ID: 1143241221

View in Genome Browser
Species Human (GRCh38)
Location 17:5444736-5444758
Sequence CCTGTGAAGGTAGGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 340}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241209_1143241221 18 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241221 17:5444736-5444758 CCTGTGAAGGTAGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 48
4: 340
1143241210_1143241221 17 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241221 17:5444736-5444758 CCTGTGAAGGTAGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 48
4: 340
1143241213_1143241221 -2 Left 1143241213 17:5444715-5444737 CCAGAAACAGGGAAACTACCGCC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1143241221 17:5444736-5444758 CCTGTGAAGGTAGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 48
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241221 Original CRISPR CCTGTGAAGGTAGGGCTGGG AGG Intronic
900314985 1:2051967-2051989 CCTCTTCAGGTAGGGCTGGACGG - Intronic
900386809 1:2414375-2414397 CCTGGGCAGGTGGGGCTTGGGGG + Intergenic
901504438 1:9675699-9675721 CCTGGGAAGGTGGGGACGGGGGG - Intronic
901798346 1:11692936-11692958 CCTGTGGAGGAAGGGAGGGGAGG + Intronic
903212366 1:21825540-21825562 CATGAGCAGATAGGGCTGGGGGG - Intronic
903366208 1:22806899-22806921 TCTGGGGAAGTAGGGCTGGGGGG - Intronic
903658125 1:24961153-24961175 ACTGAGAGGGGAGGGCTGGGTGG + Intronic
903856929 1:26343232-26343254 CCTGGAAAGGTAGGGTTGTGGGG - Exonic
903947695 1:26973967-26973989 CCTGCTAAGGTCGGGGTGGGAGG + Intergenic
904537419 1:31208998-31209020 CCTGTGAAGGGAGAGCTTGATGG - Intronic
905915943 1:41684344-41684366 CTTGGGAAGGAAGGGCTGGAAGG - Intronic
906663178 1:47596971-47596993 CCTGTGGGGGTAGGGGTCGGGGG + Intergenic
907028605 1:51148495-51148517 TCAGTGTGGGTAGGGCTGGGAGG + Intergenic
907313352 1:53552384-53552406 CCTGAGAAGGAAGGCCTGGCGGG - Intronic
907658658 1:56371315-56371337 CCTGTTAGGGGAGGGCAGGGAGG - Intergenic
910300976 1:85707615-85707637 CATGTCAAGGTAGGGCATGGGGG - Exonic
912421681 1:109546572-109546594 TATGTGAAGGAAGGGCTGGAGGG - Exonic
913106164 1:115615960-115615982 GCTGTGAAGGTAGAGCCTGGTGG + Intergenic
915538398 1:156551685-156551707 CAGGTGAAGTTAGGGCTGGTTGG - Exonic
915637651 1:157197721-157197743 ACTGTGAACATAGGGTTGGGAGG - Intergenic
917259430 1:173150636-173150658 ACTGTGGAGGTAGGAGTGGGTGG - Intergenic
918140964 1:181719608-181719630 CTACTGAAGGTAGGGCTGGTGGG + Intronic
919754801 1:201059966-201059988 CCTGCCAAGGCAGGGCAGGGTGG - Intronic
920305459 1:205015540-205015562 CTTGTGCAGGGAGAGCTGGGAGG - Intronic
922193434 1:223339664-223339686 GCTGAGAAGGTAGATCTGGGAGG - Intronic
922349954 1:224727143-224727165 CTTGTTAAGGAAGGGCTGAGTGG + Intronic
923746094 1:236701472-236701494 CCTGTGACTGGAGGGCTGTGGGG + Intronic
1063410722 10:5834585-5834607 CCTATGATGGAAGTGCTGGGTGG + Intronic
1063949865 10:11212338-11212360 TCTGTGAAGGCAGGCCCGGGGGG - Intronic
1065287996 10:24203556-24203578 CCTGTGGAGGTGGGGGTTGGGGG - Intronic
1066323447 10:34328545-34328567 ACTGTGAAGGTGGTGGTGGGGGG + Intronic
1067089409 10:43258958-43258980 CCAGTGAAGGCAGTGCAGGGTGG - Intronic
1067107943 10:43377979-43378001 CATGTGAAGGTGGAGGTGGGTGG - Intergenic
1067274158 10:44819643-44819665 CCTGTTAGAGAAGGGCTGGGAGG - Intergenic
1067702062 10:48580773-48580795 CAGGTGAGGGCAGGGCTGGGTGG + Intronic
1068077362 10:52273389-52273411 CCTGTGAAGGAGAGTCTGGGAGG - Intronic
1068890045 10:62139341-62139363 CCAGAGAAGGCAGGGCTGGGTGG - Intergenic
