ID: 1143241223

View in Genome Browser
Species Human (GRCh38)
Location 17:5444740-5444762
Sequence TGAAGGTAGGGCTGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1654
Summary {0: 1, 1: 0, 2: 5, 3: 150, 4: 1498}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143241213_1143241223 2 Left 1143241213 17:5444715-5444737 CCAGAAACAGGGAAACTACCGCC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1143241223 17:5444740-5444762 TGAAGGTAGGGCTGGGAGGGAGG 0: 1
1: 0
2: 5
3: 150
4: 1498
1143241210_1143241223 21 Left 1143241210 17:5444696-5444718 CCAGCTGGAGGAGCACGGACCAG 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1143241223 17:5444740-5444762 TGAAGGTAGGGCTGGGAGGGAGG 0: 1
1: 0
2: 5
3: 150
4: 1498
1143241209_1143241223 22 Left 1143241209 17:5444695-5444717 CCCAGCTGGAGGAGCACGGACCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1143241223 17:5444740-5444762 TGAAGGTAGGGCTGGGAGGGAGG 0: 1
1: 0
2: 5
3: 150
4: 1498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143241223 Original CRISPR TGAAGGTAGGGCTGGGAGGG AGG Intronic
900438148 1:2641110-2641132 TGTGGGGAGGGCTGGGAAGGGGG + Intronic
900438200 1:2641223-2641245 TGTGGGGAGGGCTGGGAAGGGGG + Intronic
900681815 1:3920560-3920582 GGAAGGGAGGGAAGGGAGGGAGG - Intergenic
900692961 1:3992781-3992803 TGAGGGTAGGGCCGGGCAGGTGG + Intergenic
900767241 1:4513618-4513640 TGAGGGGAAGGCTGGGTGGGAGG - Intergenic
900982731 1:6055713-6055735 TGAAGGTGGGGCGGGGAGGGTGG + Intronic
901050560 1:6424102-6424124 AGAAGGCAGGGATGGGTGGGAGG - Intronic
901194008 1:7430004-7430026 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
901208084 1:7508724-7508746 TGGAGGGAGGGAAGGGAGGGAGG + Intronic
901276139 1:7992474-7992496 AGGAGGTAGGGGAGGGAGGGCGG - Intergenic
901379320 1:8862507-8862529 TGGAGCCAGGGCTGGGAGGGAGG - Intronic
901430533 1:9211383-9211405 GGGAGGAAGGGGTGGGAGGGAGG - Intergenic
901467170 1:9429675-9429697 AGAAGGTGGGGCAGGGATGGAGG - Intergenic
901723679 1:11221994-11222016 TGAGGGTAGGATTGGGAGGTGGG + Intronic
901739788 1:11334605-11334627 TGAAGGTGAGTATGGGAGGGAGG + Intergenic
901790417 1:11650836-11650858 TGCAGGCAGGGATGGGTGGGAGG + Intronic
902101794 1:13996504-13996526 TGAAGTCAGGGGAGGGAGGGAGG + Intergenic
902167961 1:14587752-14587774 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
902190259 1:14757887-14757909 TGAAGGAAGAGAAGGGAGGGAGG + Intronic
902290801 1:15433494-15433516 TGACGGAAGCCCTGGGAGGGTGG - Intergenic
902436888 1:16403913-16403935 TGGAGGAGGGGCTGGGAGGTTGG - Intronic
902470007 1:16642749-16642771 GGCAGGTATGGCTGGGTGGGCGG - Intergenic
902513718 1:16979289-16979311 TGTAGGGAGGGCTGCGAGGGCGG + Intronic
902789969 1:18761007-18761029 TGAAAGGAGGGCTGGAAGAGGGG + Intergenic
902791146 1:18769147-18769169 GGAGGGGAGGGCAGGGAGGGGGG - Intergenic
902820076 1:18938335-18938357 TGCTGGGAAGGCTGGGAGGGAGG + Intronic
903068255 1:20713411-20713433 GGCAGGTGGGGCTGGTAGGGGGG - Intronic
903107874 1:21100198-21100220 TGAAGGGAGAGGTGGGAGGAAGG + Intronic
903173904 1:21569557-21569579 GGAAGCAGGGGCTGGGAGGGGGG + Intronic
904108575 1:28106890-28106912 TGAAGTTGGGGGTGGGAGGTAGG + Intergenic
904325968 1:29727507-29727529 GGAAGGGTGGGCTGGGAGAGGGG + Intergenic
904325989 1:29727563-29727585 GGAAGGGTGGGCTGGGAGAGGGG + Intergenic
904355270 1:29934502-29934524 TGTGGGCAGGGCTGGGAGGAGGG + Intergenic
904358714 1:29958811-29958833 CGAGGGGAGGGCTGGGAGTGTGG + Intergenic
904373566 1:30066058-30066080 TGGAGGGAGGGCTGGGGGAGGGG - Intergenic
904433503 1:30479670-30479692 GGAAGGGAGGGCTGGGGGAGGGG - Intergenic
904448379 1:30594343-30594365 GGAAGGAAGGGAAGGGAGGGAGG + Intergenic
904657853 1:32062723-32062745 TGGAGGTAGGGCTGGCAGCCTGG + Intergenic
904813775 1:33180961-33180983 TGGAGGTGGGGCCGGGCGGGGGG - Intronic
905014761 1:34770172-34770194 GGAATGTAGGGCAGGGAGGCTGG - Intronic
905543560 1:38779706-38779728 AAAGGGCAGGGCTGGGAGGGAGG - Intergenic
905600014 1:39241715-39241737 TGTATGTATGGCGGGGAGGGGGG + Intronic
905858499 1:41330655-41330677 TGAGGGCAGGGCAGGGAGGTGGG - Intergenic
905892858 1:41528105-41528127 TGAGGGTAAGGGTGTGAGGGTGG - Intronic
906335612 1:44927489-44927511 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
906610484 1:47198479-47198501 TGAAGGGAGTGCAGGGAGAGCGG + Intergenic
906612991 1:47216123-47216145 TGAAGGCAGGCCTGGTGGGGAGG - Intergenic
906696309 1:47825695-47825717 TGAACTAAGGGTTGGGAGGGTGG - Intronic
907080882 1:51620655-51620677 TGGAGGTTGGGCTGTGAGGTAGG + Intronic
907521918 1:55029485-55029507 TGAAGTCTGGGCTGGGAGGAGGG - Intergenic
907625653 1:56026770-56026792 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
907726525 1:57025429-57025451 TGAAGGGCAGGCTGGAAGGGAGG + Intronic
907796612 1:57724350-57724372 GGAAGGGAGGGAAGGGAGGGAGG + Intronic
907875508 1:58483166-58483188 ATAAGCTAGGGCTGGGAGAGGGG - Intronic
907920459 1:58906450-58906472 TGGAGGTAGGGTTTGGAGTGTGG + Intergenic
908032977 1:60020921-60020943 TGAAGGAAGGGCCTGGTGGGAGG + Intronic
908064169 1:60384520-60384542 TGGAGGTAGGGCCTGGGGGGAGG + Intergenic
908079122 1:60556389-60556411 AGAGGGTGGGGCTGGGAGGAGGG - Intergenic
908322543 1:62992186-62992208 GGAAGGGAGGGCTGGGGAGGGGG - Intergenic
908460431 1:64343750-64343772 TGAAGCAAGCACTGGGAGGGTGG - Intergenic
908462338 1:64357576-64357598 TGGGGGTAGGGGTGGGAGGTGGG - Intergenic
908580610 1:65512274-65512296 TGGAGGTGGGGCCTGGAGGGAGG - Intronic
909020486 1:70425851-70425873 TGGAGGTGGGGCCTGGAGGGAGG - Intronic
909344047 1:74564781-74564803 TGAAGGTGGGGCCCGGTGGGAGG - Intergenic
909529974 1:76671257-76671279 TGGAGGTGGGGCTTGGAGGGAGG - Intergenic
909618326 1:77638143-77638165 TGAAGGTGGGGAAGAGAGGGAGG - Intronic
909663256 1:78107034-78107056 GGAAGGAAGGGAAGGGAGGGAGG - Intronic
909745641 1:79093942-79093964 GGAGGGGAGGGCTGGGAGGCTGG - Intergenic
909877673 1:80829484-80829506 TGAAGGTGGGGCTTGGGGGGAGG + Intergenic
910059130 1:83067814-83067836 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
910266592 1:85344551-85344573 TGAAGGGAGGGAAGGGAGAGAGG - Intronic
910266601 1:85344580-85344602 TGAAGGGAGGGAGGGAAGGGAGG - Intronic
910271300 1:85397827-85397849 TGAAGGTAGGGCCTGGTGGGAGG + Intronic
910395239 1:86786782-86786804 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
910423784 1:87099523-87099545 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
910884352 1:91949789-91949811 TCAAGGGAGGGCTGGGAAGGAGG + Intronic
910990680 1:93052935-93052957 TGAAGGTGGGGCCTGGAGGAAGG - Intergenic
911011037 1:93281217-93281239 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
911886080 1:103301189-103301211 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
912560730 1:110549557-110549579 AGATGGTGGGGCTGGGAGGAAGG + Intergenic
912972980 1:114301492-114301514 TGGAGGTGGGGCTAGGTGGGAGG + Intergenic
913321557 1:117592142-117592164 TGAGGGTCTGGCTGGGAAGGTGG - Intergenic
914201677 1:145490717-145490739 AGAAGGTGGGGCTGGGAAGAGGG + Intergenic
914240073 1:145847344-145847366 TGCAGGTAGGGCTGGCAGTGAGG + Exonic
914313543 1:146487798-146487820 AGAGGGTAGGGCTGGGAAGAGGG + Intergenic
914480802 1:148063841-148063863 AGAAGGTGGGGCTGGGAAGAGGG + Intergenic
914500805 1:148245583-148245605 AGAGGGTAGGGCTGGGAAGAGGG - Intergenic
914885327 1:151579936-151579958 TGAAGGTGGGGCCAGGGGGGTGG - Intronic
