ID: 1143241219

View in Genome Browser
Species Human (GRCh38)
Location 17:5444733-5444755
Sequence CCGCCTGTGAAGGTAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241209_1143241219 15 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241219 17:5444733-5444755 CCGCCTGTGAAGGTAGGGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1143241213_1143241219 -5 Left 1143241213 17:5444715-5444737 CCAGAAACAGGGAAACTACCGCC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1143241219 17:5444733-5444755 CCGCCTGTGAAGGTAGGGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1143241210_1143241219 14 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241219 17:5444733-5444755 CCGCCTGTGAAGGTAGGGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241219 Original CRISPR CCGCCTGTGAAGGTAGGGCT GGG Intronic
902940681 1:19798724-19798746 CAGCCTGGGGAGGGAGGGCTGGG - Intronic
904319773 1:29689352-29689374 CCTACTGTGAAGCTAGGGCAGGG + Intergenic
904466448 1:30710899-30710921 CCGCCTGTGAGGCTGGGGGTTGG - Intergenic
904774608 1:32899110-32899132 CGGCATGTGCAGGTAGGGCTGGG - Intronic
905210264 1:36369327-36369349 CCACCTGTGTAAGTGGGGCTGGG + Intronic
905626628 1:39493764-39493786 CCATCTGTGAAGCTGGGGCTGGG + Intronic
905670262 1:39786692-39786714 CCATCTGTGAAGCTGGGGCTGGG - Intronic
905800191 1:40838161-40838183 CCGCCTGGAAAGGTGGAGCTTGG - Intronic
906587707 1:46994377-46994399 GTGCCTGTGCAGTTAGGGCTGGG + Intergenic
907440451 1:54475200-54475222 CCGACTGTGAATGGAGGGGTTGG + Intergenic
908601621 1:65745393-65745415 CAGCCTGTGAAGGTAGCTGTGGG + Intergenic
910536445 1:88303577-88303599 TGGCCAGTGAAGGTAGTGCTTGG - Intergenic
915837433 1:159188706-159188728 CCGCCTCTTCAGGTTGGGCTAGG + Intronic
918151832 1:181803572-181803594 CTGTCTGTGGAGGGAGGGCTCGG + Intronic
922801798 1:228367910-228367932 CCGCCTGTACAGGAAGGGCGTGG + Exonic
1064947018 10:20801900-20801922 CAGTCAGTTAAGGTAGGGCTAGG + Intronic
1067087900 10:43252490-43252512 CTGCCTGGGAAGGAAGGGCAGGG + Intronic
1067697977 10:48549197-48549219 CAGCCTGGGAACATAGGGCTTGG - Intronic
1069881785 10:71597901-71597923 CCGCCTTTGAGGGTGGGGGTGGG - Intronic
1070597574 10:77843436-77843458 CTCCCTGAGGAGGTAGGGCTAGG - Exonic
1071789665 10:88940617-88940639 CCTCTTGTGAAGGGAGGACTGGG + Intronic
1072618013 10:97062638-97062660 CAGCCTGTGAGGCCAGGGCTGGG + Intronic
1072654909 10:97323202-97323224 CCACCTGGGAAGGAAGGGGTAGG - Intergenic
1072813763 10:98484947-98484969 CCTCCTTTGAAGGTGGGGCTGGG - Intronic
1077060938 11:617619-617641 CCGCCTGGGGAGGCAGGGCCGGG + Exonic
1077225416 11:1437257-1437279 CCGCCTGGGAGGGAAGGACTTGG + Intronic
1077507599 11:2939157-2939179 CCCCTTGTGATGGTTGGGCTTGG + Intergenic
1077610789 11:3642141-3642163 CCGCCTGAGAGGGGAGGGCCGGG + Exonic
1080383772 11:31798750-31798772 CCGCCTGTGATGGTTGGGGCCGG - Intronic
1081816372 11:45945838-45945860 ACGTCTGTGGAGGTGGGGCTGGG + Exonic
1083610227 11:64000805-64000827 CCGCCTGGGGAGGTGGGCCTTGG - Intronic
1090875692 11:130786745-130786767 CCGCCTGTGATGGAAAGGCAAGG - Intergenic
1094478311 12:30859447-30859469 CCTCCTCTGAAGGTAGAGCCTGG - Intergenic