1068896813 10:62212867-62212889 ACAGTGAAGGTAGGGCAGGGAGG + Intronic
1069592482 10:69650670-69650692 TCTGTGCAGGGAGGTCTGGGGGG + Intergenic
1070577104 10:77687469-77687491 CCAGGGATGGTAGGACTGGGAGG + Intergenic
1070771513 10:79085123-79085145 CCTGTGGTGGCAGGGCTGAGTGG + Intronic
1072608601 10:97002456-97002478 CCTGTGAAGTCAGGGCTGGGTGG - Intronic
1073668745 10:105563264-105563286 CCTGTGAAGGGAAGGCAGGAGGG + Intergenic
1073670299 10:105580057-105580079 CCTGTGAGGGTAGGATTGGGTGG + Intergenic
1074404155 10:113166032-113166054 CCTTTCAAGGTGGGGGTGGGGGG - Exonic
1074563242 10:114553224-114553246 CCTGGGAAGGTAGCGGTGGCTGG - Intronic
1075782781 10:125027544-125027566 CCGGTACAGGTAGGGCTCGGCGG + Exonic
1076981593 11:207673-207695 CCTGTGAACGTGGGGCGGGGCGG + Intronic
1077060942 11:617622-617644 CCTGGGGAGGCAGGGCCGGGGGG + Exonic
1077283020 11:1754092-1754114 CCTGTGCAAGGAGGGCTGTGAGG - Exonic
1077460952 11:2709236-2709258 CCTCTGCAGCTGGGGCTGGGGGG - Intronic
1078069809 11:8101065-8101087 CCAGTGTAGGCAGGGCTAGGTGG - Intronic
1078922215 11:15841302-15841324 ACAGTGTAGGTTGGGCTGGGTGG + Intergenic
1079075178 11:17381075-17381097 ACTGTGAAGGAAAGGCAGGGGGG - Intergenic
1079328644 11:19515819-19515841 GCTTTGAAGGTAGAGCTGGGAGG + Intronic
1081540779 11:44033192-44033214 TCTGTGAAGGAAGGTCAGGGAGG - Intergenic
1083225638 11:61282775-61282797 CCTGTGTAGGTAAGGCGGGGAGG - Exonic
1083514402 11:63243233-63243255 CCTGTGCATGTACGGCTGGATGG - Intronic
1083746553 11:64740149-64740171 CACTTGTAGGTAGGGCTGGGGGG + Exonic
1083753609 11:64777782-64777804 GCTGTGGGGGGAGGGCTGGGCGG - Intronic
1084968286 11:72755753-72755775 CCTGTGAGGGCAGGGAAGGGAGG + Exonic
1085322799 11:75584922-75584944 CGTGTGAAGGTCGGGCTCGATGG - Intergenic
1085334642 11:75682313-75682335 CCTGTCAAGGGAGGGCGGTGGGG - Intergenic
1085729443 11:78983781-78983803 CCTGTGGGGGTGGGGCTGGGTGG + Intronic
1088796160 11:113268443-113268465 CCTGAGGAGGAAGGGCTGGGAGG + Intronic
1089572210 11:119418374-119418396 CCTGAGAAGGCAGGCCTGCGGGG + Exonic
1090285456 11:125495748-125495770 CGTGTGAAGGCAGGGCGGCGAGG - Intronic
1091024664 11:132131528-132131550 CTTGTGAAGGAAGGGGTGTGTGG + Intronic
1091596995 12:1884946-1884968 CCTGGGAGGGGAGGACTGGGAGG - Intronic
1092099629 12:5872441-5872463 CCTGTCACAGTAGAGCTGGGTGG - Intronic
1092150291 12:6243441-6243463 CCTGTGAATGTAGGAATGGCTGG - Intergenic
1092440419 12:8496286-8496308 CCTGGGAAGTTCGGACTGGGTGG + Intergenic
1093416442 12:18926088-18926110 CCTGTGGAGGTAGGGTGGGGTGG - Intergenic
1094073523 12:26446753-26446775 CATGTGAAGGGAGGCCTAGGTGG - Intronic
1094587733 12:31793476-31793498 CCTGTAATGGTAGCACTGGGAGG + Intergenic
1096513909 12:52146101-52146123 CCTGGGAAGGCAAGGCTTGGAGG + Intergenic
1096806342 12:54143440-54143462 CGTGTGAAGGTAAGTGTGGGAGG - Intergenic
1097263943 12:57735523-57735545 CCAGTGCAGGCAGGGTTGGGGGG - Intronic
1101440856 12:104703449-104703471 CCTTTGAAAGTAGAGCTGAGAGG - Intronic
1102877106 12:116457259-116457281 CCTGTGGGGGTAGCGATGGGGGG + Intergenic
1103758991 12:123234087-123234109 CCTTCAAAAGTAGGGCTGGGTGG - Intronic
1104143500 12:126010278-126010300 CCTGTGCAGGTAGGGGGTGGGGG - Intergenic
1104784192 12:131439134-131439156 CGCGTGAAGGGAGGGCCGGGAGG - Intergenic
1104784596 12:131441274-131441296 CCTGAGGAGGTGGGGCTGTGGGG - Intergenic
1104931015 12:132339529-132339551 CCTGCGACGTGAGGGCTGGGTGG - Intergenic
1104962931 12:132496814-132496836 CCTGGGAAGGAAGCGCGGGGCGG - Intronic
1105286523 13:19008838-19008860 CATTTGCAAGTAGGGCTGGGAGG - Intergenic
1106340201 13:28820100-28820122 GCTGCGAAGGTTGGGCTGGGCGG + Intergenic
