ID: 1143241223

View in Genome Browser
Species Human (GRCh38)
Location 17:5444740-5444762
Sequence TGAAGGTAGGGCTGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1654
Summary {0: 1, 1: 0, 2: 5, 3: 150, 4: 1498}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241209_1143241223 22 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241223 17:5444740-5444762 TGAAGGTAGGGCTGGGAGGGAGG 0: 1
1: 0
2: 5
3: 150
4: 1498
1143241210_1143241223 21 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241223 17:5444740-5444762 TGAAGGTAGGGCTGGGAGGGAGG 0: 1
1: 0
2: 5
3: 150
4: 1498
1143241213_1143241223 2 Left 1143241213 17:5444715-5444737 CCAGAAACAGGGAAACTACCGCC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1143241223 17:5444740-5444762 TGAAGGTAGGGCTGGGAGGGAGG 0: 1
1: 0
2: 5
3: 150
4: 1498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241223 Original CRISPR TGAAGGTAGGGCTGGGAGGG AGG Intronic