915106411 1:153537470-153537492 CGAGGGCAGGGCTGGGAGCGGGG - Intronic
915111013 1:153564729-153564751 TGAAGGCAGGGCTGGCATGATGG - Intronic
915214200 1:154329120-154329142 TGAATGTAGGGATTGGAGGGGGG - Intronic
915448822 1:155990544-155990566 TGAGGGTGGGAGTGGGAGGGAGG - Intronic
915514812 1:156406554-156406576 GGAAGGGTGGGCTGGGAGGGAGG - Intronic
915518882 1:156429962-156429984 TGAGGGGAGGCCTGGGAAGGGGG - Intronic
915668325 1:157465198-157465220 TGGAGGTGGGGCCTGGAGGGAGG + Intergenic
915844380 1:159248514-159248536 TGGAGGTAGGGCCTGGAGGGAGG + Intergenic
915951031 1:160190199-160190221 TGAAGCTGGGGCTGGGGGAGGGG - Intergenic
916024022 1:160818713-160818735 TGAGGGAAGGGGTGGGAGCGAGG + Intronic
916323703 1:163533843-163533865 AGAAGGTGGGGCTGGGTGGTTGG - Intergenic
916434089 1:164760427-164760449 GGAAGGAAGGGAAGGGAGGGAGG - Intronic
916498984 1:165370183-165370205 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
916719586 1:167474207-167474229 TGGGGGTGGGGCTGGGAAGGGGG + Intronic
917259428 1:173150632-173150654 TGGAGGTAGGAGTGGGTGGGAGG - Intergenic
917355852 1:174125436-174125458 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
917410981 1:174759895-174759917 TGAAGGTAGGGCCGAGTGGGAGG - Intronic
917470280 1:175320766-175320788 AGAAGGAAGGGGAGGGAGGGAGG - Exonic
917726063 1:177828522-177828544 TGCAGGTAGAGATAGGAGGGTGG + Intergenic
917797410 1:178542191-178542213 TGTATGGAGGGCTGGGAGAGAGG + Intronic
918065770 1:181100666-181100688 ATAAGGTAGGGCTGGGGTGGGGG - Intergenic
918288003 1:183077550-183077572 TGATGGGAAGGATGGGAGGGGGG - Intronic
918484051 1:185010729-185010751 TGAAAGTGGGGGTGGGAGGTGGG - Intergenic
918736096 1:188065509-188065531 TGAAGGTGGGACTTGGTGGGAGG + Intergenic
918972592 1:191438960-191438982 TGAAGGAAAGGGTGGGAAGGGGG + Intergenic
919096672 1:193045342-193045364 TGAAGGTGGGGCCTGGTGGGAGG + Intronic
919307411 1:195859759-195859781 TGAGGGAAAGGGTGGGAGGGGGG + Intergenic
919822245 1:201480816-201480838 TAAAGGTTGGGCTTGGAGGCGGG + Intergenic
919847511 1:201650852-201650874 TGAAGGTGGGGATGGCTGGGTGG + Intronic
920106442 1:203556618-203556640 AGGAGGTGGGGCCGGGAGGGTGG - Intergenic
920113049 1:203600631-203600653 TGGAGGCAGGGCTGTGGGGGCGG - Intergenic
920113644 1:203604151-203604173 TGAATGGATGGCTGGGTGGGTGG - Intergenic
920162585 1:204010664-204010686 TGAAGGTGGGGCCTGGAGGGAGG + Intergenic
920198435 1:204244822-204244844 AGAAGGTAGGTGGGGGAGGGAGG - Intronic
920626841 1:207611064-207611086 TGAGGGTAGGGAGGGGAGGTGGG - Intronic
920978161 1:210805450-210805472 AGCAGGTGGGGATGGGAGGGAGG - Intronic
921344661 1:214170012-214170034 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
922242574 1:223765512-223765534 GGAGGGTGGGGCTGGGAGGTGGG + Intronic
922324219 1:224513347-224513369 TGGGGGTGGGGGTGGGAGGGGGG + Intronic
922331210 1:224578012-224578034 TGCAGGGAAGGGTGGGAGGGAGG + Intronic
922476462 1:225910223-225910245 TGGAGGTAAGGCTGGTGGGGAGG - Intronic
922706975 1:227795220-227795242 GGAAGGCGGGGCTGGGGGGGCGG - Intergenic
922796756 1:228343292-228343314 TGCAGACAGGGCTGGGTGGGAGG + Intronic
923080753 1:230652206-230652228 TGGGGTTAGGGATGGGAGGGTGG - Intronic
923231916 1:231994661-231994683 TGATGGTGGTGCTGGGAGTGGGG + Intronic
923365440 1:233256052-233256074 TGAAGGTACAGCAGGAAGGGAGG - Intronic
923796781 1:237164477-237164499 TCAAGGTTGGGCTGAGAGGGTGG + Intronic
924051890 1:240087561-240087583 TGGAGGTGGGGGTGGGAAGGAGG + Intronic
924101195 1:240604208-240604230 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
924392188 1:243574244-243574266 TGAAGGTGGGGGTGGGAATGGGG - Intronic
924794259 1:247281204-247281226 TGAAGGGATGGGTGGGAGGTGGG + Intergenic
1062764243 10:48969-48991 TGAGGGTGGGGGTGGGAGAGCGG - Intronic
1062800593 10:376492-376514 TGAGAGTGGGGTTGGGAGGGGGG + Intronic
1062830770 10:604017-604039 TGAGGGCAGGGCTGGGGGGTGGG - Intronic
1062928380 10:1335349-1335371 TGAAGGGAAGGCTGGAAGGAGGG + Intronic
1063344145 10:5295503-5295525 TGAAGGCAGGGCCTGGTGGGAGG - Intergenic
1063480014 10:6367283-6367305 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1063709718 10:8465449-8465471 TGAGGGTAGGGGTGGGAGGAGGG + Intergenic
1063747508 10:8901719-8901741 GGAAGGTTGGGGTGGGAGGATGG - Intergenic
1064087135 10:12353549-12353571 TGAAGGTTGGCCCAGGAGGGTGG + Intronic
1064288845 10:14015091-14015113 TGAAAGGAAGGGTGGGAGGGAGG - Intronic
1064323893 10:14330963-14330985 GGAGGGAAGGGATGGGAGGGAGG - Intronic
1064433854 10:15293812-15293834 TGAAGCTGGTGCTGGAAGGGTGG + Intronic
1064915609 10:20453700-20453722 TGGAAGTAGGGCTGAGAGGAAGG + Intergenic
1065160141 10:22911310-22911332 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1065198110 10:23286497-23286519 GGAAGGGAGGGAGGGGAGGGAGG + Intronic
1065224001 10:23524383-23524405 TGGAGGTAGGGCTTGGTGGGAGG - Intergenic
1065244390 10:23742703-23742725 TGGAGGTGGGGCTTGGTGGGAGG - Intronic
1065285009 10:24179281-24179303 TGGAGGTAGGGCTTGGTGGGAGG + Intronic
1065416954 10:25498752-25498774 TGAATGTAGGGCTGTGTGGGAGG + Intronic
1066364345 10:34762413-34762435 TGAAGGCTGGGATGGGAGGAAGG - Intronic
1067214796 10:44293083-44293105 AGAAGGGGGGGCGGGGAGGGGGG + Intronic
1067263115 10:44712137-44712159 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1067268209 10:44766152-44766174 GGCAGGTAGGGGTGGGCGGGAGG - Intergenic
1067557898 10:47285079-47285101 GGGAGGGAGGGCAGGGAGGGAGG + Intergenic
1067756836 10:49011820-49011842 TGAAGACAGGGCTGGGTGGCTGG + Intergenic
1067833251 10:49622146-49622168 GACAGGTAGGACTGGGAGGGTGG + Exonic
1068434458 10:56973015-56973037 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1068443792 10:57095025-57095047 TGCAGCTACGTCTGGGAGGGTGG - Intergenic
1068757871 10:60674563-60674585 TGGAGGTGGGGCTGTGTGGGAGG - Intronic
1069075015 10:64030151-64030173 GTGAGGTAGGGGTGGGAGGGTGG + Intergenic
1069785412 10:70984795-70984817 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1070093938 10:73317836-73317858 TGTAGGTAGGGCCTGGTGGGAGG + Intronic
1070410340 10:76133829-76133851 TGAAGTTGGGGATGGGAAGGGGG + Intronic
1070683511 10:78465482-78465504 TGAAGAAAGGGCTGGGCTGGAGG + Intergenic
1070723015 10:78769689-78769711 TGTAGGTGGGACTGGGAGTGGGG - Intergenic
1070888020 10:79921748-79921770 TGGAGGTATAGCTGGGAAGGAGG + Intergenic
1071147080 10:82588225-82588247 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
1071173867 10:82900226-82900248 TGAAGGTGGGGCTTGGTGGGAGG - Intronic
1071293635 10:84204120-84204142 TGAAGGAAGAGGTGGGAGAGAGG - Intronic
1071316543 10:84406250-84406272 AGAAGGTATGGATGGGAGGAGGG + Intronic
1071502856 10:86215776-86215798 AGAAAGAAGGGCTGGGAGGCAGG - Intronic
1071894902 10:90055534-90055556 TGGAGGTGGGGCCTGGAGGGAGG + Intergenic
1071928998 10:90444488-90444510 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1072052408 10:91718805-91718827 TGGAGGTGGGGCCGGGTGGGAGG - Intergenic
1072200859 10:93157649-93157671 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1072205606 10:93202567-93202589 TGAAGGTAGAAATGGGAGAGAGG + Intergenic
1072426796 10:95336942-95336964 TGAAGGGAGGCCTGGGAAGTAGG + Exonic
1072730073 10:97840301-97840323 TGAAGTTAGGAAAGGGAGGGAGG + Intergenic
1072934242 10:99696866-99696888 CGTAGGTAGGGCAGGGAGGATGG + Intronic
