ID: 1143241222

View in Genome Browser
Species Human (GRCh38)
Location 17:5444737-5444759
Sequence CTGTGAAGGTAGGGCTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 440}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241213_1143241222 -1 Left 1143241213 17:5444715-5444737 CCAGAAACAGGGAAACTACCGCC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1143241222 17:5444737-5444759 CTGTGAAGGTAGGGCTGGGAGGG 0: 1
1: 0
2: 0
3: 48
4: 440
1143241209_1143241222 19 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241222 17:5444737-5444759 CTGTGAAGGTAGGGCTGGGAGGG 0: 1
1: 0
2: 0
3: 48
4: 440
1143241210_1143241222 18 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241222 17:5444737-5444759 CTGTGAAGGTAGGGCTGGGAGGG 0: 1
1: 0
2: 0
3: 48
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241222 Original CRISPR CTGTGAAGGTAGGGCTGGGA GGG Intronic
900231147 1:1558753-1558775 TTGTGAAAGGAGGGCTGGGGTGG - Intronic
900361305 1:2290289-2290311 CTGTGAGGGTGTGGCTGTGATGG + Intronic
900438197 1:2641220-2641242 GTGTGTGGGGAGGGCTGGGAAGG + Intronic
900518426 1:3094259-3094281 CTGTGGAGGCAGGGTGGGGATGG - Intronic
900597881 1:3490727-3490749 CTGGGAAGGACAGGCTGGGAAGG - Intronic
900982730 1:6055710-6055732 GGGTGAAGGTGGGGCGGGGAGGG + Intronic
901195359 1:7437133-7437155 CGGGGAGGATAGGGCTGGGAAGG - Intronic
901364853 1:8738139-8738161 CCGTGAAGAGAGGGCAGGGAAGG - Intronic
901377367 1:8848974-8848996 GAGAGAAGGAAGGGCTGGGATGG + Intergenic
901379321 1:8862510-8862532 ATGTGGAGCCAGGGCTGGGAGGG - Intronic
901467171 1:9429678-9429700 CAGAGAAGGTGGGGCAGGGATGG - Intergenic
901798347 1:11692937-11692959 CTGTGGAGGAAGGGAGGGGAGGG + Intronic
903506253 1:23837830-23837852 GTGGGAAGGAAGTGCTGGGAAGG + Intronic
903658126 1:24961154-24961176 CTGAGAGGGGAGGGCTGGGTGGG + Intronic
903710141 1:25317246-25317268 CTGTGAGGCCAGGGCAGGGAAGG + Intronic
903716975 1:25375160-25375182 CTGTGAGGCCAGGGCAGGGAAGG - Intronic
905862158 1:41359081-41359103 CTGTGAAGGTAGTGCTATTATGG + Intergenic
905881770 1:41468605-41468627 CAGTGAAGGCAGGGGTGGGGTGG + Intergenic
906381480 1:45334751-45334773 CTGTGAGGCCAGGGCTGGGATGG + Intronic
906524650 1:46487211-46487233 CTGTGAAGGTGGGTCTGGCCTGG + Intergenic
907615503 1:55920719-55920741 CTGTGAAAGGGGGGGTGGGAAGG + Intergenic
907808491 1:57844820-57844842 CTATGAAGGAAGGGCTGCCAGGG - Intronic
909921027 1:81380004-81380026 CTGATAAGGGAGTGCTGGGAAGG - Intronic
910922796 1:92367492-92367514 TTCAGAAGTTAGGGCTGGGAAGG - Intronic
911937931 1:104004538-104004560 CTGGGATGGAAGGTCTGGGATGG + Intergenic
912307585 1:108585634-108585656 CTTTGAAGGAAGGTCTGGGGAGG - Intronic
914435858 1:147658766-147658788 CTGTGGAGGTCAGGCTGGCAGGG + Intronic
914878537 1:151530129-151530151 CTGAGCAGAGAGGGCTGGGAGGG - Intronic
915021210 1:152780048-152780070 CTGGGAAGCTAGGGATGGAAAGG - Intronic
915120893 1:153629037-153629059 CTGTGGAGGTCGAGTTGGGAAGG - Intronic
917259429 1:173150635-173150657 CTGTGGAGGTAGGAGTGGGTGGG - Intergenic
920509271 1:206538671-206538693 CTCTGAAGGTTGGGCTGGCCTGG - Intronic
920869413 1:209781633-209781655 CTGTGAAAGTTGGGCTTTGATGG - Exonic
921259913 1:213377044-213377066 CTGGGAAGGTAAGTCTGGGAAGG + Intergenic
921292547 1:213672003-213672025 CTGTGTGGGTAGGGTTGGGGTGG - Intergenic
922037350 1:221862171-221862193 GTGTGACGGGAGGGCTAGGAAGG - Intergenic
922895673 1:229098154-229098176 CTGTGAAGGATGGGGTGGGGTGG + Intergenic
923363062 1:233231732-233231754 CTGGGAAGGCAGGGTTGGTAGGG + Intronic
924082702 1:240415991-240416013 CTGTGAATTTAGGGCTGGGCAGG - Intronic
924947787 1:248857813-248857835 CTGTGCAGGTAGGTAGGGGATGG - Exonic
1062830502 10:602356-602378 CTGTGGTGTTAGGGCTGCGATGG - Intronic
1063624836 10:7679303-7679325 ATGTGGAGGTGGGGCAGGGAGGG + Intergenic
1063949864 10:11212337-11212359 CTGTGAAGGCAGGCCCGGGGGGG - Intronic
1064624513 10:17248550-17248572 CAGTGCAGGTAGGGCTGAGGTGG + Intergenic
1065481205 10:26195611-26195633 CTGGGAAGGAAGGGCTGGAGTGG - Intronic
1065957530 10:30706310-30706332 CTGTCAAGGAAGGGAAGGGAAGG - Intergenic
1067530198 10:47065472-47065494 GACTGAAGGTAGGGATGGGAGGG + Intergenic
1067833250 10:49622143-49622165 CTGGACAGGTAGGACTGGGAGGG + Exonic
1067847793 10:49737256-49737278 CAGTAGAGGGAGGGCTGGGAAGG - Intronic
1068890044 10:62139340-62139362 CAGAGAAGGCAGGGCTGGGTGGG - Intergenic
1069425885 10:68288330-68288352 CAGTGAAGGGATGGCAGGGATGG + Intronic