1106434095 13:29708524-29708546 TGTGTGAAGGTAGGCGTGGGGGG - Intergenic
1106454191 13:29912155-29912177 CCCTGGAAGGAAGGGCTGGGGGG + Intergenic
1106580036 13:31009886-31009908 CCTGGCAGGGCAGGGCTGGGTGG + Intergenic
1107505095 13:41026011-41026033 CCTGTGAACATAGGTCTAGGGGG - Intronic
1107830768 13:44372874-44372896 CCTGGGGAGGTAGGGGTGGAAGG - Intergenic
1110942034 13:81362838-81362860 CCTGGGAAGGTTGAGCTTGGTGG + Intergenic
1112202118 13:97286897-97286919 CCACTGAATGTAAGGCTGGGAGG + Intronic
1112562340 13:100525801-100525823 CCTGCAGAGGAAGGGCTGGGTGG + Intronic
1112802508 13:103128148-103128170 ACTGCGAAAGTAGGGTTGGGTGG - Intergenic
1113063063 13:106344746-106344768 CTTCTGAAGTCAGGGCTGGGAGG - Intergenic
1113867492 13:113536829-113536851 CCTGTGGAGGTAGGGTTGCAGGG + Intronic
1116302026 14:43195129-43195151 CCTGTCAGGGTAGAGGTGGGGGG + Intergenic
1117914888 14:60667340-60667362 CCTGTGAAGGCTGGGCATGGTGG + Intergenic
1119174120 14:72556665-72556687 CATGAGAAGGTAGGGGTCGGGGG + Intronic
1121454110 14:94027412-94027434 CCTGTGGAGTGAGGGCTGGGTGG + Intronic
1121661146 14:95636022-95636044 CATGTGAGAGTGGGGCTGGGTGG + Intergenic
1122974243 14:105164495-105164517 CCCCTGAAGGTAGGGTGGGGAGG + Intronic
1124641862 15:31400823-31400845 CCTGTGAGGGTCTGGCTGGCTGG + Intronic
1126694183 15:51312499-51312521 CCAGAGAAGCTAGGGCTGGATGG - Intronic
1127403163 15:58612594-58612616 CCTGGGATGGTGGGGCTTGGTGG - Intronic
1128715630 15:69905562-69905584 ATTGTGAAGGAAGGGCTCGGGGG + Intergenic
1129270531 15:74417175-74417197 CCTGAGAAGTTAGGGTTGGCTGG - Intronic
1132712725 16:1276630-1276652 CCTGGGAAGGGAGGGCTGTGTGG + Intergenic
1132733038 16:1372415-1372437 CCTTGGAAGGCAGGGCTGGCTGG - Intronic
1133167363 16:3957709-3957731 CCTGGGAGGGCAGGGCTAGGGGG + Intronic
1135092523 16:19530383-19530405 TCTTTGAAGATAGGGCTGGGCGG + Intronic
1136116362 16:28097411-28097433 TCTGTGAGGGTGGGGATGGGTGG - Intergenic
1136381237 16:29896911-29896933 CCTGGGGAGGCAGGGCTGGGTGG + Exonic
1136509132 16:30724993-30725015 GCAGTGGAGGGAGGGCTGGGGGG - Exonic
1136552630 16:30989694-30989716 CCTCTGCAGGGCGGGCTGGGGGG + Exonic
1137711645 16:50571067-50571089 CCTTTGAAGGGAGAGCTGAGAGG + Intronic
1138614627 16:58155282-58155304 CCAGTGAGGGAAGGGCTGGGAGG + Intergenic
1139301377 16:65948100-65948122 TCTGTGCAGGCAGGGCTGGCAGG + Intergenic
1139659947 16:68413909-68413931 CCTGTCAAGGTCTGGGTGGGTGG + Intronic
1139828902 16:69780758-69780780 CTTTGGAAGGTGGGGCTGGGAGG + Intronic
1140497088 16:75398766-75398788 CCTGTGAAGGCTGGGCGTGGTGG + Intronic
1142117706 16:88368619-88368641 CCTGAGAGGGTGTGGCTGGGAGG + Intergenic
1142126900 16:88414835-88414857 CCTGGGAAGGCAGGGCCGGGTGG - Intergenic
1142213641 16:88820641-88820663 GCTGTGAGGGCGGGGCTGGGTGG + Intronic
1142401882 16:89863235-89863257 CCAGTGAAGGCTGGGCTGGCCGG + Intronic
1142958099 17:3534989-3535011 CCAGAGAAGGAGGGGCTGGGAGG - Intronic
1143241221 17:5444736-5444758 CCTGTGAAGGTAGGGCTGGGAGG + Intronic
1143697445 17:8630775-8630797 CCAATGAGGGTAGGGGTGGGTGG - Intergenic
1144773008 17:17770082-17770104 CCTGTGATGGGAGGGGCGGGAGG + Intronic
1145040292 17:19572894-19572916 CCTGTCTAGGTAGGACTGGAGGG + Intronic
1146419168 17:32666189-32666211 CCTCTGTAGGTAGGGATGAGGGG - Intronic
1146844387 17:36174025-36174047 CCTGGGGAGGTAGGGCGGGAGGG - Intronic
1146856692 17:36261960-36261982 CCTGGGGAGGTAGGGCGGGAGGG - Intronic
1146863925 17:36326415-36326437 CCTGGGGAGGTAGGGCGGGAGGG + Intronic
1146872601 17:36385871-36385893 CCTGGGGAGGTAGGGCGGGAGGG - Intronic