1072950697 10:99844476-99844498 TGAAGGAAGGCCTGGATGGGAGG + Intronic
1072998863 10:100270575-100270597 TGAAAGTAGGGATGGGGGGATGG - Intergenic
1073164161 10:101429506-101429528 GGAAGGGAGGGAGGGGAGGGGGG - Intronic
1073239760 10:102049252-102049274 TGAAAATAGGGCTGGCACGGTGG + Intronic
1073396504 10:103222643-103222665 TGGAGGTAGGGCTTGGTGGGAGG - Intergenic
1073579871 10:104655629-104655651 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
1074100267 10:110349145-110349167 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1074156752 10:110806565-110806587 TGAAGGTGGGGCCTGGTGGGAGG - Intronic
1074600075 10:114905024-114905046 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1074671331 10:115795812-115795834 TGAAGGTGGGGCCTGGTGGGAGG - Intronic
1074927044 10:118084304-118084326 TGAAGGTGGGGCCTGGCGGGAGG - Intergenic
1074959837 10:118433221-118433243 TAAAGCTAGAGCTGGGTGGGAGG - Intergenic
1075312976 10:121430258-121430280 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1075470750 10:122687577-122687599 TGGAGGTGGGGCCTGGAGGGGGG - Intergenic
1075470800 10:122687721-122687743 TGGAGGTGGGGCCTGGAGGGGGG - Intergenic
1075685309 10:124360804-124360826 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1076063590 10:127431170-127431192 TGAAAGTAGGGCTGGTGGGTAGG - Intronic
1076361556 10:129893037-129893059 TAAAGGGAGAGCTGGGAGGGAGG - Intronic
1076470202 10:130713460-130713482 TGAAGGTGGGACTGGCAGGTTGG - Intergenic
1076561805 10:131371840-131371862 AGCAAGTAGGGCTGGCAGGGAGG - Intergenic
1076570848 10:131432002-131432024 AGGAGCTGGGGCTGGGAGGGGGG + Intergenic
1076598999 10:131645167-131645189 TGAAGGCAGGGCTGTGCTGGCGG - Intergenic
1076845873 10:133069306-133069328 CGAAGGAAGGGGTGGGAAGGCGG + Intergenic
1076888341 10:133272626-133272648 GGAAGGTACAGCAGGGAGGGTGG + Intronic
1076921013 10:133454657-133454679 TGAGTGTGGGGCTGGGCGGGAGG + Intergenic
1077047650 11:553482-553504 TGGAGGGAGGGCAGGCAGGGCGG + Intronic
1077060490 11:615784-615806 TGAGGGTCGGGCGGGGAGGGAGG - Intronic
1077281284 11:1747366-1747388 TGCAGGAGGGGCTGGGAGCGGGG - Intronic
1077356813 11:2122498-2122520 TGGGGGGAGGGCTGGGAGCGGGG + Intergenic
1077426979 11:2485331-2485353 GGAGGGAAGGGCTGGCAGGGTGG - Intronic
1077599722 11:3565962-3565984 TGAAGGGATGGCTGAGTGGGTGG + Intergenic
1077664124 11:4093019-4093041 TAAAGGTATGGCAGGGAGTGGGG - Exonic
1077792523 11:5456771-5456793 TGAAGGTGGGGCTTGGTGGGAGG + Intronic
1077887929 11:6399885-6399907 TGGAGGTGGGGGTGGGATGGGGG - Intronic
1078082922 11:8217179-8217201 TGGAGGTGGGGGTGGGTGGGAGG + Intergenic
1078516947 11:12030671-12030693 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1078520260 11:12057297-12057319 TGAAGGTAGGGCCTGGTGGGAGG + Intergenic
1078555192 11:12319576-12319598 TGAGGGGAGGGCAGGGAGGAAGG + Intronic
1079243456 11:18736853-18736875 TCCAGGTAGGGCTGGGATCGGGG + Intronic
1079457346 11:20648305-20648327 TGAAGGAAGGGAAGAGAGGGAGG - Intronic
1079637779 11:22766094-22766116 TGAAGGTGGGGCATGGTGGGAGG - Intronic
1079697375 11:23498656-23498678 TGGAGGTGGGACTGGGAGGTTGG - Intergenic
1079733889 11:23971299-23971321 TGAAGGTGGGGCCTGGTGGGTGG + Intergenic
1079737141 11:24011687-24011709 TGAAGGTAGGGCCTGGTGGGAGG + Intergenic
1079833357 11:25299977-25299999 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1080522694 11:33081534-33081556 TGGAGGTAGGGCTTGGTGGGAGG + Intronic
1080547274 11:33333080-33333102 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
1080611212 11:33905704-33905726 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1080689466 11:34544402-34544424 AGAATGTAAGGGTGGGAGGGAGG + Intergenic
1081109771 11:39120806-39120828 TGAAGGAGGGGCTTGGTGGGAGG - Intergenic
1081260701 11:40956785-40956807 TGAAGGTTGGAATGGGAGGGGGG - Intronic
1081540777 11:44033188-44033210 TGAAGGAAGGTCAGGGAGGAGGG - Intergenic
1081752624 11:45522832-45522854 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1081782741 11:45724406-45724428 TGGAGGCAGGCATGGGAGGGAGG - Intergenic
1081792556 11:45798744-45798766 TGGAGGTGGGGCCTGGAGGGAGG - Intergenic
1081839547 11:46187321-46187343 TGATGCAAGGGATGGGAGGGAGG + Intergenic
1081952373 11:47055348-47055370 GGAAGGGAGGGGAGGGAGGGAGG - Intronic
1081952375 11:47055352-47055374 GGAAGGAAGGGAGGGGAGGGAGG - Intronic
1082993086 11:59225706-59225728 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1083128112 11:60593327-60593349 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1083328040 11:61883645-61883667 AGAGGGAAGGGCTGGGAGGGAGG - Intronic
1083367841 11:62152163-62152185 TGGAGGATGGGCTGGGTGGGTGG + Exonic
1083597130 11:63923324-63923346 TGAAGGGAGGGTTGGGAGTGGGG - Intergenic
1083680180 11:64348192-64348214 TGAGGGTAGGGCTGGCGGGCTGG + Intronic
1083753607 11:64777778-64777800 TGGGGGGAGGGCTGGGCGGGCGG - Intronic
1083780615 11:64915543-64915565 TGCAGGCTGAGCTGGGAGGGAGG + Intronic
1084090319 11:66875386-66875408 AAAAGGCAGGGCTGGGAGTGAGG + Intronic
1084111089 11:67014646-67014668 TGGAGGTAGGACTGGGGTGGAGG + Intronic
1084170243 11:67397401-67397423 TGGAGGCAGGGGTGGGAGGTAGG + Intronic
1084255632 11:67940567-67940589 TGAAGGGATGGCTGAGTGGGTGG + Intergenic
1084506181 11:69569925-69569947 GGAAGGGAGGGCTAGGAGGGAGG - Intergenic
1085241780 11:75062497-75062519 TGAACGTGGGGCTTGGTGGGAGG + Intergenic
1085470371 11:76753740-76753762 TGGGGTTAGGGCAGGGAGGGAGG - Intergenic
1085565504 11:77509616-77509638 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1085600470 11:77851552-77851574 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
1085885482 11:80517190-80517212 TGAAGGTGGGGCTTGGTGGGAGG + Intergenic
1086194398 11:84119990-84120012 TGGAGGTATGGCTGGAAGGAGGG + Intronic
1086351478 11:85946157-85946179 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1086428574 11:86713173-86713195 TGTAGGCAGGGTTGGGATGGAGG - Intergenic
1086723649 11:90153007-90153029 GGAAGGAAGAGTTGGGAGGGTGG - Intronic
1087124597 11:94611594-94611616 TGAAGGTAGGGCCTGGTGGGAGG + Intronic
1087302830 11:96455916-96455938 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
1087527152 11:99330160-99330182 GGAAGGGAGGGAGGGGAGGGAGG + Intronic
1087574688 11:99975721-99975743 TGAAGGTAGGGCCTAGTGGGAGG - Intronic
1087905840 11:103696170-103696192 TGAAGCTGGGGAGGGGAGGGAGG - Intergenic
1088109468 11:106245668-106245690 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1088315187 11:108499281-108499303 TGAACAGAGGGCTGTGAGGGAGG - Intergenic
1088460424 11:110076576-110076598 TGGAGGTGGGGCCTGGAGGGAGG - Intergenic
1089007648 11:115105657-115105679 TGGGGGCAGGGGTGGGAGGGTGG + Intergenic
1089063168 11:115642742-115642764 GGAAGCGAGGGCTGGGAGGATGG + Intergenic
1089493575 11:118897876-118897898 TGCAGGGAGGGGTGGGAGAGGGG + Exonic
1089645543 11:119876329-119876351 AGAAGGCAGGGCAGAGAGGGTGG + Intergenic
1089664982 11:120012676-120012698 TGAAGGTAAGTCTGGGAGGATGG - Intergenic
1089667927 11:120032170-120032192 TGGAGGTAGGGAGGAGAGGGTGG + Intergenic
1089896531 11:121935703-121935725 TGGAGGTGGGGCCTGGAGGGAGG - Intergenic
1089995472 11:122902831-122902853 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
1090202238 11:124865270-124865292 TAGAGGTAAGGGTGGGAGGGTGG + Intergenic