1069807993 10:71137913-71137935 AAGTGAAGGTGGGGCTGGGGTGG + Intergenic
1070365900 10:75736932-75736954 TGGGGAAGGCAGGGCTGGGATGG + Intronic
1070577105 10:77687470-77687492 CAGGGATGGTAGGACTGGGAGGG + Intergenic
1070718863 10:78742710-78742732 CTGTGAAAGCAGGGATGGCAAGG - Intergenic
1070785234 10:79158726-79158748 CCCTGGAGGTGGGGCTGGGAAGG + Intronic
1070888019 10:79921745-79921767 ATGTGGAGGTATAGCTGGGAAGG + Intergenic
1071440890 10:85692907-85692929 CTGTAAAGGTAAGGCTGTAAAGG + Intronic
1072175419 10:92916089-92916111 CCGTGAAGGGAGGGCTGTCATGG + Intronic
1072608600 10:97002455-97002477 CTGTGAAGTCAGGGCTGGGTGGG - Intronic
1072899662 10:99395815-99395837 CTGTGAAGAGATGGGTGGGAGGG + Intergenic
1073670300 10:105580058-105580080 CTGTGAGGGTAGGATTGGGTGGG + Intergenic
1074765755 10:116698948-116698970 CAGTGAAGGTGGGGCCTGGAGGG - Intronic
1076160985 10:128244184-128244206 CAGAGAAGGCAGAGCTGGGATGG - Intergenic
1076981594 11:207674-207696 CTGTGAACGTGGGGCGGGGCGGG + Intronic
1077364185 11:2154894-2154916 CTGTGGAGGCCGGGCTGGGGTGG + Intronic
1078526144 11:12103071-12103093 GTGTGAAAGTAGGGGTGGGGAGG + Intronic
1079444535 11:20546919-20546941 CTGTGAGGGAAAGGCTGAGATGG - Intergenic
1079613926 11:22467430-22467452 CTGGGATGATAGGGCAGGGATGG + Intergenic
1080324968 11:31061013-31061035 CTGGGAAGGAAGGGCTGGTTAGG + Intronic
1081816373 11:45945842-45945864 CTGTGGAGGTGGGGCTGGGCAGG + Exonic
1081997787 11:47376364-47376386 CTGTGAGAGTGGGGCTGGGCAGG - Intronic
1083153253 11:60806914-60806936 CTGTGAAAGTAGGCCGGGCACGG - Intergenic
1083616664 11:64029620-64029642 CTGCGCAGGGTGGGCTGGGAAGG - Intronic
1083630653 11:64093562-64093584 CTGGGAGGGAAGGACTGGGAGGG - Intronic
1083753608 11:64777781-64777803 CTGTGGGGGGAGGGCTGGGCGGG - Intronic
1083863274 11:65437965-65437987 CAGAGAGCGTAGGGCTGGGATGG + Intergenic
1084111088 11:67014643-67014665 CAGTGGAGGTAGGACTGGGGTGG + Intronic
1084506182 11:69569928-69569950 GTGGGAAGGGAGGGCTAGGAGGG - Intergenic
1085045639 11:73351567-73351589 GTGTGAAGATAGAGCAGGGAGGG - Intronic
1085276106 11:75301409-75301431 CTAGGAGGGTAGGGCTGTGAAGG + Intronic
1085729444 11:78983782-78983804 CTGTGGGGGTGGGGCTGGGTGGG + Intronic
1086376974 11:86210877-86210899 CTGAGCAGATAGGGCTGGAAAGG - Intergenic
1086498421 11:87427226-87427248 CTGAGATGGAAGGGCTGGGCTGG + Intergenic
1086592786 11:88535193-88535215 TCGTGAAGGTAAGGATGGGATGG - Intronic
1087420114 11:97912220-97912242 CTGATAAGTTAGGGCTGGAATGG - Intergenic
1087936539 11:104039950-104039972 CTGAGAAGGTAGGGTGGGTATGG - Intronic
1088315188 11:108499284-108499306 CTGTGAACAGAGGGCTGTGAGGG - Intergenic
1088917152 11:114236259-114236281 CTATGAAGTTAGGGTTGGAAAGG + Intronic
1089298698 11:117484937-117484959 GTGTGTAAGTGGGGCTGGGAGGG + Intronic
1089644116 11:119866701-119866723 ATGTGAAGATAGGTCTGGGGTGG - Intergenic
1090202237 11:124865267-124865289 CTGTAGAGGTAAGGGTGGGAGGG + Intergenic
1090637657 11:128701200-128701222 CTGGGAAGGAAGGGATGAGAAGG - Intronic
1090726710 11:129533593-129533615 AGGTGAAGGTGGGGTTGGGAAGG + Intergenic
1091078062 11:132639854-132639876 CTGCTAAGGTAGCACTGGGATGG + Intronic
1092148992 12:6234042-6234064 TTGAAAAGGTGGGGCTGGGAAGG + Intronic
1093416441 12:18926087-18926109 CTGTGGAGGTAGGGTGGGGTGGG - Intergenic
1094869212 12:34580176-34580198 CTGTGAAGGGATATCTGGGAGGG - Intergenic
1095983206 12:47984276-47984298 CTGGGAAGGAAGGGAGGGGAAGG - Intronic
1096513910 12:52146102-52146124 CTGGGAAGGCAAGGCTTGGAGGG + Intergenic
1096806341 12:54143439-54143461 GTGTGAAGGTAAGTGTGGGAGGG - Intergenic
1097938082 12:65275947-65275969 CTCTGAAGGCAGGGTTGGGAAGG - Intergenic
1099985245 12:89654897-89654919 TTGTAAAGGCAGGGATGGGAAGG - Intronic
1101085822 12:101234810-101234832 GTGTGAAGGTAGGGAAAGGAGGG - Intergenic
1102082035 12:110106341-110106363 CTGTGTAGGAAGGGTCGGGAAGG - Intergenic
1103106513 12:118231242-118231264 CTGTGTAGATAGGGCAGGGGTGG + Intronic
1104067611 12:125318512-125318534 CTGTCAGGGTGGGGGTGGGAAGG - Intronic
1104079057 12:125414579-125414601 CAGTGCAGGCTGGGCTGGGAAGG - Intronic
1104784191 12:131439133-131439155 GCGTGAAGGGAGGGCCGGGAGGG - Intergenic
1105708120 13:22981482-22981504 CTGTAAAGTGAGGGCTGGGCTGG - Intergenic
1105892221 13:24689927-24689949 CACTGAAGGTGGGGCTGGGGAGG - Intronic
1106158898 13:27183339-27183361 CAGCGATGGGAGGGCTGGGAAGG - Intergenic
1106192669 13:27467299-27467321 CTGCCAAGGTAGGAATGGGAGGG - Intergenic