1146879960 17:36436956-36436978 CCTGGGGAGGTAGGGCGGGAGGG - Intronic
1146976553 17:37118106-37118128 CCTGTGAAGGTAGGAGGGGGAGG - Intronic
1147066785 17:37927003-37927025 CCTGGGGAGGTAGGGCGGGAGGG + Intronic
1147075486 17:37986495-37986517 CCTGGGGAGGTAGGGCGGGAGGG - Intronic
1147078317 17:38006564-38006586 CCTGGGGAGGTAGGGCGGGAGGG + Intronic
1147087011 17:38066041-38066063 CCTGGGGAGGTAGGGCGGGAGGG - Intronic
1147094255 17:38130499-38130521 CCTGGGGAGGTAGGGCGGGAGGG + Intergenic
1147102956 17:38190004-38190026 CCTGGGGAGGTAGGGCGGGAGGG - Intergenic
1147255280 17:39177535-39177557 CCTGTGAAGGCGGGGTTAGGGGG + Exonic
1148239146 17:45988506-45988528 CCTATGGAGGCGGGGCTGGGGGG - Intronic
1148870627 17:50657024-50657046 GCTGTGCAGGGAGGGCAGGGAGG - Exonic
1149997065 17:61411053-61411075 CCTGCGAAGGCCGGGCGGGGCGG + Intergenic
1150289179 17:63971836-63971858 CCTGTGAAGGTGTACCTGGGGGG + Exonic
1150650108 17:67004642-67004664 CCAGTGAAGGTACAGCTGGTTGG + Intronic
1151392583 17:73797682-73797704 CCTCTGAAGGCAGTTCTGGGAGG - Intergenic
1152323486 17:79622392-79622414 CCAGAGGAGGTGGGGCTGGGAGG + Intergenic
1152493621 17:80654525-80654547 CCTGTGACTGGAGGGCTGGGTGG + Intronic
1152788714 17:82266272-82266294 CCTGTGATGCCAGGCCTGGGTGG - Intronic
1152819326 17:82428474-82428496 CCTGATGAGGAAGGGCTGGGGGG + Intronic
1152845581 17:82597599-82597621 TCTGTGAGGGCAGGGCTGGGTGG + Intronic
1203165447 17_GL000205v2_random:89021-89043 CCTGTGACGATAGGGCTGCGAGG + Intergenic
1152985216 18:314730-314752 GCTATGAAGGCAGGGCTGGCTGG + Intergenic
1153480384 18:5542608-5542630 CTTGTGGAGGTTGGGCTGGGAGG - Intronic
1153798481 18:8647105-8647127 CCTGAGAAGTTTGGACTGGGCGG + Intergenic
1153838240 18:8983353-8983375 CCTGTGAAGGCAGGTCTGAGAGG + Intergenic
1154056905 18:11021703-11021725 CTTGTGAAGGCATGGGTGGGAGG - Intronic
1154217103 18:12423353-12423375 CCTGTGGAGAGAGGGCCGGGGGG + Intronic
1154297611 18:13164312-13164334 CATTTGCAGGTAGAGCTGGGAGG + Intergenic
1154311027 18:13266288-13266310 GCTGTGAATGCAGGGCTGGAGGG - Intronic
1154377348 18:13821266-13821288 CCTGCGGAGGGAGGGATGGGAGG - Intergenic
1155395343 18:25380466-25380488 GCTGGGAAGTTAGGACTGGGCGG + Intergenic
1157412940 18:47479064-47479086 CCAGTGAAGGGAGGCCTGGGTGG - Intergenic
1157582352 18:48781029-48781051 TCCGTGAAGGCAGGGATGGGGGG - Intronic
1157597113 18:48870696-48870718 TCTGTGCAGGGAGAGCTGGGAGG + Intergenic
1157614612 18:48979081-48979103 TCTGTGCAGGGAGAGCTGGGAGG - Intergenic
1157782034 18:50448144-50448166 CCACTAAAGGTAGGGCTTGGGGG - Intergenic
1157792703 18:50546689-50546711 CCTGTGAGGGGAGGGTTGGAAGG + Intergenic
1157890488 18:51411334-51411356 GCTGTGTAGGGAGGGCTGTGGGG + Intergenic
1158227394 18:55215273-55215295 CCTGCGGAGGAAGGGCTGGGTGG - Intergenic
1159010676 18:63056628-63056650 CCTGTCAAGTTGGGGCTGGGTGG - Intergenic
1160731163 19:642374-642396 GCTGTGAGGGCCGGGCTGGGGGG + Intronic
1160731179 19:642414-642436 GCTGTGAGGGCCGGGCTGGGGGG + Intronic
1160731221 19:642538-642560 GCTGTGAGGGCCGGGCTGGGGGG + Intronic
1161249271 19:3271462-3271484 CCTCTGAGGGTGCGGCTGGGCGG + Intronic
1161543851 19:4867927-4867949 CCTGTGAAGTTGGCCCTGGGAGG + Intergenic
1161741428 19:6023199-6023221 TCTGAGAAGGGAGGTCTGGGAGG + Intronic
1161982229 19:7636059-7636081 CCACAGAAGGTAGGGGTGGGAGG - Intronic
1162080713 19:8216037-8216059 CCTGAGAAGGTAGGGAGGTGAGG - Intronic
1163114224 19:15179422-15179444 CCCGTGCTGGCAGGGCTGGGAGG + Exonic
1163159173 19:15454628-15454650 GCTGGGAAGCTAGGGGTGGGGGG - Intronic
1163584854 19:18157944-18157966 GCTGGGAAGCCAGGGCTGGGAGG + Intronic