1090257994 11:125299262-125299284 CGGAGGTGGGGCTGGGCGGGAGG - Intronic
1090270097 11:125379992-125380014 TGAGGGTAGGGGGTGGAGGGTGG + Intronic
1090357270 11:126148297-126148319 TGAAGGTATAGCTGGGATCGGGG - Intergenic
1090438326 11:126705288-126705310 TGAAGGTGGGGCCTGGTGGGAGG + Intronic
1091192930 11:133709246-133709268 TGAAGGTGGGGAGGGGAGAGGGG - Intergenic
1091323269 11:134666332-134666354 TGAAGGCTGGCCTGGGAGGATGG + Intergenic
1091396145 12:155303-155325 TGAGGGTGGGGCTGGGGTGGAGG - Intronic
1091397305 12:161879-161901 TGGTGGTGGGGTTGGGAGGGAGG - Intronic
1091473553 12:752040-752062 TGACTGCAGGGCTGTGAGGGTGG - Intergenic
1091543288 12:1482308-1482330 GGAAGGCAGGGTTGGGGGGGTGG - Intronic
1091555103 12:1566976-1566998 TTAAGGTGGGGGCGGGAGGGAGG + Intronic
1091842687 12:3632016-3632038 TGGAGGTGGGGCCTGGAGGGAGG + Intronic
1091844734 12:3647153-3647175 GGAGGGTAGGGGTGGGACGGTGG - Intronic
1091889354 12:4040784-4040806 TGACGGCAGGGGTGGGTGGGTGG + Intergenic
1091981536 12:4868094-4868116 GGGAGGTAGGGGAGGGAGGGAGG + Intergenic
1092222960 12:6727859-6727881 ACAGGGTAAGGCTGGGAGGGTGG + Intronic
1092374888 12:7947301-7947323 AGAAGGGAGGGGAGGGAGGGAGG - Intergenic
1092425867 12:8375301-8375323 TGAAGGGATGGCTGAGTGGGTGG + Intergenic
1092572466 12:9739955-9739977 TGCAGGGAGGTGTGGGAGGGAGG - Intergenic
1092786181 12:12029067-12029089 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1092811629 12:12276251-12276273 TGGAGTTGGGGCTGGGTGGGAGG - Intergenic
1092952846 12:13524223-13524245 TCAGGGTAGGGCTGGGAGGCAGG + Intergenic
1093172844 12:15878500-15878522 TGGAGGGAGGAGTGGGAGGGGGG + Intronic
1093591495 12:20907385-20907407 AGAAGGAAGGGGAGGGAGGGAGG - Intronic
1093613738 12:21195055-21195077 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
1093878232 12:24374782-24374804 TGTGGCTAGGGCTGGGAGTGTGG - Intergenic
1093883616 12:24434568-24434590 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1094196325 12:27753458-27753480 TGGGGATAGGGGTGGGAGGGTGG + Intronic
1094242337 12:28242748-28242770 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
1094443997 12:30510009-30510031 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1094473116 12:30821938-30821960 TATAGGTAGGTGTGGGAGGGAGG - Intergenic
1094706630 12:32920513-32920535 TGAAAGTAGGCCTGGCACGGTGG - Intergenic
1095102850 12:38201822-38201844 TGAGGGTGGGGGTGGGAGAGGGG + Intergenic
1095106071 12:38234204-38234226 TGAAGGTAGGACCCGGTGGGAGG + Intergenic
1095226607 12:39685547-39685569 TGGAGGTGGGGCTTGGTGGGAGG - Intronic
1095238706 12:39831625-39831647 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
1095399836 12:41801345-41801367 GGAAGGGAGGGAAGGGAGGGAGG + Intergenic
1095444642 12:42271761-42271783 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1095471178 12:42538473-42538495 AGAAGGTAGGGGTGCGGGGGTGG + Intronic
1095837748 12:46656561-46656583 TGAAGGTAGGGGTGGGAGAGGGG + Intergenic
1096080218 12:48828013-48828035 TGAAGCTGGGGCTGGGCAGGGGG - Exonic
1096160396 12:49371858-49371880 TGAAGGTGGGGCCTGGTGGGAGG - Intronic
1096572174 12:52529917-52529939 GGCAGGCAGGGCTGGGAGGCAGG - Intergenic
1097548888 12:61041569-61041591 TGAAGGGAGGGCCTGGTGGGAGG - Intergenic
1097755965 12:63407056-63407078 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1098146672 12:67504467-67504489 TGGAGGTTGGGCTTGGTGGGAGG + Intergenic
1098241686 12:68473561-68473583 TGAAAATTGGGGTGGGAGGGGGG + Intergenic
1098571146 12:71988634-71988656 TGAAGGTGGGGCCTGGTGGGAGG - Intronic
1098978640 12:76931103-76931125 TGATTGTTGGGATGGGAGGGTGG + Intergenic
1099049868 12:77768723-77768745 TGAAGCTATGCCTGGGAGGGCGG + Intergenic
1099476120 12:83109368-83109390 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
1100002565 12:89855188-89855210 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1100317734 12:93461010-93461032 TGGTGGTAGGGCTGGGGGCGTGG - Intergenic
1100330688 12:93579149-93579171 TGCTGGTAAGGATGGGAGGGCGG - Intronic
1100591884 12:96037042-96037064 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
1100709092 12:97234967-97234989 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1100877193 12:98975008-98975030 GGAAGGGAGGGGAGGGAGGGAGG - Intronic
1100877195 12:98975012-98975034 GGAAGGAAGGGAGGGGAGGGAGG - Intronic
1100915917 12:99421801-99421823 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
1101121006 12:101580081-101580103 TGTGGGTAGGGGTGGGAGGAGGG - Intronic
1101171484 12:102101164-102101186 TGAAGGGAAGGATGGGGGGGAGG - Intronic
1101193424 12:102358400-102358422 TGGAGGTAGGGCTTGCTGGGAGG - Intergenic
1101616698 12:106344894-106344916 TGCAGGAAGGGCAGGGAAGGTGG + Intronic
1101639729 12:106579334-106579356 TGCAGGAGGGGGTGGGAGGGAGG - Intronic
1101819566 12:108173479-108173501 TGAAGGCAGGGGAGGGTGGGGGG - Intronic
1101897999 12:108770237-108770259 GGAAGGGAGGGCTGGGGAGGTGG - Intergenic
1101898050 12:108770386-108770408 GGAAGGGAGGGCTGGGGAGGTGG - Intergenic
1101941168 12:109100137-109100159 TGGAGGTAAGGCTGAGAGGTAGG - Intronic
1102893615 12:116581015-116581037 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1103230533 12:119326775-119326797 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1103260153 12:119580471-119580493 TAGAGGTGGGGGTGGGAGGGTGG + Intergenic
1103425471 12:120830315-120830337 GGAAGGGAGGGGTGGGGGGGAGG + Intronic
1103507676 12:121452790-121452812 TGAAGGCAGGGCCGGAAGGAAGG + Intronic
1103514845 12:121500744-121500766 AGACGGTGGGGCTGGGATGGAGG - Intronic
1103553414 12:121751654-121751676 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1103892332 12:124249341-124249363 TGAAGGAGGGGGTGGGATGGGGG + Intronic
1103937331 12:124483524-124483546 TGCTGGTTGGGCTGGGTGGGAGG - Intronic
1103994522 12:124820533-124820555 TGAAGGAAGGGCTGGGCGATCGG - Intronic
1104110158 12:125697200-125697222 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1104127043 12:125857771-125857793 TGAAGGTGGGGCACGGTGGGAGG + Intergenic
1104400650 12:128473256-128473278 TGAAGATAGGGGTTGGAGTGAGG - Intronic
1104709387 12:130974818-130974840 TGGAGGGAGGGCCGGGAGCGGGG - Intronic
1104934422 12:132356921-132356943 AGATGGTGGGGCTGGGACGGCGG - Intergenic
1104950440 12:132437521-132437543 CGAAGGAAGGGAGGGGAGGGAGG + Intergenic
1104998678 12:132674824-132674846 GGAAGGAAGGGAAGGGAGGGAGG - Intronic
1104998687 12:132674846-132674868 GGAAGGAAGGGAAGGGAGGGAGG - Intronic
1104998700 12:132674881-132674903 GGAAGGAAGGGAAGGGAGGGAGG - Intronic
1105514665 13:21078315-21078337 TGAAGGTGAGGAAGGGAGGGAGG + Intergenic
1105871631 13:24510887-24510909 TGAAAGGATTGCTGGGAGGGAGG - Intronic
1106130385 13:26934562-26934584 TGAAAGTAGGGCCTGGTGGGAGG + Intergenic
1106192667 13:27467296-27467318 CCAAGGTAGGAATGGGAGGGAGG - Intergenic
1106269567 13:28139340-28139362 TGAAGGGGGGGCGGGGAGGAAGG + Intronic
1106338691 13:28808046-28808068 TGGAAGTGGGGCTGGGTGGGAGG + Intergenic
1106383583 13:29263798-29263820 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
1106606330 13:31232544-31232566 TGGAAGTAGGGCCTGGAGGGAGG - Intronic
1106989110 13:35395249-35395271 TGGAGGTTGGGCTCGGTGGGAGG + Intronic
1107127824 13:36863566-36863588 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