1106434094 13:29708523-29708545 GTGTGAAGGTAGGCGTGGGGGGG - Intergenic
1106448361 13:29857377-29857399 GTGTGAAGGGGGGGCTGTGAGGG - Intergenic
1106549450 13:30758792-30758814 ATGTGAAGGGAGGGAAGGGAAGG - Intronic
1107045275 13:35986694-35986716 CTTTGGAGGTAGGGCAGGGGAGG + Intronic
1107830767 13:44372873-44372895 CTGGGGAGGTAGGGGTGGAAGGG - Intergenic
1108157541 13:47601547-47601569 ATGTGAAGGCAGGGATGGGGAGG - Intergenic
1108671002 13:52688497-52688519 CTGTGAAGGTAGGGCAAAGAAGG + Intronic
1109476352 13:62884715-62884737 CTGTGTAGCTAGTTCTGGGATGG + Intergenic
1110842800 13:80161988-80162010 CAGGGAAGGCAGGGCAGGGATGG + Intergenic
1112407753 13:99136126-99136148 CTGGGAAGGGAGGCCTGGCAGGG + Intergenic
1113676597 13:112211536-112211558 CTGTGTAGACAGTGCTGGGAAGG - Intergenic
1113801868 13:113090923-113090945 CAGTGAAGGAGGGGCCGGGAGGG - Intronic
1113913870 13:113859788-113859810 CTGTCAAGGCAGGGCAGGGGAGG + Intronic
1115534694 14:34362192-34362214 CTGTGATGGAAAGGCTGAGAAGG - Intronic
1115537177 14:34384419-34384441 CTGTGAGCCTAGGGCTGGGATGG - Intronic
1117481321 14:56148266-56148288 CTGTGAAGGATGGACTGGAATGG - Intronic
1117555642 14:56880448-56880470 CTGTGTTGCTGGGGCTGGGATGG - Intergenic
1117806256 14:59493939-59493961 TTGGGAAGGTAGGGGTGGGAAGG + Intronic
1118203732 14:63702105-63702127 AGGTGAAGGTAGGACGGGGAAGG + Intronic
1118550050 14:66940201-66940223 CTGTGAAGAGAGGACAGGGAAGG + Intronic
1119421374 14:74509719-74509741 CTGTGAAGGTAACCCTGGGGAGG - Exonic
1119757228 14:77127724-77127746 ATGTGGAGGAGGGGCTGGGAGGG + Intronic
1122202499 14:100131028-100131050 GAGTTAAGGTAAGGCTGGGAAGG + Intronic
1122408857 14:101516015-101516037 CTGTTCAGGTGGGGCTGGGGAGG - Intergenic
1123538116 15:21260280-21260302 CTGTGAAATGAGGGATGGGAGGG - Intergenic
1123795203 15:23763910-23763932 CTGTGAATGTGGGGTTGGAAGGG + Intergenic
1123971054 15:25508088-25508110 CTGTGCAGGTGGGGCGGGAATGG + Intergenic
1124595137 15:31086073-31086095 CTGTGAAGGTAGTTCTCTGAAGG - Intronic
1124938432 15:34194617-34194639 GTGTGGAGGTGGGGTTGGGAAGG + Intronic
1125797037 15:42410670-42410692 CTGAGAAGGAAGGGGTGGCAGGG + Intronic
1126330207 15:47523390-47523412 CTGTGAATCAAAGGCTGGGAAGG + Intronic
1126815252 15:52447681-52447703 CAGTGAAGGCAAGGCTGAGAGGG + Intronic
1127660663 15:61097429-61097451 CTGTGAAGGGAGGGAGGAGAGGG - Intronic
1127962321 15:63898973-63898995 TTGAGGAGGCAGGGCTGGGAGGG - Intergenic
1128495847 15:68198100-68198122 CCGTGGAGGAGGGGCTGGGATGG - Intronic
1128642659 15:69351117-69351139 CTGTGAAGGGAGGGCTATTATGG + Intronic
1129231180 15:74197954-74197976 CTGAGAAGGTGGGACTGGGAAGG - Intronic
1129774860 15:78230035-78230057 TTGTGGAGGAAGGGCTTGGAAGG - Intronic
1130656822 15:85797345-85797367 CTGTGCAGGGAGCTCTGGGAGGG + Intergenic
1130659326 15:85817850-85817872 CTGTCAAAGTATGTCTGGGATGG - Intergenic
1130903552 15:88224738-88224760 CTGGGAAGGTAGGGTTGATAAGG + Intronic
1131230599 15:90656161-90656183 CTGTGAAGGGAAGGAAGGGAAGG + Intergenic
1131383827 15:91986203-91986225 CTGTCCAGGTAGGGGTGTGATGG + Intronic
1131916973 15:97277840-97277862 CAGTGAAAGCAGGGCTGTGAGGG - Intergenic
1132073557 15:98800621-98800643 AGGTGGAGGGAGGGCTGGGAGGG - Intronic
1132075660 15:98817846-98817868 CTGGGAAAGTAGGGCTGGGGTGG - Intronic
1132172922 15:99681326-99681348 CTCTGAAGGTGGGGATGGGATGG + Intronic
1132185330 15:99798325-99798347 CTGGGAAAGTGGGGCTGGAAAGG + Intergenic
1132431657 15:101766206-101766228 CTGGGAAAGTGGGGCTGGAAAGG - Intergenic
1132640471 16:976028-976050 CTCTGAAGGTTGAGCTTGGAAGG + Intronic
1132712726 16:1276631-1276653 CTGGGAAGGGAGGGCTGTGTGGG + Intergenic
1132846990 16:2005243-2005265 CTGTGAGGGTCGGGCTGGAGAGG - Intronic
1132860833 16:2070981-2071003 CTGAGAGGGCAGGGCAGGGATGG + Intronic
1133403369 16:5504744-5504766 CTCTGAAGGTGGGGCTGGTGAGG - Intergenic
1135092524 16:19530384-19530406 CTTTGAAGATAGGGCTGGGCGGG + Intronic
1135763477 16:25156578-25156600 CACTGAAGGAAGAGCTGGGAAGG + Intronic
1136116361 16:28097410-28097432 CTGTGAGGGTGGGGATGGGTGGG - Intergenic
1136170901 16:28488727-28488749 AAGTGAAGGCAGAGCTGGGACGG - Intronic
1136381238 16:29896912-29896934 CTGGGGAGGCAGGGCTGGGTGGG + Exonic
1137496780 16:48975570-48975592 CTGTGAAGGTGGGGTTAGGTTGG - Intergenic
1138478119 16:57284028-57284050 GAGGGAAGGGAGGGCTGGGAAGG + Intronic
1138537336 16:57667028-57667050 CTCTGCAGGGAGGGCTGCGAAGG - Intergenic