1163597276 19:18227472-18227494 CCTCTGATGGCAGGGGTGGGCGG - Intronic
1164160911 19:22624853-22624875 CATGTGAAAGTGGGGGTGGGGGG - Intergenic
1164461697 19:28454580-28454602 CCTGGGGAGGTCCGGCTGGGTGG - Intergenic
1164719085 19:30418648-30418670 CCTCTGAAGGTGGGGTTGGCCGG + Intronic
1165311146 19:35030217-35030239 CCTGGGAAGGTGGGGGGGGGGGG + Intergenic
1165427261 19:35753065-35753087 TCTGGGAAGGTGGGGATGGGAGG - Exonic
1166137535 19:40786472-40786494 GCTCTGAAGGAAGAGCTGGGTGG + Intronic
1166295842 19:41888863-41888885 CTGGTGAGGGCAGGGCTGGGTGG + Exonic
1166327945 19:42062692-42062714 CCTGGGAGGCGAGGGCTGGGCGG - Intronic
1167503044 19:49857975-49857997 CCTGTGAGTGCTGGGCTGGGGGG + Exonic
1167618680 19:50549647-50549669 CAGGTGAAGGGAGGGCTGGGAGG + Intronic
1168319362 19:55500078-55500100 TCTGTGAGGTTAGGTCTGGGGGG - Exonic
925118117 2:1397631-1397653 CCTGTGGAGGCAGAGCTGGGAGG + Intronic
925343649 2:3154326-3154348 CCGGTGAGGGCAGGGCAGGGGGG - Intergenic
925427109 2:3758974-3758996 CCTGAGAGGGGAGGGCTGTGTGG + Intronic
925565807 2:5253034-5253056 CCTGTGAGGGCAGAGCTGGGAGG + Intergenic
925649904 2:6078771-6078793 ATCATGAAGGTAGGGCTGGGTGG + Intergenic
925753293 2:7109350-7109372 TGTGTGAAAGCAGGGCTGGGAGG - Intergenic
925975131 2:9137100-9137122 CCTGTGAACGGAGGGCTGGAGGG + Intergenic
926127194 2:10278864-10278886 CCTGAGAAGGCAGGGGTAGGGGG + Intergenic
927488618 2:23505838-23505860 CCTGTAGGGGAAGGGCTGGGAGG - Intronic
927992070 2:27454958-27454980 CCTGTCAGTGTAGGGCTGCGAGG - Intronic
930951901 2:57152871-57152893 CCTGTTGGGGTAGGGTTGGGGGG + Intergenic
932436126 2:71703478-71703500 GCTGAGAAGGCAGGCCTGGGTGG - Intergenic
933636978 2:84719450-84719472 TCTGTGAAGGGAGGCATGGGTGG - Intronic
933738664 2:85515751-85515773 CCTAGGAAGTTAGGACTGGGTGG + Intergenic
933942981 2:87260516-87260538 CCTGTTCAGGGAGGGCTGAGGGG + Intergenic
933994523 2:87658208-87658230 CCTGTGCAGGTAGGGTGTGGAGG - Intergenic
936067740 2:109344806-109344828 CCAGAGGAGGTAGGGCTGGAGGG + Intronic
936337232 2:111601046-111601068 CCTGTTCAGGGAGGGCTGAGGGG - Intergenic
942482419 2:176403592-176403614 CCTCTGGAGGTAGGGTTGTGGGG - Intergenic
943059236 2:183021114-183021136 CCTGTGAAAGAATTGCTGGGTGG - Intronic
946038358 2:216762767-216762789 CCTGTGAGGGTCGGGGTGGTTGG + Intergenic
946477709 2:220024659-220024681 CCTGTGGAAGGAGGGCTGGATGG + Intergenic
947097343 2:226581138-226581160 CCTGGGAAGGAGGGGCTTGGAGG + Intergenic
948581312 2:238988858-238988880 CCTGAGAAGGCAGCGGTGGGCGG + Intergenic
948588301 2:239034930-239034952 ACTAGGAAGGTAGGGCAGGGAGG - Intergenic
1168761713 20:354171-354193 CCTGTGGTGGGTGGGCTGGGGGG - Exonic
1168858534 20:1028098-1028120 CTTGTGAGGTTTGGGCTGGGTGG - Intergenic
1168902197 20:1374505-1374527 ACTGTGATGCTGGGGCTGGGAGG + Intronic
1169091286 20:2862730-2862752 CCGGGGAGGGTGGGGCTGGGAGG + Intronic
1171942809 20:31348085-31348107 CCTGTGGTGGTGGGGCTAGGTGG - Intergenic
1173539442 20:43840559-43840581 CCTGAGGAGGTAGGGCCTGGGGG + Intergenic
1174062860 20:47844839-47844861 TCTGTGGAGGCAGGGCTAGGAGG - Intergenic
1174151213 20:48487835-48487857 TCTGTGGAGGCAGGGCTAGGAGG - Intergenic
1174347041 20:49937693-49937715 CCTGAAAAGGGAGGGGTGGGGGG - Intronic
1175067327 20:56300397-56300419 CCTGGTAGGGTAGGGGTGGGGGG + Intergenic
1175121773 20:56721404-56721426 CCTGTGAGGGAGGGGCAGGGAGG + Intergenic
1175757668 20:61539738-61539760 CCTGTGACAGCAGGGCTTGGGGG - Intronic
1175806064 20:61830047-61830069 CCCATGAAGGTAGGGCTGTGGGG - Intronic