1107472637 13:40704642-40704664 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1107675828 13:42795827-42795849 TTAAGGTCAGGCAGGGAGGGAGG + Intergenic
1108117945 13:47150478-47150500 AAAATGTAGGGCTGGGAGTGGGG - Intergenic
1108174400 13:47777480-47777502 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1108521979 13:51254530-51254552 TGGGGGTAGGGCAGGGAGGTAGG + Intronic
1108529320 13:51314295-51314317 TGAGGGTGGAGCTGGGAGGAGGG + Intergenic
1108683440 13:52799066-52799088 GGAAGGAAGGGGAGGGAGGGAGG - Intergenic
1108723688 13:53158780-53158802 AGAAGGAAGGGCAGGGAGGAAGG - Intergenic
1108777607 13:53785225-53785247 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1109252324 13:60033672-60033694 TGAAGGTGGGGCCTGGTGGGAGG - Intronic
1110117772 13:71841352-71841374 GGAAGGGAGAGCGGGGAGGGAGG + Intronic
1110375059 13:74783900-74783922 TGGAGGCAGGGAAGGGAGGGAGG + Intergenic
1110411037 13:75204222-75204244 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1110752794 13:79135511-79135533 GGAAGGGAGAGCAGGGAGGGAGG + Intergenic
1110909242 13:80934484-80934506 TGAAGGTAGGGCCTAGTGGGAGG - Intergenic
1111332143 13:86773726-86773748 TGAAGGTAGGCCAGGCACGGTGG + Intergenic
1111368162 13:87278611-87278633 TAAATTTCGGGCTGGGAGGGTGG + Intergenic
1111405940 13:87806265-87806287 TAACAGTAGGGCTGTGAGGGTGG + Intergenic
1111537514 13:89622991-89623013 TGGAGGTTGGGCTGGGTGGGGGG - Intergenic
1111559941 13:89932263-89932285 TGGAGGAAAGGGTGGGAGGGGGG - Intergenic
1111578623 13:90192704-90192726 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1111721434 13:91950354-91950376 GGAGGGTGGGGCTGGGAGGGAGG - Intronic
1111805333 13:93033385-93033407 TGAAAGTAGGGGTGAAAGGGTGG - Intergenic
1111838990 13:93425791-93425813 TGAAAGTGGAGCTGGGAGAGGGG - Intronic
1111937432 13:94571372-94571394 TGCAGGTAGGGCCTGGTGGGGGG - Intergenic
1112023686 13:95393517-95393539 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1112202119 13:97286901-97286923 TGAATGTAAGGCTGGGAGGCAGG + Intronic
1112295243 13:98180390-98180412 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
1112450898 13:99508855-99508877 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
1112575025 13:100627770-100627792 GGAAGCCAGGGGTGGGAGGGTGG + Intronic
1112864228 13:103873308-103873330 TGGAGGTAGGGCTTGATGGGAGG - Intergenic
1112874805 13:104024112-104024134 TGGAGGTGGGGCCTGGAGGGAGG - Intergenic
1113503890 13:110799697-110799719 TGCAGTCAGCGCTGGGAGGGAGG - Intergenic
1113942406 13:114025115-114025137 AGAAGGGGGGGCAGGGAGGGAGG - Intronic
1114140099 14:19900128-19900150 TGGAGGTAGGGCTTGGTTGGAGG + Intergenic
1114259534 14:21026500-21026522 TGAGGGTGGTGGTGGGAGGGTGG - Intronic
1114444184 14:22775618-22775640 TGAAGGAAGGGATGGCAGAGAGG - Intronic
1114454234 14:22845076-22845098 GGAAGGTGGGGGTGGAAGGGAGG - Intronic
1114536538 14:23426609-23426631 GCAAGGTAGCGCTGAGAGGGAGG + Intronic
1114598566 14:23935137-23935159 TGGAGGTGGGGCCTGGAGGGAGG - Intergenic
1114623482 14:24113816-24113838 TGAGGGCAGGGATGGGAGCGAGG - Intronic
1114712139 14:24789428-24789450 GGAAGGTGGGGCAGGGAGTGGGG - Intergenic
1114977113 14:28115563-28115585 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1115128678 14:30026641-30026663 TGAAGATGGGGCCGGGTGGGAGG + Intronic
1115318615 14:32053673-32053695 TGGAGGTGGGGCTGAGTGGGAGG - Intergenic
1115500786 14:34047665-34047687 TAGAGGTAGGGCCTGGAGGGAGG - Intronic
1115971579 14:38950593-38950615 TGAAGGTAGGGCCTGGTGGGAGG + Intergenic
1116093156 14:40334476-40334498 TCAGAGTTGGGCTGGGAGGGAGG + Intergenic
1116174920 14:41456407-41456429 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1116319986 14:43449125-43449147 TGAAGGTAGGGCATGGTGGGAGG - Intergenic
1116858679 14:49976288-49976310 TGAAGGTAGGCCTTCCAGGGAGG - Intergenic
1117051541 14:51865320-51865342 TGGAGGTGAGGGTGGGAGGGTGG - Intronic
1117150591 14:52883843-52883865 AGGAGGTAGGGGTGGGAGTGGGG - Intronic
1117252715 14:53952663-53952685 TGAAAGTTGGGCTCTGAGGGTGG - Intronic
1117594735 14:57314762-57314784 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1117881970 14:60320905-60320927 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1117886863 14:60372728-60372750 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1117890575 14:60417675-60417697 TGAAACTTGGGCTGGGAGAGAGG - Intronic
1118024628 14:61756462-61756484 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1118373630 14:65158318-65158340 AGATGGTAGGGCTGGGAGAGTGG + Intergenic
1118388471 14:65276654-65276676 TTAATGTAGGGGGGGGAGGGGGG - Intergenic
1118861634 14:69668712-69668734 TGAAGTTGGGGCTTGGTGGGAGG + Intronic
1119386604 14:74261257-74261279 AGAATGTAGAGCTGGGAAGGAGG - Exonic
1119876127 14:78060964-78060986 TGAAGGCAGGGCTGGGGGTGTGG - Intergenic
1119956893 14:78808540-78808562 AGGAGGGAGGGCAGGGAGGGAGG - Intronic
1120016546 14:79480680-79480702 TGGAGGTGGGCCTTGGAGGGAGG + Intronic
1120464100 14:84833826-84833848 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1120502214 14:85310824-85310846 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1120548767 14:85843912-85843934 TCAAGGGAGGGCTGGGACAGAGG + Intergenic
1120589961 14:86363662-86363684 TGCAGCTATGCCTGGGAGGGAGG - Intergenic
1120840087 14:89077931-89077953 TGTAGGTGGGGTTGGGTGGGAGG + Intergenic
1121254530 14:92521423-92521445 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
1121288235 14:92753251-92753273 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1121678834 14:95776091-95776113 TGAAGGTAGGGCCTGGTGGGAGG - Intergenic
1122121878 14:99558854-99558876 TGGAGGTGGGGCCTGGAGGGAGG + Intronic
1122275645 14:100589430-100589452 AGAAGAGAGGGCAGGGAGGGTGG - Intergenic
1122574159 14:102731351-102731373 TACAGGCAGGTCTGGGAGGGAGG + Intergenic
1122652325 14:103232507-103232529 GGAGGGCAGGGCTGGGAGGCAGG + Intergenic
1122652356 14:103232591-103232613 GGAGGGTGGGGCTGGGAGGGTGG + Intergenic
1122794660 14:104200134-104200156 TGAGGGTAGGGGTGGGGGTGGGG + Intergenic
1123043649 14:105500789-105500811 TGAAGGCAGGGGAGGGAGGCAGG - Intergenic
1123126071 14:105947115-105947137 TGAATGCATGGCTGGGTGGGTGG - Intergenic
1123406655 15:20023537-20023559 TGAATGCATGGCTGGGTGGGTGG - Intergenic
1123515985 15:21030185-21030207 TGAATGCATGGCTGGGTGGGTGG - Intergenic
1123775546 15:23575565-23575587 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
1123795204 15:23763913-23763935 TGAATGTGGGGTTGGAAGGGTGG + Intergenic
1124211228 15:27766768-27766790 TCAAGGGATGGCTGGGAGGTAGG - Intronic
1124345118 15:28917166-28917188 TGGAGGGAGGGCAGGGAGGATGG - Intronic
1124486409 15:30121164-30121186 GGAAGGAAGGGACGGGAGGGAGG - Intergenic
1124486417 15:30121185-30121207 GGAAGGAAGGGACGGGAGGGGGG - Intergenic
1124507270 15:30289239-30289261 TGGAGGTGGGGCCTGGAGGGAGG + Intergenic
1124541483 15:30590143-30590165 GGAAGGAAGGGATGGGAGGGAGG - Intergenic
1124541491 15:30590164-30590186 GGAAGGAAGGGACGGGAGGGGGG - Intergenic
1124548164 15:30651967-30651989 GGAAGGAAGGGATGGGAGAGGGG - Intronic
1124685556 15:31778819-31778841 TGATGATGGGGCTGGGAGCGGGG - Intronic
1124736286 15:32249420-32249442 TGGAGGTGGGGCCTGGAGGGAGG - Intergenic
1124757167 15:32417421-32417443 GGAAGGAAGGGACGGGAGGGGGG + Intergenic
1124757175 15:32417442-32417464 GGAAGGAAGGGACGGGAGGGAGG + Intergenic