1138655113 16:58486952-58486974 CTGTGAAGATGGGCCAGGGAGGG - Intronic
1140650477 16:77082743-77082765 ATGTGATTGTAGGGCAGGGAGGG - Intergenic
1140764758 16:78146644-78146666 CTCAGAAGGGAGAGCTGGGAAGG - Intronic
1141276538 16:82593455-82593477 CTGTGATGTGAGGGATGGGATGG + Intergenic
1141576309 16:84966368-84966390 CTGGGAAGCGAGGGCTGGGCTGG - Intergenic
1143053368 17:4144350-4144372 CTGTGAGGGTAGGGGCGGGGCGG - Intronic
1143137380 17:4719419-4719441 ATGTGAGGGTGGGGCTGGGGCGG + Exonic
1143241222 17:5444737-5444759 CTGTGAAGGTAGGGCTGGGAGGG + Intronic
1143610472 17:8015106-8015128 CTGCGCAGGAAGGGCTGGGCTGG - Intronic
1144110168 17:12022716-12022738 CTGTGAAGATGGGGGAGGGAAGG + Intronic
1144265345 17:13563130-13563152 TGGAGAAGGCAGGGCTGGGAAGG - Intronic
1144327783 17:14198199-14198221 CTGAGGAGGTAGGGGAGGGAGGG + Intronic
1147318661 17:39633123-39633145 CTGCTCAGATAGGGCTGGGAAGG - Intronic
1147326112 17:39670370-39670392 CTCAGAAGGTTGGGCTGTGAGGG + Exonic
1147498996 17:40944195-40944217 CTTTAAAGGTAGGAGTGGGAGGG - Intergenic
1147655640 17:42089073-42089095 GTGTGAAGATGGGACTGGGAGGG - Intergenic
1147811787 17:43175776-43175798 CTGTGAGGCTAGGGTTGAGAAGG - Exonic
1148045746 17:44743146-44743168 CAGTGATGCTAGGCCTGGGATGG + Intronic
1148905840 17:50911635-50911657 CTGTTAAGGTAGGGGTGAGGAGG - Intergenic
1149308877 17:55374831-55374853 CTTTGCAGGTAGGCCTAGGATGG - Intergenic
1151493838 17:74447740-74447762 CTGTGGGGATAGGACTGGGAAGG + Intronic
1152272792 17:79334878-79334900 CTGTGCAGGGTGGGCTGGGCTGG - Intronic
1153841434 18:9011541-9011563 CTGGGAAGGCAGGGCTGTGGTGG + Intergenic
1154056904 18:11021702-11021724 TTGTGAAGGCATGGGTGGGAGGG - Intronic
1154377347 18:13821265-13821287 CTGCGGAGGGAGGGATGGGAGGG - Intergenic
1156351057 18:36301135-36301157 CTGTGTAGGCAGCGCTGAGAAGG + Intronic
1157138061 18:45076911-45076933 CTTTGAAGGGAGGGCTGGGCTGG - Intergenic
1157292296 18:46418790-46418812 CTGTGAGGGCAGGACTGTGAAGG + Intronic
1157412939 18:47479063-47479085 CAGTGAAGGGAGGCCTGGGTGGG - Intergenic
1157582350 18:48781028-48781050 CCGTGAAGGCAGGGATGGGGGGG - Intronic
1158114783 18:53983212-53983234 CTATAAAGTTGGGGCTGGGAAGG + Intergenic
1160704743 19:524688-524710 CAGTGAAGGGAGGGCAGGCAGGG - Intergenic
1160824372 19:1072802-1072824 CTGAGGAGTTAGGGCAGGGAAGG + Intronic
1160932829 19:1578673-1578695 TTGTGAAGGGAGGGGTGGCACGG - Intronic
1161010242 19:1956292-1956314 CTGTGCAGGTGCAGCTGGGATGG + Intronic
1161410580 19:4114982-4115004 CTATGCAGGTAGGGCTGCAAGGG - Intronic
1161982228 19:7636058-7636080 CACAGAAGGTAGGGGTGGGAGGG - Intronic
1162080712 19:8216036-8216058 CTGAGAAGGTAGGGAGGTGAGGG - Intronic
1162925377 19:13928232-13928254 CTGTCCAGGTGGGGCTGAGAGGG - Intronic
1162969117 19:14169637-14169659 CAGGGAAGGTTGGGGTGGGAGGG + Intronic
1163424485 19:17233816-17233838 CAGGGAAGGTGGGGCTGGGAAGG + Intronic
1163452028 19:17384007-17384029 CTGTGACTGGAGGGCTGGAAAGG + Intergenic
1163584855 19:18157945-18157967 CTGGGAAGCCAGGGCTGGGAGGG + Intronic
1163601227 19:18250292-18250314 ATGGTAAGGTAGGGCTGGGCTGG - Exonic
1163758951 19:19122665-19122687 CTGTGAAGGCTGAGGTGGGAAGG + Intronic
1164273233 19:23692523-23692545 AACTAAAGGTAGGGCTGGGAGGG - Intergenic
1164415539 19:28044039-28044061 ATGAGGAGGTATGGCTGGGATGG - Intergenic
1166137536 19:40786473-40786495 CTCTGAAGGAAGAGCTGGGTGGG + Intronic
1166868177 19:45853772-45853794 CAGTGTGGGCAGGGCTGGGATGG - Intronic
1167107014 19:47436279-47436301 CAGAGTAGGCAGGGCTGGGATGG - Intronic
1167526357 19:49986654-49986676 ATGTGAGGGAAGGACTGGGAAGG + Intronic
925130628 2:1491843-1491865 CTTTGATGAGAGGGCTGGGATGG + Intronic
925565808 2:5253035-5253057 CTGTGAGGGCAGAGCTGGGAGGG + Intergenic
925628238 2:5863309-5863331 CTGTGAAGGCAAGGCAAGGAAGG - Intergenic
925649905 2:6078772-6078794 TCATGAAGGTAGGGCTGGGTGGG + Intergenic
925921229 2:8639274-8639296 CTGAGAATGGAGGGGTGGGATGG - Intergenic
926405792 2:12551480-12551502 ATGTGAAGGAAGGGCTGGGGAGG - Intergenic
927748337 2:25643239-25643261 AGGTGAAGGAAGGGCTGGGGCGG - Intronic
928682584 2:33717525-33717547 ATGTGAAGATAGGGAGGGGATGG + Intergenic
929214749 2:39400170-39400192 CTGTGAATGGAGGGATGGGGAGG - Intronic
929258545 2:39839522-39839544 GTGTTCAGGTAGGGCTGGGGTGG + Intergenic
932370999 2:71187824-71187846 ATCAGAAGGTAGGGCTGTGATGG - Exonic
932883217 2:75523614-75523636 CTGTGATGGTTGGGAGGGGAAGG - Intronic