1176270299 20:64232767-64232789 CCTGAGAAGGTATGAATGGGAGG - Intronic
1176295607 21:5070506-5070528 CCAGACAAGGTGGGGCTGGGTGG - Intergenic
1176336237 21:5602431-5602453 CCTGTGATGAAAGGGCTGGGAGG - Intergenic
1176391520 21:6218517-6218539 CCTGTGATGAAAGGGCTGGGAGG + Intergenic
1176406305 21:6370058-6370080 CCTGTGATGATAGGGCTGCGAGG - Intergenic
1176469899 21:7097657-7097679 CCTGTGATGAAAGGGCTGGGAGG - Intergenic
1176493460 21:7479435-7479457 CCTGTGATGAAAGGGCTGGGAGG - Intergenic
1176507182 21:7658948-7658970 CCTGTGATGAAAGGGCTGGGAGG + Intergenic
1179861442 21:44191618-44191640 CCAGACAAGGTGGGGCTGGGTGG + Intergenic
1180230126 21:46422116-46422138 CACGTGAAGGTATGGCTGGCAGG + Exonic
1180339319 22:11605654-11605676 CGAGTGAAGGTGGGGCGGGGAGG + Intergenic
1180741581 22:18056913-18056935 CCTGTGATGGGAGGGCTGGAGGG - Intergenic
1180898247 22:19352965-19352987 CCAGGGCAGGAAGGGCTGGGAGG + Intronic
1181059683 22:20276424-20276446 CCTGTGAAGGTTGGGCAGGGGGG - Intronic
1181179475 22:21056751-21056773 CCTGGGAGGGAAAGGCTGGGAGG - Intronic
1182232143 22:28846401-28846423 CCAGGGAAGGTGGGGCTGGATGG + Intergenic
1182614431 22:31577348-31577370 GCTGTGGAGGTAGGGATGGTGGG + Intronic
1182805301 22:33064654-33064676 GTTGAGAAGGTAGGGCTGGAGGG + Intergenic
1183463466 22:37967109-37967131 CCTGTGATGGTGGAGCTGGAGGG + Exonic
1183688399 22:39374971-39374993 CCTGCCAAGGTCTGGCTGGGAGG - Intronic
1184291139 22:43498741-43498763 CCTGGGGATGTTGGGCTGGGTGG - Intronic
1185184644 22:49391696-49391718 ACCGTGGAGGGAGGGCTGGGCGG - Intergenic
949949840 3:9220024-9220046 GCTGGGAAGGTAGGGTGGGGCGG + Intronic
950260429 3:11539458-11539480 CCAGGGAAGGTTGGGCTGGAAGG + Intronic
950296777 3:11838790-11838812 TCTGTGAAGGTGGGAGTGGGGGG + Intronic
950424411 3:12917013-12917035 CCTGAGCAGGTGGGGCAGGGTGG + Intronic
950583674 3:13878939-13878961 TCTGTGGAGGTGGGGCTCGGGGG - Intronic
951580718 3:24159988-24160010 CCTTTGAAGGCAGGGCTGGTTGG + Intronic
953152070 3:40333788-40333810 CCTGTGTAGTTGGGGCGGGGAGG - Intergenic
953390936 3:42533405-42533427 TCTGAGAAGGAAAGGCTGGGGGG + Intronic
953567470 3:44045094-44045116 CCTGTGCAGCTGGGGCTGGAGGG - Intergenic
953791545 3:45951531-45951553 CCTGTGGAGTAAGGGCTGGCAGG - Intronic
953941568 3:47103546-47103568 CCAGTTAAGGTAGGGCAGTGAGG + Intronic
955320661 3:57972123-57972145 GGTGTGGAAGTAGGGCTGGGTGG + Intergenic
956250472 3:67229660-67229682 CCTGTGAACCAATGGCTGGGTGG - Intergenic
959967148 3:112369188-112369210 CCTGTCAGGGGAGGGTTGGGTGG - Intergenic
961399766 3:126630698-126630720 CCTGTGATGGTAAGGCTGCATGG - Intronic
961505784 3:127369856-127369878 CCAGTGAGGGTGGGGCTGGGTGG - Intergenic
964159618 3:153631096-153631118 TCTGTGAAGGAAGGGCAGGCAGG - Intergenic
964473629 3:157079209-157079231 CCTGAGAATCTAGGGCAGGGTGG + Intergenic
964523604 3:157593573-157593595 CCTGTGCAGGTAGGCATGGCTGG + Intronic
966131006 3:176639793-176639815 CCTGTTAAGGGAGTGCAGGGAGG - Intergenic
966618997 3:181944090-181944112 TCTGTGTACATAGGGCTGGGGGG - Intergenic
966848159 3:184146525-184146547 TCTGGGACGGTAGGGATGGGGGG - Intronic
967257801 3:187611297-187611319 CCTGTGAAGGGAGGGGTTGTTGG - Intergenic
967454257 3:189664153-189664175 CCTTTAAAGGCAGGGCTTGGGGG - Intronic
968320513 3:197763982-197764004 CCTGTAGAGGTAGGGCTTGGAGG + Intronic
968460328 4:721581-721603 CCTGTGAAAGGAGTCCTGGGGGG - Intronic
968950281 4:3687890-3687912 CATCTGGAGGTGGGGCTGGGTGG + Intergenic
969739829 4:9016161-9016183 TCGGTGAAGGGATGGCTGGGTGG - Intergenic
973900431 4:55464580-55464602 CCTGTAAAGGTAGGACTAGAGGG + Intronic