1125098138 15:35878298-35878320 GGAAGGTAGAGCAGGGAGAGAGG - Intergenic
1125262291 15:37840695-37840717 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1126155905 15:45565429-45565451 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1126226815 15:46280339-46280361 TGAGGGAAGGGGAGGGAGGGAGG + Intergenic
1126444547 15:48727637-48727659 TAAAGGTAGGCCTGGTACGGTGG + Intronic
1126456045 15:48862986-48863008 TGGGGGTGGGGCTGGCAGGGAGG - Intronic
1127586390 15:60382043-60382065 AGAAGGGAGGGGAGGGAGGGAGG + Intronic
1127715191 15:61642952-61642974 TGAATGGAGGGAAGGGAGGGTGG + Intergenic
1127755728 15:62090165-62090187 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1127806514 15:62525993-62526015 TGCAGGTGGGGCAGGAAGGGTGG + Intronic
1128006025 15:64242302-64242324 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
1128312113 15:66637300-66637322 TGAGGGAAGGGCAGGGAGGAGGG + Intronic
1128478754 15:68019470-68019492 GGAAAGTAGGGAGGGGAGGGTGG + Intergenic
1128643358 15:69356926-69356948 TGAAGGTGGGGCCTGGAGGGAGG + Intronic
1129123003 15:73414335-73414357 TCAAGGTAGGGCTGGGACCCTGG - Intergenic
1129144311 15:73633270-73633292 GGAAGGGAGGGGAGGGAGGGAGG + Exonic
1129322874 15:74784301-74784323 GGAAGTTAGGGCTGGGTGTGGGG - Intronic
1129905259 15:79182786-79182808 GGAAGGAAGGGGAGGGAGGGAGG - Intergenic
1129954836 15:79626812-79626834 GGAAGGAAGGGGAGGGAGGGAGG + Intergenic
1130177647 15:81591565-81591587 TGAAGGATGGGTTTGGAGGGTGG + Intergenic
1130199679 15:81813428-81813450 GGAAGGTGGGAATGGGAGGGAGG - Intergenic
1130297433 15:82657049-82657071 TGAAGGCTGGGCTGGGAGATTGG - Intergenic
1130346982 15:83056679-83056701 TGAATGGATGGCTGGGTGGGTGG - Intronic
1130417803 15:83710467-83710489 TGAAGGTGGTGGGGGGAGGGAGG - Intronic
1130899490 15:88196400-88196422 GGAAGGGTGGGCTGGGATGGGGG + Intronic
1131271917 15:90952821-90952843 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
1131612088 15:93975982-93976004 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1131678631 15:94698479-94698501 TTAAGGTAGGGCTGCTAGTGGGG + Intergenic
1131913167 15:97231546-97231568 GGAAGGGAGGGAAGGGAGGGAGG + Intergenic
1132172923 15:99681329-99681351 TGAAGGTGGGGATGGGATGGCGG + Intronic
1132194902 15:99907241-99907263 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1132209765 15:100011310-100011332 GGAAAGGAGGGATGGGAGGGAGG + Intronic
1132367705 15:101269543-101269565 AGAAGGGAGGGCTGCGAGGAGGG + Intergenic
1132434334 15:101784767-101784789 AGAAGGGAGGGAAGGGAGGGAGG + Intergenic
1132949030 16:2549990-2550012 TCATGGGAGGGCTGGGAGTGTGG + Intronic
1132965558 16:2652137-2652159 TCATGGGAGGGCTGGGAGTGTGG - Intergenic
1133474030 16:6102563-6102585 TGCTGGAAGGGGTGGGAGGGTGG - Intronic
1133593950 16:7272828-7272850 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1133819746 16:9226078-9226100 GGAAGGAAGGGAAGGGAGGGAGG - Intergenic
1133853065 16:9524275-9524297 GGAAGGGAGGGAGGGGAGGGAGG - Intergenic
1133915093 16:10102189-10102211 TGGAGGTAGGGCCTGGCGGGAGG + Intronic
1134009012 16:10837394-10837416 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1134087465 16:11367836-11367858 GGAAGGAAGAACTGGGAGGGGGG + Intronic
1134196283 16:12161756-12161778 AGAAGGGCGGGCAGGGAGGGTGG - Intronic
1134224383 16:12380333-12380355 TGAAGGGATGGGTGGGTGGGGGG - Intronic
1134299352 16:12975728-12975750 TGTAGGTGGGGCTGGGAGGGGGG + Intronic
1134383101 16:13746676-13746698 CAAAGGTAGGGCAGGGAGAGAGG + Intergenic
1134438091 16:14280129-14280151 GGAACTTAGAGCTGGGAGGGTGG + Intergenic
1134760429 16:16709786-16709808 GGAGGGTAGGGGAGGGAGGGAGG - Intergenic
1134985631 16:18649387-18649409 GGAGGGTAGGGGAGGGAGGGAGG + Intergenic
1135151728 16:20012894-20012916 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1135733037 16:24910162-24910184 TGGAGGATGGGGTGGGAGGGTGG + Intronic
1135738498 16:24953411-24953433 TGAAGGCAGGGCCTGGTGGGAGG + Intronic
1135930541 16:26732593-26732615 TGGAGGTGAGGCTGGGTGGGAGG + Intergenic
1136247729 16:28985111-28985133 GGCAGGTAGGGCTGGGACGCAGG + Intronic
1136421250 16:30134867-30134889 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1136505837 16:30702578-30702600 GGAAGGCAGGGAAGGGAGGGAGG - Intronic
1136524595 16:30820924-30820946 TGAAGGCAGAGGTGGGAGGCTGG + Intergenic
1137893834 16:52189945-52189967 TGGAGGTAGAGCCTGGAGGGAGG + Intergenic
1138074917 16:54032770-54032792 TGGAGGTAGGGTTTGGTGGGAGG + Intronic
1138113382 16:54341835-54341857 AGAAGGAAGGGATGGGAGGGTGG + Intergenic
1138183534 16:54959521-54959543 AGAGGGCAGGGATGGGAGGGTGG - Intergenic
1138417555 16:56879951-56879973 TTATGGTAGGGCGGGGAGGGTGG + Intronic
1138567980 16:57847262-57847284 GGAAGGAAGGGAAGGGAGGGAGG + Intronic
1138579058 16:57927746-57927768 TGAAGGCTGGGCTGGGTAGGGGG - Intronic
1138654266 16:58481796-58481818 TGAGGGTGGGGCAGGGATGGGGG - Intronic
1138726237 16:59142423-59142445 TGGAGGTAGGGCTTGGTGGGAGG + Intergenic
1138991974 16:62401478-62401500 TGAAGGTGGAGCCGGGTGGGAGG + Intergenic
1139004195 16:62551249-62551271 GGGAGGGAGGGCAGGGAGGGAGG - Intergenic
1139041739 16:63006275-63006297 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1139158891 16:64478851-64478873 GGAAAGTAGGGGTGGGTGGGGGG + Intergenic
1139246782 16:65452379-65452401 GGAAGGAAGGACGGGGAGGGAGG + Intergenic
1139410835 16:66759458-66759480 TGAAATAAGTGCTGGGAGGGAGG + Intronic
1139475986 16:67202811-67202833 GGAAGGTAGGGCTAGGACTGAGG - Intronic
1139605599 16:68015998-68016020 TGTAGGGAGGGCTGGATGGGAGG - Intronic
1139691918 16:68646506-68646528 TGAACTTGGGGCGGGGAGGGGGG - Intronic
1140236894 16:73167318-73167340 TAAACGTGTGGCTGGGAGGGAGG - Intergenic
1140297895 16:73726797-73726819 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1140533100 16:75683891-75683913 TGGAAGAAGGGCTGGGATGGAGG + Intronic
1140556234 16:75924678-75924700 TGAAGGTGGGGCTTGGTGGGAGG + Intergenic
1140621281 16:76736305-76736327 TGAAGCTAGGCCTGTGAGGAAGG - Intergenic
1140740674 16:77938460-77938482 TGGAGGAGGGGCTGGGTGGGAGG + Intronic
1140835600 16:78791098-78791120 TGAAGGAAGGGCAGGGAAGAAGG + Intronic
1140914644 16:79483029-79483051 TGGAGGGAGGGGAGGGAGGGAGG - Intergenic
1141126952 16:81407704-81407726 TGAAGGAAGACCTGGCAGGGTGG - Intergenic
1141488277 16:84355250-84355272 TGAATGTATGGGTGGGTGGGTGG + Intergenic
1141735082 16:85846931-85846953 AGAAGGCCGAGCTGGGAGGGAGG + Intergenic
1141756792 16:85996781-85996803 TGGAGGTAGGAGAGGGAGGGAGG + Intergenic
1141803927 16:86330163-86330185 TGAATGGAAGGCTGGGAGGAGGG + Intergenic
1141826168 16:86481940-86481962 TGAAGGAAGGGCAGGAAGAGAGG - Intergenic
1141926465 16:87173571-87173593 TGGAGGGTGGGCTGGGAGGATGG - Intronic
1141927287 16:87177907-87177929 GGCAGGAAGGGCTGGGAGGCTGG + Intronic
1142183958 16:88685753-88685775 TGAAGGGAGGTGGGGGAGGGAGG + Intronic
1142262993 16:89051253-89051275 GGCAGGGAGGGCTGGGGGGGCGG - Intergenic
1142365295 16:89646886-89646908 AGAGGGTGGGGCTGGGTGGGGGG - Intronic
1142502498 17:340620-340642 TGTGGGGAGGCCTGGGAGGGGGG - Intronic
1142502573 17:340836-340858 TGTGGGGAGGCCTGGGAGGGGGG - Intronic
1142567918 17:852625-852647 AGAAAGTAGGGCTGGGTGGGTGG + Intronic
1142597616 17:1037126-1037148 TCCAGGTGGGGCTGGGAGAGGGG + Intronic