933994522 2:87658207-87658229 CTGTGCAGGTAGGGTGTGGAGGG - Intergenic
935179869 2:100679722-100679744 CTTTGCAGGTAGGGGTGGGCAGG - Intergenic
935422459 2:102883990-102884012 CAGTCAAGTTAGGGCTGGAAGGG + Intergenic
935785632 2:106546054-106546076 GTGTGAAGACAGGACTGGGATGG - Intergenic
938071739 2:128311973-128311995 CTGCAAAGGTAGTGCTGGCAAGG - Intronic
938487940 2:131733670-131733692 CTGTGAAATGAGGGATGGGAGGG + Intronic
939753603 2:146080632-146080654 CTGGGAAGTTGGGGATGGGATGG + Intergenic
941466136 2:165829492-165829514 CTGAGAAGGTAAGGGTGGGCTGG + Intergenic
941638953 2:167967044-167967066 CTGAGAAGGAAGGGCTGGGTAGG + Intronic
941875974 2:170433682-170433704 CAGACAAGATAGGGCTGGGAAGG - Intronic
942205923 2:173620052-173620074 CTGCGAAGGCAGGGCTTAGAAGG + Intergenic
942292592 2:174487116-174487138 GTCTGAAGGCGGGGCTGGGAGGG - Intergenic
944203697 2:197135435-197135457 ATGTGAAGGCAGGGGTGGCAGGG - Intronic
944318337 2:198307236-198307258 CTGTGAGGGGTTGGCTGGGAAGG + Intronic
945229993 2:207577583-207577605 CTGTGTAGGAAGTGCTGGGGAGG - Exonic
946155650 2:217804949-217804971 CAGTAGGGGTAGGGCTGGGATGG - Intronic
946625814 2:221611194-221611216 CTGGGGAGAGAGGGCTGGGATGG + Intergenic
946748011 2:222864608-222864630 ATCTGCAGGTAGGGGTGGGATGG + Intronic
946764031 2:223023497-223023519 ATGTGTAGGTTGGGGTGGGAGGG - Intergenic
947097344 2:226581139-226581161 CTGGGAAGGAGGGGCTTGGAGGG + Intergenic
947106264 2:226670896-226670918 TTGAGAAGGTAGGGATGAGATGG - Intergenic
947756986 2:232573579-232573601 CTATGAAATTAGGGTTGGGAAGG - Intronic
948283770 2:236768807-236768829 CACAGAAGGAAGGGCTGGGATGG - Intergenic
948554485 2:238797899-238797921 TAGAGAAGGGAGGGCTGGGAAGG + Intergenic
1168786648 20:545120-545142 CTGTGAAGGCAGGGCTGTGGAGG - Intergenic
1169091287 20:2862731-2862753 CGGGGAGGGTGGGGCTGGGAGGG + Intronic
1169211280 20:3767534-3767556 CCGTGATGGCAGGGCTGGGGTGG - Intronic
1170150076 20:13220124-13220146 CTGGGAGGGAAGGGCTGGGCCGG + Intergenic
1170856837 20:20064559-20064581 CTGGGCAGGACGGGCTGGGATGG + Intronic
1173788849 20:45814469-45814491 CAGTAAGTGTAGGGCTGGGATGG + Exonic
1175806062 20:61830046-61830068 CCATGAAGGTAGGGCTGTGGGGG - Intronic
1175843693 20:62047972-62047994 CTGGGGAGCTAGGTCTGGGATGG - Intronic
1175971922 20:62690816-62690838 CTGTGACGGCAGGCCCGGGAGGG - Intergenic
1176049815 20:63112811-63112833 CCTTGAAGGGAAGGCTGGGAGGG + Intergenic
1176270298 20:64232766-64232788 CTGAGAAGGTATGAATGGGAGGG - Intronic
1178699939 21:34824602-34824624 CTGTGAGGCTAAGGCTTGGAAGG + Intronic
1180230127 21:46422117-46422139 ACGTGAAGGTATGGCTGGCAGGG + Exonic
1180625662 22:17191922-17191944 CTGGGAAGGGGTGGCTGGGAAGG - Intronic
1180841817 22:18962441-18962463 CTGTGAAGGTTGGGCAGGGGTGG + Intergenic
1181059682 22:20276423-20276445 CTGTGAAGGTTGGGCAGGGGGGG - Intronic
1181179474 22:21056750-21056772 CTGGGAGGGAAAGGCTGGGAGGG - Intronic
1181582334 22:23835180-23835202 CCTTGGAGGCAGGGCTGGGAAGG - Intronic
1182007670 22:26974838-26974860 CAGTGGAGGGAGGGGTGGGAAGG + Intergenic
1182177120 22:28302142-28302164 CTGTCAGGGTAGGTCTGGGAAGG + Intronic
1183089140 22:35509539-35509561 CAGCGGAGGTGGGGCTGGGAGGG + Intergenic
1184590442 22:45478530-45478552 CTGAGAAGAAATGGCTGGGAAGG + Intergenic
1185284349 22:49993766-49993788 CCGTGGAGGTGGGGCTGGGGAGG - Intergenic
949949841 3:9220025-9220047 CTGGGAAGGTAGGGTGGGGCGGG + Intronic
950172689 3:10850574-10850596 CTGTGATGGGAAGGATGGGATGG + Intronic
950366595 3:12490057-12490079 GTGTGGGGGTATGGCTGGGATGG - Intronic
950531242 3:13553413-13553435 CTGAGGAGGAAGAGCTGGGACGG + Intronic
950739481 3:15038720-15038742 TTGTGAGTGAAGGGCTGGGAAGG - Intronic
951580719 3:24159989-24160011 CTTTGAAGGCAGGGCTGGTTGGG + Intronic
951932693 3:27986363-27986385 CTGCCAAGCTTGGGCTGGGAGGG + Intergenic
951972269 3:28460025-28460047 CATTGCAGGTAGGGCTGGGGAGG - Intronic
952415933 3:33091816-33091838 CTGAGAAGACAGGGCTGGGCTGG - Exonic
952702243 3:36339705-36339727 CTGGCAAGGCAGGGCTGGGGTGG + Intergenic
953152069 3:40333787-40333809 CTGTGTAGTTGGGGCGGGGAGGG - Intergenic
953390937 3:42533406-42533428 CTGAGAAGGAAAGGCTGGGGGGG + Intronic
953760134 3:45680179-45680201 ATGTGAAAGTAGAGCTGTGATGG + Exonic
953791544 3:45951530-45951552 CTGTGGAGTAAGGGCTGGCAGGG - Intronic
953793275 3:45964682-45964704 CACTGAAGGTAGGGGTGGCAGGG + Intronic
953980872 3:47412430-47412452 CTGGGCAGATGGGGCTGGGATGG + Intronic