1094587731 12:31793473-31793495 CCGCCTGTAATGGTAGCACTGGG + Intergenic
1097166394 12:57088780-57088802 CCGGCTGTGCAGGGCGGGCTTGG - Intergenic
1097644307 12:62217619-62217641 CCTACTTTGAAGGAAGGGCTGGG - Intronic
1102457155 12:113077909-113077931 GCGCCTGTGAAGGTGGCGCTGGG - Exonic
1108025201 13:46170345-46170367 GCGGCTGGCAAGGTAGGGCTAGG - Intronic
1113616686 13:111685338-111685360 CCTGCTGTGAAGGTGGTGCTTGG - Intergenic
1113622216 13:111770609-111770631 CCTGCTGTGAAGGTGGTGCTTGG - Intergenic
1119421377 14:74509723-74509745 CTGCCTGTGAAGGTAACCCTGGG - Exonic
1120953118 14:90060784-90060806 CCGCCTGAGAAGGCAGAGCGCGG + Intergenic
1121332413 14:93057974-93057996 CCGCCTGGGAAGATCGGGCCAGG - Intronic
1122143254 14:99674769-99674791 ACTCCTGGGAAGGTGGGGCTTGG + Intronic
1123662346 15:22575442-22575464 CCTCCTGTGGACGTGGGGCTGGG + Intergenic
1124316146 15:28669724-28669746 CCTCCTGTGGACGTGGGGCTGGG + Intergenic
1132618866 16:855077-855099 CCGCCTGGGAAGGTGGGGAGAGG + Intronic
1132860881 16:2071235-2071257 CCGCCTGGGATGGAAGGGATGGG - Intronic
1135145528 16:19959573-19959595 CCTCCTGGGATGGTAGGGGTTGG - Intergenic
1135993875 16:27233967-27233989 CTGCCTGAGAAGGAAGTGCTGGG - Intronic
1139238519 16:65366122-65366144 CCGCATGTGTAGGAAGGTCTTGG - Intergenic
1140193572 16:72838325-72838347 CAGCCTGGGAAGGGAGGGCCAGG + Intronic
1141014273 16:80433746-80433768 CCACCTTGGAAGGTAGGGATAGG - Intergenic
1143241219 17:5444733-5444755 CCGCCTGTGAAGGTAGGGCTGGG + Intronic
1143426082 17:6839228-6839250 CAGTCATTGAAGGTAGGGCTAGG + Intergenic
1144819864 17:18064849-18064871 CAGCCGGTGAGGTTAGGGCTTGG + Intronic
1151129059 17:71876785-71876807 CCTCCTGTTAGGGTAAGGCTTGG + Intergenic
1154358740 18:13642065-13642087 CCGCCTGTGACGGGAGGGAAGGG - Intronic
1154376751 18:13817156-13817178 CCGCCCATGGAGGTTGGGCTTGG + Intergenic
1154992835 18:21612469-21612491 GGGGCTGTGAAGGGAGGGCTTGG + Intronic
1157138063 18:45076915-45076937 CTACCTTTGAAGGGAGGGCTGGG - Intergenic
1157672498 18:49542127-49542149 CCACCTGTGAAGATGGGGCCAGG + Intergenic
1158692770 18:59675980-59676002 TGGCCTATGAAGGTAGGGCGGGG - Intronic
1162028052 19:7905301-7905323 CAGGCTGTGAAGGTCAGGCTGGG - Intronic
1163766403 19:19165743-19165765 CAGCCAGGGATGGTAGGGCTTGG + Intronic
1163830483 19:19545049-19545071 CAGCCTGTCCAGGTAGGGCTGGG - Exonic
1167250680 19:48396985-48397007 CCGCCTGGGGTGGTTGGGCTGGG - Intronic
927094373 2:19736457-19736479 CCGCCTGTGTAATCAGGGCTGGG + Intergenic
927869280 2:26613477-26613499 CTGCCTGTGGAGGGAGGGCATGG - Intronic
931096359 2:58945123-58945145 CCTCCTGTGTAGCTAGGACTAGG + Intergenic
932664042 2:73681982-73682004 CAGCCTGTGAAAGAAGTGCTGGG + Intergenic
936344908 2:111668066-111668088 TCGACTCTGAAGGCAGGGCTTGG + Intergenic
938287363 2:130129025-130129047 CCGCCTGTGGGGGCAGGGGTTGG - Intronic
938428229 2:131209844-131209866 CCGCCTGTGGGGGCAGGGGTTGG + Intronic
947097341 2:226581135-226581157 CTGCCTGGGAAGGAGGGGCTTGG + Intergenic
1169345504 20:4824987-4825009 CCTCCTGTGACAGTGGGGCTAGG + Intergenic
1173339585 20:42141442-42141464 CAGCCTGTGAGGGAGGGGCTAGG - Intronic
1175248936 20:57597359-57597381 CCGTCTGTACAGGTGGGGCTAGG - Intergenic