978564935 4:110071627-110071649 ACTGTGGAGGGAAGGCTGGGCGG - Intronic
980226817 4:129998177-129998199 CCTGTGGTGGTAGGGCTAGCTGG - Intergenic
980741560 4:136956311-136956333 CCTGTCAGGGTAGGGAAGGGAGG + Intergenic
980769349 4:137351258-137351280 CCTGGGAAGTTTGGACTGGGTGG + Intergenic
980793530 4:137651101-137651123 CCTGTGGAGGTCGGGCATGGTGG + Intergenic
981515120 4:145599407-145599429 CCTGAGAAATTAGGGCTAGGAGG - Intergenic
982123125 4:152160989-152161011 TCTGTGACGCTGGGGCTGGGGGG + Intergenic
984653337 4:182291868-182291890 GCTGTGTGTGTAGGGCTGGGAGG + Intronic
985028352 4:185762248-185762270 CCTGGGAAGGAAGAGCAGGGTGG + Intronic
985567308 5:625807-625829 CCTGTGAGAGCAGGGCTGGAGGG - Intronic
985653837 5:1119808-1119830 CCTGTGATGGGCAGGCTGGGGGG + Intergenic
986797941 5:11230905-11230927 ACTGAGGAGGGAGGGCTGGGTGG - Intronic
987040179 5:14055051-14055073 CCTCAGAAGGTTGGGGTGGGAGG + Intergenic
988994222 5:36698912-36698934 GCTTTGAAGGTAGTGCTAGGAGG + Intergenic
990603597 5:57385278-57385300 CCTGTGTAGCTATGTCTGGGTGG - Intergenic
992052428 5:72953752-72953774 CCTGAGTGGGTAGTGCTGGGTGG - Intergenic
992069603 5:73136680-73136702 CCTGGGAAGATAGGACTGAGTGG + Intergenic
995254230 5:110028244-110028266 CCAGTGAGGGGAAGGCTGGGAGG - Intergenic
997224009 5:132195241-132195263 CCTGTGAAGAAAGGACAGGGAGG - Intronic
997440858 5:133907739-133907761 CATGGGAAGGGAGGGCAGGGAGG - Intergenic
997471030 5:134116926-134116948 CCAGTGCAGGTGGGGCTGGCAGG + Intronic
999257613 5:150218406-150218428 CAAGTGAAGGCAGGGCTGGGAGG + Intronic
1001399247 5:171437088-171437110 CCTGAGAAGGCAGGAATGGGTGG - Intronic
1001572725 5:172741133-172741155 CATGTGTAGGTGGTGCTGGGGGG - Intergenic
1002857117 6:1047918-1047940 CCTGTGGAGGTCGGGGTGGGTGG - Intergenic
1003936055 6:10976510-10976532 CCTGAAAAGGCAGGGCGGGGTGG + Intronic
1004344147 6:14832724-14832746 CCTGAGCAGGAAGGGGTGGGTGG + Intergenic
1004541997 6:16559970-16559992 CCTGTGATGGTGGGGTGGGGAGG - Intronic
1004650055 6:17600220-17600242 GCTGGGAAGGGAGGGCGGGGAGG - Intergenic
1006173573 6:32108992-32109014 CCTGTGAAGGAGTGTCTGGGAGG - Intronic
1007377506 6:41466904-41466926 CCTGTGTAGGCAGGTCTGGTTGG - Intergenic
1007712715 6:43834899-43834921 CCTGTGGAGGGAGGGCTGCCTGG - Intergenic
1009845176 6:69125505-69125527 CATGTGAAGACAGGGCTGGAAGG + Intronic
1012490709 6:99780091-99780113 CTTGTGCAGGTGGGGCTGGCTGG + Intergenic
1012649789 6:101738507-101738529 GCTGTGAAGATAGGGCAGGTGGG - Intronic
1013429820 6:110045626-110045648 TCTGGTAAGGTGGGGCTGGGGGG + Intergenic
1017318595 6:153062094-153062116 CTTGTGAAGGGTGGGGTGGGCGG - Intronic
1020333415 7:7042425-7042447 CCTGGGATGGTAGAGCTTGGTGG + Intergenic
1020759123 7:12246171-12246193 CCTGTAAGGGTGGGGCTGGGAGG + Intergenic
1020789265 7:12605334-12605356 CCTGAGAAGGCCGGGCAGGGTGG - Intronic
1024610441 7:51059633-51059655 CCTGGTCAGGTAGGGGTGGGTGG + Intronic
1025982789 7:66420968-66420990 CCTGCGAAGTAAGGGGTGGGGGG - Intergenic
1026066199 7:67075328-67075350 CCTGTGAAGTGGGGGCAGGGTGG + Intronic
1026564530 7:71478741-71478763 TCTGTGAAGATAGGGGTAGGAGG + Intronic
1027405494 7:77855619-77855641 CCTGTGGTGGTAGGGCTAGCCGG + Intronic
1028787414 7:94811355-94811377 CCTGGGGAGGCAGGGCAGGGGGG + Intergenic
1029371553 7:100154079-100154101 CCCGTCCAGGTAGGGGTGGGAGG - Exonic
1029689402 7:102170965-102170987 GCTGGGAGGGTAGGGGTGGGCGG + Intronic
1032627885 7:133612428-133612450 CCTGAGAAGGTAGGGAAGTGAGG + Intronic
1032996724 7:137455203-137455225 CCTGAGAAGGGTGGGGTGGGAGG - Intronic
1035053558 7:156018592-156018614 ACAGAGAAGGCAGGGCTGGGAGG - Intergenic