954152599 3:48664961-48664983 CTGCAAAGGAAGGGCAGGGAGGG + Intergenic
954437840 3:50505275-50505297 CTCAGCAGGCAGGGCTGGGAAGG - Intergenic
955320662 3:57972124-57972146 GTGTGGAAGTAGGGCTGGGTGGG + Intergenic
955737683 3:62057178-62057200 CTGAGAAGGAAAGGCAGGGATGG + Intronic
956011680 3:64838369-64838391 CTGTGGAGGGAGGGGTGGGCTGG - Intergenic
956285118 3:67600488-67600510 CAGTCAAAGTAGGGCTGGGATGG + Intronic
958187052 3:90135634-90135656 CAGACAAAGTAGGGCTGGGAAGG - Intergenic
959056614 3:101574023-101574045 CTCGGAAGGAAGAGCTGGGAAGG - Intergenic
960246994 3:115410919-115410941 CAGTGAAAGTTGGGATGGGAAGG + Intergenic
961066883 3:123883790-123883812 CCGGGAAGGTAGGGCGGGGAAGG - Intronic
961441050 3:126953410-126953432 CTGCCAACGTAGGGCTTGGAGGG - Intronic
961450173 3:126999115-126999137 CTGTGCAGTTCTGGCTGGGAAGG + Intronic
961487074 3:127224138-127224160 CTGTTATGGTGGGGCTGGGGAGG - Intergenic
961556789 3:127701570-127701592 GTGTTAAGGGAGGGCAGGGATGG - Intronic
961654174 3:128432549-128432571 CGGTGAATGTGGGGCTGGGAAGG + Intergenic
961869501 3:129977334-129977356 GTGTGAATATGGGGCTGGGAGGG - Exonic
962875177 3:139530682-139530704 GTGTGAAGGTGGGGATGGCATGG - Intronic
963646653 3:147923453-147923475 CTGTCAAGTTAGGGCTTGGATGG + Intergenic
964159617 3:153631095-153631117 CTGTGAAGGAAGGGCAGGCAGGG - Intergenic
964697876 3:159530305-159530327 TTGTGAAGAGAGAGCTGGGAAGG - Intronic
965672383 3:171159904-171159926 GTGTTAAGGTACGGCTGGGCTGG + Intronic
966118384 3:176492911-176492933 GTGGGAAGGTAGGACAGGGAGGG - Intergenic
966131005 3:176639792-176639814 CTGTTAAGGGAGTGCAGGGAGGG - Intergenic
966618996 3:181944089-181944111 CTGTGTACATAGGGCTGGGGGGG - Intergenic
966848158 3:184146524-184146546 CTGGGACGGTAGGGATGGGGGGG - Intronic
966970771 3:185043391-185043413 TTGTGAGGGAAGGGCTGGGAAGG - Intronic
967194876 3:187017468-187017490 CTGTGAGATTAGGGGTGGGAGGG + Intronic
967322287 3:188206435-188206457 CTGTGAAGGTTGGACCAGGAAGG - Intronic
967326534 3:188245836-188245858 TTGTGAAAGCAGGGCTGGGCTGG - Intronic
967971023 3:194999610-194999632 CTGTGCATAGAGGGCTGGGAGGG - Intergenic
967984339 3:195084176-195084198 CTGGGAAGGTCCGGCTGGTAAGG + Intronic
968547942 4:1208096-1208118 CTGCGGGGGTAGGCCTGGGAGGG + Intronic
968870210 4:3238327-3238349 ATGTGAAATCAGGGCTGGGAGGG - Intronic
968901985 4:3436230-3436252 CTGTGGTGGGAAGGCTGGGAAGG + Intronic
969513270 4:7631771-7631793 GAGGGAAGGGAGGGCTGGGAGGG - Intronic
969639899 4:8390681-8390703 CTCTGAATGTGAGGCTGGGATGG + Intronic
969739828 4:9016160-9016182 CGGTGAAGGGATGGCTGGGTGGG - Intergenic
969868707 4:10091881-10091903 CAGTGAAGGCAGTGGTGGGAGGG + Intronic
973829909 4:54748168-54748190 CTGTGGAGGAAGAGCTGGGCAGG - Intergenic
975621887 4:76304999-76305021 TTGTCAAGGAAGGGCTGGGCAGG + Intronic
976468255 4:85396175-85396197 AGGTGTAGGTAGGGCTAGGAGGG - Intergenic
978207410 4:106094265-106094287 ATGTGCAGGTGGGGATGGGAGGG + Intronic
978337743 4:107688086-107688108 ATGTGAAGGTAGGAGTGGCAGGG - Intronic
978564934 4:110071626-110071648 CTGTGGAGGGAAGGCTGGGCGGG - Intronic
980873098 4:138632607-138632629 CTGTGTAGGTCAGCCTGGGATGG - Intergenic
981427377 4:144619019-144619041 ATGTGATGGTGGGGGTGGGATGG - Intergenic
983682694 4:170371874-170371896 TTGTGAAGCTAAGGCTGGCAGGG - Intergenic
984027715 4:174564531-174564553 ATGTGATGGTAGGGGAGGGAGGG - Intergenic
984261161 4:177444904-177444926 CTGGGAAGGGAATGCTGGGAAGG + Intergenic
984653338 4:182291869-182291891 CTGTGTGTGTAGGGCTGGGAGGG + Intronic
985889711 5:2705943-2705965 CTGTGACGGGAGGGAGGGGATGG + Intergenic
986240454 5:5955222-5955244 CAGTGAGGGAAGGGCAGGGAGGG - Intergenic
986797940 5:11230904-11230926 CTGAGGAGGGAGGGCTGGGTGGG - Intronic
987011494 5:13770615-13770637 CTGTGGCGGCAGGGCAGGGAAGG - Intronic
987265059 5:16244853-16244875 CTGTGCATGTATGGCAGGGAAGG + Intergenic
988994223 5:36698913-36698935 CTTTGAAGGTAGTGCTAGGAGGG + Intergenic
991248741 5:64535478-64535500 CTGAAGAGGTGGGGCTGGGAGGG - Intronic
991934178 5:71785566-71785588 CTTTGGGGGTGGGGCTGGGAGGG - Intergenic
992195815 5:74337832-74337854 CTGAAGAGGAAGGGCTGGGAGGG - Intergenic
993397744 5:87412202-87412224 CTGTGCAGGAATGGCTGGGGAGG - Intronic
993486547 5:88494679-88494701 GTGGGAAAGTAGGGCAGGGAGGG - Intergenic
993737967 5:91500168-91500190 CTGAAAAGAGAGGGCTGGGAAGG - Intergenic
995522751 5:113026580-113026602 TTTTGGAGGCAGGGCTGGGAAGG - Intronic