1175899090 20:62353020-62353042 CCGGGTGTGAGGGCAGGGCTGGG + Intronic
1179581960 21:42349817-42349839 CCGCCTGTGAAGCTGGGTCCTGG + Intronic
1180051762 21:45334932-45334954 CTGCAGGTGAAGGCAGGGCTGGG + Intergenic
1180841814 22:18962437-18962459 TGGCCTGTGAAGGTTGGGCAGGG + Intergenic
1181059687 22:20276427-20276449 TGGCCTGTGAAGGTTGGGCAGGG - Intronic
1183465810 22:37979951-37979973 CAGCCTGGGGAGGGAGGGCTCGG - Intronic
1184044516 22:41964382-41964404 CTGGCTGAGAAGGAAGGGCTCGG + Intergenic
949462388 3:4306727-4306749 ATGCCTGTGAAGGCAGGGTTTGG - Intronic
949737258 3:7187884-7187906 CTCACTCTGAAGGTAGGGCTTGG - Intronic
950669037 3:14514207-14514229 GCGCTTGTGAAGCTAGGGCTTGG + Intronic
952007877 3:28863253-28863275 CCATCTGAGAAGGCAGGGCTGGG - Intergenic
956174878 3:66463467-66463489 CCGCCTCTAAGGGTATGGCTGGG - Intronic
956454627 3:69408635-69408657 CTGCCTGGGCAGGCAGGGCTTGG + Intronic
956809215 3:72848194-72848216 TCGCCTGAGAAAGTATGGCTTGG + Exonic
958714155 3:97759025-97759047 AAGCCTGTGGAGGTAGGCCTAGG + Intergenic
959056616 3:101574027-101574049 CCGCCTCGGAAGGAAGAGCTGGG - Intergenic
961906592 3:130269209-130269231 CCCCCTGTGAAGGTGGATCTGGG - Intergenic
962920704 3:139948162-139948184 CTGCTTTTGAAGGTAGGGTTTGG + Intronic
963646651 3:147923449-147923471 ATGCCTGTCAAGTTAGGGCTTGG + Intergenic
969697888 4:8745529-8745551 CCGCCTGTCCAGCTGGGGCTGGG - Intergenic
978895187 4:113878440-113878462 CCTCCTGTGATGGTAAGGGTTGG - Intergenic
981270839 4:142846178-142846200 CCGCCTGGGATCCTAGGGCTCGG - Intronic
983216122 4:165004679-165004701 CTACCTGTGAAGGTAGTGATGGG + Intergenic
986222010 5:5776435-5776457 CCGGCTGTCCAGGTAGGTCTAGG + Intergenic
990067514 5:51736521-51736543 CCTCCTGTGCAGTAAGGGCTTGG + Intergenic
998576282 5:143320869-143320891 CAGCCTGAGAAGGGAGTGCTTGG - Intronic
1002088587 5:176791461-176791483 ACGCCTGTGAAGTTAGGGAGGGG - Intergenic
1002605447 5:180380413-180380435 CCACCAGAGAAGGAAGGGCTTGG - Intergenic
1005692707 6:28322633-28322655 CATCCTGGGAAGGAAGGGCTGGG - Intergenic
1006180483 6:32150817-32150839 CTGCCTGTGGCGGTGGGGCTGGG + Exonic
1006183317 6:32166799-32166821 TCACCTGTGAAGGTGAGGCTGGG + Exonic
1006788613 6:36684322-36684344 CCCCGTGGGAAGGTAGAGCTTGG - Exonic
1007433033 6:41787370-41787392 CAGCCTGTGGAGGTGGGGGTAGG - Exonic
1026848751 7:73712032-73712054 CCGTCTATGAGGGTAGGGCTGGG + Intronic
1036711599 8:11082991-11083013 CTGCCTGTGCAGAAAGGGCTGGG - Intronic
1045942406 8:107754852-107754874 CAGGCTGTGAGGGTGGGGCTGGG - Intergenic
1049800659 8:144516126-144516148 CCTCCAGTCAAGCTAGGGCTGGG - Exonic
1057726669 9:97572984-97573006 CCGCTTGTGAAAGGAGGACTGGG - Intronic
1060933587 9:127503672-127503694 CCACCTGTGAAGGGGGCGCTGGG - Intergenic
1061600497 9:131666878-131666900 CCTCCTGTGATGGGACGGCTGGG + Intronic
1061882103 9:133573730-133573752 CCGCCTGGGAAGGGTGGGGTGGG + Intronic
1061884481 9:133584719-133584741 CGGGCTGTGAAGGATGGGCTGGG + Intronic
1062424234 9:136498626-136498648 CCGCCCAGGAGGGTAGGGCTGGG + Intronic
1187378557 X:18779431-18779453 TAGCCTGTGAAGGTCGGGCATGG - Intronic
1187431498 X:19229170-19229192 CCGCCGGTGAGGGTAGGGCCGGG - Intergenic