1142624509 17:1183298-1183320 TGGAGGGAGGGCTGGGAGGGTGG - Intronic
1142660863 17:1428402-1428424 TGAAAGAAGGGCTGGCACGGTGG - Intronic
1142805389 17:2368662-2368684 TATTGGAAGGGCTGGGAGGGAGG - Intronic
1143217257 17:5234310-5234332 TGGAGGTGGGGGTGGGAGCGAGG - Intronic
1143241223 17:5444740-5444762 TGAAGGTAGGGCTGGGAGGGAGG + Intronic
1143427313 17:6850221-6850243 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1144140280 17:12341248-12341270 TGGGGGTTGGGCTGGGTGGGAGG + Intergenic
1144480500 17:15625133-15625155 TGGAGGTGGAGCTGGGTGGGAGG - Intronic
1144904155 17:18626296-18626318 AGAAGGTAGAGCTGTCAGGGTGG + Intergenic
1144917810 17:18738612-18738634 TGGAGGTGGAGCTGGGTGGGAGG + Intergenic
1145025229 17:19463209-19463231 TGGAGGTGGGGCTTGGAGGGAGG + Intergenic
1146175202 17:30661728-30661750 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1146342548 17:32033322-32033344 GGAAGGGAGGGAGGGGAGGGAGG + Intronic
1146348654 17:32077762-32077784 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1146763246 17:35496474-35496496 AGAAGGAAGGGTAGGGAGGGAGG - Intronic
1146946135 17:36874887-36874909 TGGAGGTGGGGATAGGAGGGAGG - Intergenic
1147133247 17:38420828-38420850 TAGTGGTAGGGCGGGGAGGGAGG + Intergenic
1147626541 17:41904181-41904203 GGAAGGAAGGGAGGGGAGGGAGG + Intronic
1147626543 17:41904185-41904207 GGAAGGGAGGGGAGGGAGGGAGG + Intronic
1147626566 17:41904245-41904267 GGAAGGAAGGGAGGGGAGGGAGG + Intronic
1147816413 17:43213897-43213919 TGAAGCTAGGGGAGGAAGGGGGG - Intronic
1147964932 17:44189484-44189506 TGAGGCCAGGGCTGGGAGGGAGG - Exonic
1147991111 17:44334011-44334033 GGCTGGGAGGGCTGGGAGGGAGG + Intergenic
1148075290 17:44932196-44932218 TGCAGGGCTGGCTGGGAGGGTGG + Exonic
1148235999 17:45969569-45969591 TGAAGGAAGGGATGGGTGGATGG - Intronic
1148236018 17:45969672-45969694 TGAAGGAAGGGATGGGTGGATGG - Intronic
1148324784 17:46776916-46776938 TCAAGCAAGGGCTGGGAGAGGGG - Intronic
1149012487 17:51871670-51871692 AGAAGGAAGGGCTGGCATGGTGG - Intronic
1149016875 17:51917770-51917792 TGAAGGTAGGGCCTGGCAGGAGG - Intronic
1149148980 17:53536281-53536303 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1149283248 17:55131759-55131781 TTAAGGCAGGGGTGGGTGGGGGG - Intronic
1149469295 17:56902801-56902823 TGGAGGTGGGGCAGGGTGGGAGG + Intronic
1149565694 17:57639335-57639357 TGGAGGTAGGAATGCGAGGGAGG - Intronic
1150294690 17:64001533-64001555 TTCAGGTAGGGCTGGGGTGGTGG + Intronic
1150361715 17:64541047-64541069 TGGAGGTGGGGCTGAGATGGGGG - Intronic
1150424835 17:65069004-65069026 GGATGGAAGGGCTGGGAGGGAGG - Intergenic
1150434870 17:65145944-65145966 AGAAAGAAGGGCTGGGTGGGAGG - Intronic
1150450787 17:65266008-65266030 TAAAGGTAGGGCTGAGTAGGAGG + Intergenic
1150774041 17:68065063-68065085 TGCAGGGAGGGCAGGGAGGAGGG - Intergenic
1150835311 17:68558393-68558415 TGAAGGTGGGGCCTGGTGGGAGG + Intronic
1150969548 17:70011486-70011508 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1150997230 17:70332541-70332563 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1151061621 17:71101099-71101121 TGAAGGTAGGGCCTGGTGCGAGG - Intergenic
1151115450 17:71730018-71730040 TGGAGGTGGGGCCTGGAGGGAGG + Intergenic
1151334644 17:73432660-73432682 AGGAGGTAGGGCTGGAGGGGAGG + Intronic
1151546020 17:74793640-74793662 TGGAGGAAAGGCTGGGAGTGGGG + Intronic
1151660839 17:75517100-75517122 GGCAGGGAGGGCAGGGAGGGCGG - Intronic
1151667146 17:75551476-75551498 AGAAGGTGGGGATGGGGGGGAGG + Intronic
1151817006 17:76476308-76476330 AGAAGCTGGGGCTGGGAGGGAGG - Intronic
1151928505 17:77215801-77215823 CGTAGGTAGGGCTGGTAGGTAGG + Intronic
1151929884 17:77225687-77225709 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1151941647 17:77295971-77295993 TGAAGATAGGGCTTTTAGGGAGG + Intronic
1152315317 17:79577103-79577125 TGAGGGCAAGGCTGGGATGGGGG - Intergenic
1152366863 17:79861430-79861452 TGAAGGCTGAGATGGGAGGGAGG + Intergenic
1152452059 17:80387749-80387771 TGGAGGCAGGGCTGGAAGGTTGG - Intronic
1152655756 17:81518546-81518568 TAACTCTAGGGCTGGGAGGGAGG + Intronic
1152805740 17:82355116-82355138 GGAAGGGTGGGCTGGGAGTGAGG + Intergenic
1152930258 17:83105673-83105695 TGTGGGTGGGGCTGGGAGGGAGG - Intergenic
1153160830 18:2203145-2203167 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1153350028 18:4069442-4069464 TGAAGGTGGGGCCTGGTGGGAGG + Intronic
1153538137 18:6125186-6125208 GGAAGGAAGGGAGGGGAGGGAGG + Intronic
1153647189 18:7205894-7205916 GGAAGGGAGGGAGGGGAGGGAGG - Intergenic
1153944775 18:10009087-10009109 TGGTGGTATGGCAGGGAGGGAGG + Intergenic
1154083467 18:11280157-11280179 TGGAGGTAGGGCTTGGTGGGAGG - Intergenic
1154167187 18:12024726-12024748 GGGAGGAAGGGCAGGGAGGGAGG - Intronic
1154297613 18:13164316-13164338 TGCAGGTAGAGCTGGGAGGTGGG + Intergenic
1154396081 18:13990598-13990620 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1154501954 18:15001608-15001630 GCAAGGCAGGGCTGGGAGGTGGG - Intergenic
1155044743 18:22094166-22094188 ACAAGGCAGGGCTGGGTGGGTGG - Intronic
1155061756 18:22234906-22234928 TAAAGAGAGGGCTTGGAGGGTGG + Intergenic
1155215010 18:23635679-23635701 TGAAGGCAGGGCTGAGGGTGGGG - Intronic
1155428796 18:25734131-25734153 TAATGGTAGGGGTGGCAGGGTGG - Intergenic
1155798905 18:30074768-30074790 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1155878871 18:31119125-31119147 GGAAGGAAGGGGTAGGAGGGGGG + Intergenic
1155891605 18:31277434-31277456 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1156068404 18:33174279-33174301 TGAAGGTGGGGCTTGATGGGAGG - Intronic
1156219712 18:35038970-35038992 TGAAGGAAGGGATGGGATGATGG - Intronic
1156461475 18:37323629-37323651 GGAAGGGAAGGCTAGGAGGGCGG - Intronic
1156755377 18:40517571-40517593 AGTAGGTATGGCAGGGAGGGTGG - Intergenic
1156790374 18:40965281-40965303 TGAGGGTGGGGCTGGGAGGGGGG + Intergenic
1156814934 18:41298359-41298381 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1156897184 18:42259087-42259109 TGGAGGTGGGGCTGTGTGGGAGG + Intergenic
1156960367 18:43021513-43021535 TGGAGGTGGGGCTTGGAGAGAGG + Intronic
1157034439 18:43953967-43953989 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1157396680 18:47347378-47347400 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1157431039 18:47626948-47626970 TGAAGGCTGGACTGGAAGGGAGG - Intergenic
1157516268 18:48313833-48313855 TGGAGGTAGGGCCCGGTGGGAGG + Intronic
1158570355 18:58592559-58592581 AGGAGGTAGGGCTGGGGGAGAGG + Intronic
1158878559 18:61754787-61754809 TGAAAGCAGGGCTGAGAGGGAGG - Intergenic
1158899481 18:61949658-61949680 TGAGGGTAGGGCAGGGAATGGGG - Intergenic
1159096289 18:63906155-63906177 TGGAAGTAGGGCTTGGTGGGAGG + Intronic
1159600948 18:70428191-70428213 AGAAGGTAGGACTAGGAGTGCGG + Intergenic
1159759660 18:72408712-72408734 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1160272948 18:77404050-77404072 TGGAGGTGGGGCCTGGAGGGAGG - Intergenic
1160343730 18:78112013-78112035 TGAAGGTGGGACTGGCAGGAAGG - Intergenic
1160696939 19:489397-489419 AGAGGGTCTGGCTGGGAGGGCGG - Intronic
1160800043 19:963525-963547 GGCAGGTAGGGCTGGAAGGGCGG + Intronic
1160829789 19:1098391-1098413 TGAAAAGAGGGGTGGGAGGGTGG + Intergenic
1160863740 19:1248510-1248532 TGGAGTTAGGGCGGGCAGGGGGG - Intergenic
1161127871 19:2570012-2570034 TGGAGGTGAGGCTGGGTGGGCGG + Intronic