997224008 5:132195240-132195262 CTGTGAAGAAAGGACAGGGAGGG - Intronic
997251596 5:132392863-132392885 CTCTGATGGAAGGCCTGGGATGG - Intronic
997440857 5:133907738-133907760 ATGGGAAGGGAGGGCAGGGAGGG - Intergenic
998798232 5:145841293-145841315 TTGTGAAGGTAGAGCTGGAAAGG + Intergenic
999434177 5:151550398-151550420 AAGTGAAGGTAGAGATGGGACGG - Intronic
1000146421 5:158457521-158457543 CTGTGCAGGGTGGGGTGGGAGGG + Intergenic
1001415747 5:171543890-171543912 CTGAGAAGGAAGGGTAGGGAAGG + Intergenic
1001543991 5:172558725-172558747 CTGGGAAGGCAGGGCTCGGAAGG + Intergenic
1001717429 5:173828043-173828065 CTGTTAAGGTAAGGCTGGTGAGG - Intergenic
1001774252 5:174316741-174316763 GTGTGCAGGCAGGGCTGGGGAGG + Intergenic
1002421991 5:179153712-179153734 ATGTGCAGGTAGGGCTGCCATGG - Intronic
1002857116 6:1047917-1047939 CTGTGGAGGTCGGGGTGGGTGGG - Intergenic
1003129491 6:3383343-3383365 CTCTGAGGGTGGGGCTGGGGAGG + Intronic
1003167970 6:3697890-3697912 CTGGGAAGGCACCGCTGGGAAGG - Intergenic
1003744884 6:8989634-8989656 CTGTATAGGCATGGCTGGGAAGG + Intergenic
1004814208 6:19294880-19294902 CATTGAAGGTAGGACTGGAAGGG + Intergenic
1005794842 6:29348401-29348423 CTGATAAGGGAGTGCTGGGAAGG - Intergenic
1006155018 6:32009235-32009257 CTGGGAGGGTGAGGCTGGGAGGG - Intergenic
1006161329 6:32041970-32041992 CTGGGAGGGTGAGGCTGGGAGGG - Intronic
1007243568 6:40443956-40443978 CTGACAACCTAGGGCTGGGAGGG + Intronic
1007384711 6:41512830-41512852 AGGTGAAGGTGGGGATGGGAAGG - Intergenic
1007397739 6:41587177-41587199 CTGTGGGGTTGGGGCTGGGAGGG - Intronic
1008532849 6:52480624-52480646 TTGTGAAGGTAGGTCAGGGTAGG + Intronic
1008924061 6:56873705-56873727 CTGGGAAGGTTGGGCGGAGAGGG + Intronic
1009845177 6:69125506-69125528 ATGTGAAGACAGGGCTGGAAGGG + Intronic
1014662584 6:124192243-124192265 CTGTGAAAATAGTGCTTGGAGGG - Intronic
1015890755 6:137967767-137967789 GAGTGATGGTGGGGCTGGGATGG - Intergenic
1016357705 6:143235961-143235983 CAAAGAAGGTAGGGCAGGGAAGG + Intronic
1016721841 6:147307117-147307139 TTGTTAAGGCAGGCCTGGGAAGG + Intronic
1017232919 6:152092062-152092084 CTGGGAGGTTAGGGCTAGGAGGG - Intronic
1018450481 6:163902768-163902790 CCCTGAAGGTGGGGCTGGGAAGG + Intergenic
1018849815 6:167578809-167578831 CTGTGAAGGAACGCCTGAGACGG + Intergenic
1021937642 7:25646862-25646884 CTGGGAAGTTAGGGGTGGGATGG + Intergenic
1022047501 7:26633871-26633893 CTCTGGAGGAAAGGCTGGGAAGG + Intergenic
1022234704 7:28449891-28449913 CTGTGAAGTAAAGGATGGGAGGG - Intronic
1022459094 7:30587136-30587158 CTGTTAAAGTAGGGTTGGGTCGG - Intergenic
1022657838 7:32337063-32337085 CTGGGAAAGTAGGGGTGGAAAGG - Intergenic
1022965525 7:35467972-35467994 CTGGGAAGGGAGGTCTGGGAAGG + Intergenic
1024155884 7:46624687-46624709 CTGTGCAGGTAGGGAAGTGAAGG - Intergenic
1024220216 7:47281297-47281319 CTTGGAAGGAAGGGCTGGGCAGG - Intronic
1024657640 7:51465299-51465321 CTTGGAAGGGAGGGCTGGCAAGG - Intergenic
1024889162 7:54181391-54181413 CTGTGAAGTTAGGGCGAGGATGG - Intergenic
1025524961 7:61794231-61794253 CTGTGAAGGTATATTTGGGAGGG - Intergenic
1025548339 7:62206793-62206815 CTGTGAAGGTATATTTGGGAGGG - Intergenic
1025575670 7:62638020-62638042 CTGTGAAGGTATATTTGGGAAGG - Intergenic
1025592505 7:62879934-62879956 CTGTGAAGGGATATCTGGGAGGG + Intergenic
1026817661 7:73524665-73524687 CTGGGAAGGTACAGCTGGGAAGG - Intergenic
1028622695 7:92842648-92842670 GTGGGAAGGTGGGGGTGGGAGGG + Intergenic
1029209886 7:98898352-98898374 TTGTGAAGGTAATGCTGGCATGG + Intronic
1029515743 7:101021978-101022000 CTGTGATGGCAGGGCCGGGCTGG - Intronic
1029689403 7:102170966-102170988 CTGGGAGGGTAGGGGTGGGCGGG + Intronic
1030807659 7:113937012-113937034 ATGTGCTGGCAGGGCTGGGAAGG + Intronic
1032474548 7:132203180-132203202 CTGTGAAGGAGGGGCTCAGAGGG + Intronic
1032508003 7:132450583-132450605 CTGAGAAGGGTGGACTGGGAAGG + Intronic
1032648738 7:133854715-133854737 ATTTGAAGGTAGGGCTGGAGTGG - Intronic
1033424965 7:141235914-141235936 CTGGGAAGGCTGAGCTGGGACGG - Intronic
1034271770 7:149806566-149806588 CTGTGAGGGTAGGGGCAGGAGGG + Intergenic
1035559264 8:593022-593044 CTGTGAGGGGAGCGCTGTGAGGG + Intergenic
1035559282 8:593098-593120 CTGTGAGGGGAGGGATGTGAGGG + Intergenic
1035559301 8:593181-593203 CTGTGAGGGGAGGGATGTGAGGG + Intergenic
1035559308 8:593209-593231 CTGTGAGGGGAGGGATGTGAAGG + Intergenic
1035559321 8:593251-593273 CTGTGAGGGGAGGGATGTGAGGG + Intergenic
1035609920 8:954798-954820 CTTTGAGGGTAGGGCTGGTATGG + Intergenic
