGGCAGG - Intergenic
1146643281 17:34557006-34557028 AGTGCCTGTGGAGGGAGGGCAGG + Intergenic
1148359019 17:46996551-46996573 ACTTCCTGTGAAGGTAGGAAAGG + Intronic
1150787604 17:68175573-68175595 ACCTCCTGTGAAGGAAGGAAAGG - Intergenic
1151195002 17:72425100-72425122 ACTGGCTGTCAAGGTGGGGCAGG - Intergenic
1152985214 18:314726-314748 CCCGGCTATGAAGGCAGGGCTGG + Intergenic
1154358742 18:13642066-13642088 ACCGCCTGTGACGGGAGGGAAGG - Intronic
1156482344 18:37444252-37444274 ACCCCCTGTGTGGGTAGGGGTGG + Intronic
1158692771 18:59675981-59676003 ATGGCCTATGAAGGTAGGGCGGG - Intronic
1160113367 18:76054742-76054764 ACCCCCTGTCAAGGTGGGACAGG + Intergenic
1160922267 19:1526566-1526588 ACCGCTGGTGCAGGTAGCGCAGG - Exonic
1163830484 19:19545050-19545072 CCAGCCTGTCCAGGTAGGGCTGG - Exonic
925975127 2:9137096-9137118 ACACCCTGTGAACGGAGGGCTGG + Intergenic
927030191 2:19113092-19113114 ACCACCTGGGAAGCTAGGGATGG - Intergenic
932664041 2:73681981-73682003 ACAGCCTGTGAAAGAAGTGCTGG + Intergenic
936451043 2:112634391-112634413 ACCGCCTGTGTAGCTTGGGTGGG + Intergenic
940819370 2:158335146-158335168 ACAGCCTTTGAAGACAGGGCAGG - Intronic
948975137 2:241459279-241459301 ACCGTCAGTGAATGTGGGGCCGG - Intronic
1171188342 20:23139768-23139790 ACCCTCTGTGAAGGTGGTGCTGG + Intergenic
1175224225 20:57435646-57435668 AGCGGCTGTGGAGGGAGGGCTGG - Intergenic
1180841813 22:18962436-18962458 GTGGCCTGTGAAGGTTGGGCAGG + Intergenic
1181059688 22:20276428-20276450 GTGGCCTGTGAAGGTTGGGCAGG - Intronic
1183978151 22:41525037-41525059 ACCTCCTGTGCAGGCAGGGAGGG + Intronic
951580716 3:24159984-24160006 TCTGCCTTTGAAGGCAGGGCTGG + Intronic
954131914 3:48565195-48565217 ACCCGCTCTGCAGGTAGGGCAGG + Exonic
954201206 3:49024419-49024441 ACCACCTGTGAGGTGAGGGCAGG + Intronic
954578428 3:51689819-51689841 AGCCCTTGTGCAGGTAGGGCAGG + Intronic
956214940 3:66839035-66839057 ACTGCCTGTGAAAGCAGGGGAGG + Intergenic
963591456 3:147265329-147265351 ACTGCCTGTGAAGGTAGTTGAGG - Intergenic
969697890 4:8745530-8745552 ACCGCCTGTCCAGCTGGGGCTGG - Intergenic
985567311 5:625811-625833 ACGGCCTGTGAGAGCAGGGCTGG - Intronic
985699092 5:1359526-1359548 ACCGCCTGAGGAGGAAGGACGGG - Intergenic
995571531 5:113487495-113487517 ACCGCCTCTGTAGGAAGTGCGGG + Intronic
997243951 5:132330204-132330226 ACCTGCTGTGAAGGCAGGCCTGG + Intronic
998798229 5:145841288-145841310 ATCCCTTGTGAAGGTAGAGCTGG + Intergenic
1002088588 5:176791462-176791484 GACGCCTGTGAAGTTAGGGAGGG - Intergenic
1002426310 5:179178275-179178297 CCCGCCTGTGAATGGAGAGCTGG + Intronic
1007631292 6:43274984-43275006 ACAGCCTGTGCAGGGAGGGAGGG - Intronic
1013134451 6:107267268-107267290 CCAGCCTGTGAAGCTAGAGCTGG + Intronic
1018054712 6:160041731-160041753 ACCGCCTGGGCAGGGAGTGCTGG + Intronic
1020756340 7:12208494-12208516 ACTGCCTGTGAATGTAAGTCAGG + Intergenic
1024203230 7:47127062-47127084 ACCTCCTGGGAAGGTGGGGAGGG - Intergenic
1024971134 7:55071529-55071551 TCTGCCAGTGAAGGCAGGGCAGG - Intronic
1026848749 7:73712031-73712053 TCCGTCTATGAGGGTAGGGCTGG + Intronic
1027232301 7:76279894-76279916 GCCGCCTCTGGAGGAAGGGCTGG - Intronic
1030087916 7:105832881-105832903 AGCAGCTGTGAAGGTAGAGCTGG - Intronic
1033044362 7:137947881-137947903 ACCTCCTGTAAAGACAGGGCAGG - Intronic
1033514722 7:142094515-142094537 AGGGCCTGTGCCGGTAGGGCAGG + Intronic
1035038974 7:155913883-155913905 GGCGCCTGTGAGGGCAGGGCTGG + Intergenic
1039888877 8:41671256-41671278 ACCCCCTTTGAAGGAGGGGCTGG - Intronic
1054867145 9:70014265-70014287 AACACCTGTGAAGAAAGGGCAGG - Intergenic
1055163716 9:73164574-73164596 ACCGCTTGTGACAATAGGGCAGG + Intronic
1057090616 9:92254932-92254954 ACCTCCTGTGAAGCTGGGTCTGG - Intronic
1057804244 9:98209234-98209256 ACCCTCAGTGAAGGCAGGGCAGG - Intronic
1057968030 9:99523511-99523533 ACCACCTGTGAGGGCTGGGCAGG + Intergenic
1061600495 9:131666877-131666899 ACCTCCTGTGATGGGACGGCTGG + Intronic
1062599488 9:137313491-137313513 ACCCCCTGAGAAGGTGGGGTGGG + Intronic
1185445914 X:258016-258038 ACCGCCTGGGATGGTACAGCCGG + Intergenic
1187431500 X:19229171-19229193 TCCGCCGGTGAGGGTAGGGCCGG - Intergenic