1035826725 8:2653089-2653111 CCTGGGAGGGGACGGCTGGGAGG - Intergenic
1036633690 8:10532787-10532809 CCTGTGAAGGAAGGGGATGGGGG + Intronic
1036651809 8:10649005-10649027 CGCATGAAAGTAGGGCTGGGAGG - Intronic
1038084592 8:24180522-24180544 CCTAAGAAGGTGGGGGTGGGGGG + Intergenic
1038474845 8:27858273-27858295 AGTGTGATGGTAGGGATGGGTGG + Intergenic
1038534543 8:28344430-28344452 GCTGCGAAGGTAGGGGTAGGGGG + Intergenic
1039568953 8:38571628-38571650 CCTGTGAAGTCAGAGCTGAGCGG + Intergenic
1039888871 8:41671252-41671274 CCTTTGAAGGAGGGGCTGGTGGG - Intronic
1040842466 8:51799230-51799252 CCTGTGGGGGCAGGGCAGGGAGG + Intronic
1043138962 8:76564038-76564060 CCTGGGAAGGATGGACTGGGTGG - Intergenic
1045293347 8:100852155-100852177 CCTGTGAAGTTAAAGCAGGGGGG + Intergenic
1046587446 8:116165032-116165054 CATGTGAGGATAGGGCTGGGAGG + Intergenic
1048208693 8:132436826-132436848 CCTCAGAAGGTAGGGCTGGAAGG + Intronic
1048255435 8:132901632-132901654 GCTGGGAAGGCAGGGGTGGGAGG + Intronic
1049096228 8:140549855-140549877 CTTGTGAAGCTGGGGCGGGGTGG + Intronic
1049250110 8:141583721-141583743 CCTGGGACAGTGGGGCTGGGTGG + Intergenic
1049283901 8:141764281-141764303 CTGGTGAAGGGAGGGCTGGGAGG + Intergenic
1049521163 8:143092130-143092152 CCTGTGAGGATAGGGCTGGAGGG + Intergenic
1049680487 8:143915836-143915858 CCTGTGCAGCTAGGACTGGCAGG + Exonic
1051196406 9:14566630-14566652 CCTAGGAAGGCAGGGGTGGGCGG + Intergenic
1052090092 9:24317130-24317152 CCTGGGAAGGTCCGGGTGGGAGG - Intergenic
1052672045 9:31570638-31570660 GCTGTGTAGGTGGGGGTGGGAGG - Intergenic
1057273335 9:93663143-93663165 CCTGAGTAGGTAGTGCTGTGGGG + Intronic
1058651761 9:107181660-107181682 CCTGTGAAGGTCGGGGAGCGGGG - Intergenic
1060401554 9:123352782-123352804 CCTGTGAGAGCTGGGCTGGGAGG + Intergenic
1061001268 9:127904355-127904377 ACTGTGGGGGAAGGGCTGGGGGG - Intronic
1061802373 9:133119669-133119691 CCTGGGAGGGTGGGGGTGGGAGG - Intronic
1062326852 9:136016637-136016659 CCTGTGAGGGCAGGACTAGGTGG - Intronic
1062378803 9:136276932-136276954 CATGTCGAGGAAGGGCTGGGAGG + Intergenic
1062394364 9:136346802-136346824 GCTGTGCAGGTGAGGCTGGGAGG + Intronic
1062518668 9:136948253-136948275 CCTCTGACTGCAGGGCTGGGTGG + Intronic
1203425406 Un_GL000195v1:32471-32493 CCTGTGATGAAAGGGCTGGGAGG + Intergenic
1185893004 X:3836596-3836618 CCAGGAAAGGTAAGGCTGGGGGG + Intronic
1185898113 X:3875016-3875038 CCAGGAAAGGTAAGGCTGGGGGG + Intergenic
1185903231 X:3913447-3913469 CCAGGAAAGGTAAGGCTGGGGGG + Intergenic
1187249541 X:17584303-17584325 CCTGGGGAGGGAGGGCAGGGTGG + Intronic
1187855304 X:23631308-23631330 GCTGGGAAGGTAGTGCTGGTAGG + Intergenic
1188451833 X:30315622-30315644 GCTGGGAAGGTTGGGCAGGGAGG - Intergenic
1189104312 X:38220695-38220717 CCTGGGAAGCTGCGGCTGGGCGG + Exonic
1191115421 X:56847111-56847133 GCTGGGAAGTTAGGACTGGGTGG + Intergenic
1191902564 X:66054978-66055000 CCTGTGAAGGGAGGGTAAGGTGG + Intergenic
1192056520 X:67779328-67779350 GCTGTGAAGGCAGGCCAGGGAGG + Intergenic
1192175202 X:68880921-68880943 CCTGGGAAGGGGGGGCAGGGAGG - Intergenic
1195235296 X:102890663-102890685 CCTGTGCAGGTAGGGTGTGGGGG + Intergenic
1195615229 X:106906652-106906674 CCTGAGAAGAGAGGGCTGGAGGG - Intronic
1196711116 X:118764181-118764203 GCTGGGAAGGTGGGGGTGGGGGG - Intronic
1197146527 X:123178409-123178431 CCTCCCCAGGTAGGGCTGGGAGG + Intergenic
1199801217 X:151253007-151253029 CCTGGGACGGTAGAGCTTGGTGG + Intergenic
1200011169 X:153122104-153122126 CCTGGGAAGGTATGGGTGCGGGG + Intergenic
1200028430 X:153277818-153277840 CCTGGGAAGGTATGGGTGCGGGG - Intergenic