1036711597 8:11082987-11083009 CTGTGCAGAAAGGGCTGGGAAGG - Intronic
1037532387 8:19790580-19790602 GTGTGAGGGTAGGGTAGGGAGGG + Intergenic
1037693982 8:21207872-21207894 CGGTGGTGGTAGTGCTGGGAGGG - Intergenic
1039658827 8:39439604-39439626 CTGTGAAGGGAAGGAAGGGAAGG - Intergenic
1040276704 8:46017533-46017555 CTGTGCAGGTGCTGCTGGGATGG + Intergenic
1040842467 8:51799231-51799253 CTGTGGGGGCAGGGCAGGGAGGG + Intronic
1041324685 8:56651949-56651971 CTGAAAAGGAAGGTCTGGGATGG + Intergenic
1041896819 8:62934462-62934484 CTGTTAGGGGAGGGCTGGAATGG + Intronic
1044639403 8:94362721-94362743 CCATGAAAGTAGGGTTGGGATGG - Intergenic
1045499214 8:102732140-102732162 CTGTGAAGGTTGGCCTGGTCTGG + Intergenic
1045712779 8:105004916-105004938 CTCTGAAGGTAGAGATAGGATGG + Intronic
1046629577 8:116610089-116610111 CAGTGAAGGATGGGATGGGAAGG - Intergenic
1048049485 8:130803926-130803948 CTGGCTAGGTAGGGCTGGGCAGG + Intronic
1048208694 8:132436827-132436849 CTCAGAAGGTAGGGCTGGAAGGG + Intronic
1048255436 8:132901633-132901655 CTGGGAAGGCAGGGGTGGGAGGG + Intronic
1048725625 8:137380344-137380366 GTGGGAAGTTAGAGCTGGGAAGG - Intergenic
1049340183 8:142108162-142108184 CTGAGAACGGCGGGCTGGGAGGG - Intergenic
1049521164 8:143092131-143092153 CTGTGAGGATAGGGCTGGAGGGG + Intergenic
1049621937 8:143602373-143602395 AGCTGCAGGTAGGGCTGGGACGG - Exonic
1049646179 8:143736794-143736816 CAGTGAAGGCGGGGCTGGGGTGG - Intergenic
1049797489 8:144503332-144503354 CTGTGGAGGTGGGGCTCTGACGG + Intronic
1049800657 8:144516122-144516144 CAGTCAAGCTAGGGCTGGGAAGG - Exonic
1050280308 9:4043498-4043520 GTCTGTAGGAAGGGCTGGGAAGG + Intronic
1050424456 9:5499472-5499494 CTGTGAATGTAGGGCAGAGTAGG - Intergenic
1051580718 9:18670862-18670884 CTGTGGAGGTGGGGGTGGGGTGG - Intronic
1054834411 9:69661397-69661419 CTGTGCAGGAAGAGATGGGAAGG + Intronic
1057491923 9:95526903-95526925 CTGCGTAAGTGGGGCTGGGAAGG - Intergenic
1057801869 9:98195793-98195815 GTGGGAAGGTGGGGCTGAGAGGG + Intergenic
1058603729 9:106698305-106698327 CTGTGAGGGTTGGACTGGGGAGG + Intergenic
1059281345 9:113136666-113136688 CTGGGAAGGGAGGGGTGAGAAGG - Intergenic
1059853054 9:118364762-118364784 CTGTGAAGGGAAGGCTGGAAAGG + Intergenic
1060232941 9:121839073-121839095 CAGTGAAGGTAATGCTGAGATGG - Intronic
1060401555 9:123352783-123352805 CTGTGAGAGCTGGGCTGGGAGGG + Intergenic
1060804321 9:126564989-126565011 CAGTGCAGGTAGAGGTGGGAGGG - Intergenic
1060849051 9:126860258-126860280 CTTGGAAGGGAGGGCTGGGCTGG + Intergenic
1061001267 9:127904354-127904376 CTGTGGGGGAAGGGCTGGGGGGG - Intronic
1061253431 9:129439694-129439716 CTGGAAAGCCAGGGCTGGGAGGG + Intergenic
1061489585 9:130937833-130937855 CAGTGGAGGTGGGGCTTGGAGGG - Intronic
1062250566 9:135591796-135591818 CTGGGGAGGGAGGGCAGGGAAGG - Intergenic
1062378804 9:136276933-136276955 ATGTCGAGGAAGGGCTGGGAGGG + Intergenic
1062394365 9:136346803-136346825 CTGTGCAGGTGAGGCTGGGAGGG + Intronic
1062495206 9:136828281-136828303 CTCTGGAGGCAGGGCTGGGCCGG - Intronic
1062623796 9:137434072-137434094 GTGTGAAGGTAGGGTGGGCATGG + Exonic
1187527778 X:20069605-20069627 TTGAGAGGGTAGGGGTGGGAGGG + Intronic
1188451832 X:30315621-30315643 CTGGGAAGGTTGGGCAGGGAGGG - Intergenic
1190470236 X:50771187-50771209 GTGTGAAGGGAGGGTGGGGAAGG - Intronic
1190873768 X:54445696-54445718 CTGAGGAGGCAGGGCTGGGTCGG + Exonic
1192034096 X:67545151-67545173 AAGTGCAGTTAGGGCTGGGAAGG + Exonic
1192056521 X:67779329-67779351 CTGTGAAGGCAGGCCAGGGAGGG + Intergenic
1192175201 X:68880920-68880942 CTGGGAAGGGGGGGCAGGGAGGG - Intergenic
1195129452 X:101839246-101839268 GGGTGAAGGTAGGGGAGGGACGG + Intronic
1195176786 X:102320583-102320605 GGGTGAAGGTAGGGGAGGGACGG - Intronic
1195182078 X:102366510-102366532 GGGTGAAGGTAGGGGAGGGACGG + Intronic
1195463339 X:105152714-105152736 CTATGAGGGTAGGGCTGTCATGG - Intronic
1197632836 X:128881922-128881944 ATGTGAAGGGAGTACTGGGATGG - Intergenic
1198036797 X:132808847-132808869 GTGTGAAGGTAGTGGTGCGATGG - Intronic
1198504293 X:137286003-137286025 ATTTGAAGGTTGGACTGGGAAGG + Intergenic
1199264945 X:145818423-145818445 CAGGGAAGGTAGGGCTGCGCTGG + Exonic
1200122151 X:153796218-153796240 CTGTGAAGGAAGGCTGGGGAGGG - Intronic
1200135946 X:153874722-153874744 GTGTCAAGGTGAGGCTGGGAAGG + Intronic
1200173818 X:154097842-154097864 CTGTGATGGCCGGGCTGGGACGG + Intergenic
1200840996 Y:7781748-7781770 CTGTCAAGGTAGGACTGGCCAGG + Intergenic