1161722859 19:5913355-5913377 TGGAGGTGGGCCTGGGTGGGAGG + Intronic
1161756602 19:6138528-6138550 GGAAGGAAGGGGAGGGAGGGAGG + Intronic
1162076701 19:8192689-8192711 TCCGGGTAGGGGTGGGAGGGAGG - Intronic
1162080711 19:8216033-8216055 AGAAGGTAGGGAGGTGAGGGAGG - Intronic
1162085639 19:8247378-8247400 AGAAGGTGGGGCTGGGGGAGGGG - Intronic
1162135806 19:8554630-8554652 TGAGGCTGGGGCTGGGTGGGAGG - Intronic
1162260217 19:9527041-9527063 TGATGGAAGGTCTGAGAGGGAGG + Intergenic
1162451647 19:10758533-10758555 GGAAGGGAGGGAAGGGAGGGAGG - Intronic
1162785046 19:13029659-13029681 TGAAGGTAGGGAGGGAGGGGAGG - Intronic
1162823226 19:13235972-13235994 TGTGGGTGGGGCTGGCAGGGAGG - Intronic
1163054619 19:14708978-14709000 TGGAGGAAGGGCTTGGTGGGAGG + Intronic
1163248985 19:16114806-16114828 GGAATGAAGGGGTGGGAGGGAGG - Intronic
1163472844 19:17507296-17507318 TGAAGGAAAGGAAGGGAGGGAGG - Intergenic
1163601224 19:18250289-18250311 GTAAGGTAGGGCTGGGCTGGGGG - Intronic
1163754624 19:19099308-19099330 GGAAGGGAGGGCTGGGCTGGTGG + Intronic
1163756851 19:19111403-19111425 AGAAGGCAGGGCCGGCAGGGTGG - Exonic
1164489198 19:28691214-28691236 TGAGGGTAGGGTTTGGTGGGTGG + Intergenic
1164706065 19:30321130-30321152 AGAAGAGAGGGCTGGGAGGTCGG - Intronic
1164719583 19:30422797-30422819 TGAAGGGAGGGATGGGTGGGTGG - Intronic
1164719606 19:30422897-30422919 TGAAGGGAGGGATGGGTGGGTGG - Intronic
1164719633 19:30423013-30423035 TGAAGGGAGGGATGGGTGGGTGG - Intronic
1164719647 19:30423069-30423091 TGAAGGGAGGGATGGGTGGGTGG - Intronic
1164804713 19:31108028-31108050 TCAAGGTTGGGGTAGGAGGGGGG - Intergenic
1165178269 19:33946042-33946064 TGGAGGTGGGGCCTGGAGGGAGG + Intergenic
1165191357 19:34066438-34066460 TGGAGGTGGGGCTGGGTGGGAGG + Intergenic
1165247234 19:34504738-34504760 TCAGGGTGGGGCTGGGTGGGAGG - Exonic
1165777457 19:38413175-38413197 TGGAGGTAAGGAGGGGAGGGTGG - Exonic
1165886957 19:39085178-39085200 AGCAGGAAGGGCTGGGAGGATGG - Exonic
1166176802 19:41078966-41078988 TGGAGGTAGGGCCTAGAGGGAGG - Intergenic
1166210973 19:41306373-41306395 TGAGGGTGGGGCTGGTGGGGAGG + Intronic
1166329271 19:42069315-42069337 TGGTGGTGGGGCTGGGCGGGGGG + Intronic
1166351414 19:42200169-42200191 TGCAGAGAGGGCTGGGTGGGTGG - Intronic
1166404267 19:42508339-42508361 TCAAGGCAGTGCTGAGAGGGAGG - Exonic
1166581639 19:43905570-43905592 TGACGGTAGGGCCTGGTGGGAGG + Intergenic
1166714525 19:44958248-44958270 TGAAGGAAGGGCGAGGAGGCTGG + Intronic
1166934151 19:46320998-46321020 TGAAGGATAGACTGGGAGGGAGG - Intronic
1166986311 19:46661589-46661611 TGAAGGTTGGGCGGGGTGGAGGG - Intergenic
1167225606 19:48237412-48237434 TGGAGGTGGGGCCTGGAGGGAGG - Intronic
1167253845 19:48415613-48415635 TGGAGGCGGGGCTAGGAGGGTGG + Intronic
1167289037 19:48614658-48614680 TGAGGGTGGGGCGGGGAGGCTGG - Intronic
1167309484 19:48728862-48728884 TGAAGGTAGGGAAGGGAGGCTGG + Intronic
1167362951 19:49039944-49039966 TGCAGGTGGGGCGGGGTGGGGGG + Intergenic
1167504499 19:49863946-49863968 TCCAGGTATGGCTGGAAGGGAGG - Exonic
1167615320 19:50529940-50529962 TGAAGGGAGGGAGGGGAGGGTGG - Intronic
1167651134 19:50729655-50729677 GGAAGGGAGGGAGGGGAGGGAGG + Intergenic
1167679168 19:50909087-50909109 AGAGGGAAGGGCTGGGAGGCGGG - Intronic
1167757506 19:51421776-51421798 GGAAGGAAGGGCGGGGACGGTGG + Intergenic
1167830045 19:52012006-52012028 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1168330091 19:55563148-55563170 TGACTGAAGGGCTGGGAGCGGGG + Intergenic
924992416 2:323668-323690 TGAGGGAAAGGGTGGGAGGGGGG - Intergenic
925251962 2:2446349-2446371 GCCAGGTAGGGCTGGGAGGTTGG + Intergenic
925275723 2:2646921-2646943 AGGAAGGAGGGCTGGGAGGGAGG - Intergenic
925373209 2:3362327-3362349 TGGGTGTGGGGCTGGGAGGGAGG - Intronic
925587182 2:5475510-5475532 TTGAGGGAGCGCTGGGAGGGAGG + Intergenic
925756753 2:7140309-7140331 TGGAGGTAGGGCTTGGTGGGAGG + Intergenic
925907788 2:8549636-8549658 TGGAGGTGGGGCCTGGAGGGGGG + Intergenic
926220923 2:10934943-10934965 TGAGGGCAGGGCTGGCTGGGAGG + Intergenic
926224885 2:10960770-10960792 TGCAGGCAGGGCTGGGTGAGGGG + Intergenic
926248046 2:11135139-11135161 TGAAGGTAGGGCCTAGTGGGAGG - Intronic
926405791 2:12551477-12551499 TGAAGGAAGGGCTGGGGAGGTGG - Intergenic
926547740 2:14262858-14262880 TGGAGGTGGGGCTTGGCGGGAGG - Intergenic
926707278 2:15845728-15845750 TGAACATATAGCTGGGAGGGAGG + Intergenic
926837980 2:17045360-17045382 TGAAGGTGGGGCTTGGTGGGAGG - Intergenic
926842186 2:17093090-17093112 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
926920669 2:17936950-17936972 TGGAGGCAGGGCCTGGAGGGAGG + Intronic
927039078 2:19209980-19210002 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
927068667 2:19501575-19501597 TGAAGGTGGGGCTTGGTGGAAGG + Intergenic
927113290 2:19879283-19879305 TGAAGACAGGGTTGGGAGGTGGG - Intergenic
927192082 2:20523895-20523917 AGAAGTTAGGCCTGGAAGGGAGG - Intergenic
927216871 2:20672337-20672359 GGAAGGTGGGGCTGGGGGAGGGG + Exonic
927480805 2:23452417-23452439 TGGAGGTGGGGCTTGGTGGGAGG - Intronic
927564833 2:24103242-24103264 TGAAGGGAGGCTGGGGAGGGAGG + Intronic
927625125 2:24708176-24708198 AATAGGTAGGGCTGGGAGAGAGG - Intronic
927722697 2:25396554-25396576 TGAGGGAAAGGGTGGGAGGGGGG + Intronic
927877907 2:26670903-26670925 GGAAGGCAGGGGAGGGAGGGAGG + Intergenic
927952821 2:27184928-27184950 TGGGGGTGGGGTTGGGAGGGAGG - Intergenic
927970952 2:27306227-27306249 CGAAGGTGGAGCTGGCAGGGCGG + Exonic
928244152 2:29612710-29612732 TGAAGGGGGTGCTGGGAGTGGGG + Intronic
928615268 2:33031915-33031937 TGAGGGAAGGCCTGGGAGGCTGG + Intronic
928925921 2:36579420-36579442 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
929218998 2:39444043-39444065 CCAAGGTTTGGCTGGGAGGGTGG + Intergenic
929391637 2:41475188-41475210 AGAAGGAAAGGCTGGAAGGGGGG - Intergenic
929942237 2:46343127-46343149 TCACAGTAGTGCTGGGAGGGTGG - Intronic
930002476 2:46870514-46870536 GGAAGGTGGGGCTGGGAAGCAGG - Intergenic
930036835 2:47091139-47091161 AGAAGGAAGGGAAGGGAGGGAGG + Intronic
930154531 2:48092595-48092617 GGAAGGAAGGGCTGGGAAGACGG + Intergenic
930172258 2:48263904-48263926 GAATGGTAGGGTTGGGAGGGAGG + Intergenic
930224569 2:48779087-48779109 TGGAAGTGGGGGTGGGAGGGTGG - Intergenic
930489973 2:52057407-52057429 TGTAGGTGGGGCAGGGAGGGAGG + Intergenic
930622837 2:53662176-53662198 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
930626863 2:53708105-53708127 TGAAGGTGGGGCTTGGTGGGAGG + Intronic
931049504 2:58394786-58394808 TGGAGGTGGGGCCGGGTGGGAGG + Intergenic
931062509 2:58547082-58547104 TGAGAAGAGGGCTGGGAGGGAGG - Intergenic
931154235 2:59609011-59609033 TGGAGGAAGGGCTTGGTGGGAGG + Intergenic
931588630 2:63856456-63856478 TGAAGGGAGGGGCGGGGGGGTGG - Intronic
931654679 2:64500292-64500314 TGGAGGTAGGGCCTGCAGGGAGG - Intergenic
931790127 2:65657576-65657598 TGAAGGTGGGGAGAGGAGGGTGG - Intergenic
932320775 2:70820639-70820661 GGGAGGAAGAGCTGGGAGGGTGG - Intergenic
932370998 2:71187821-71187843 AGAAGGTAGGGCTGTGATGGTGG - Exonic
932595794 2:73092833-73092855 GGGAGGTGGGGCTGGAAGGGAGG - Intronic
932602186 2:73135344-73135366 GGAAGGGAGGGAAGGGAGGGAGG + Intronic
932605679 2:73163831-73163853 TGGAGGTGGGGGTGGGAGGTAGG + Intergenic
932713237 2:74083014-74083036 TGAAGGTATGGCTGGGGGCTAGG - Intronic
933498799 2:83086179-83086201 GGAAGGAAGGAATGGGAGGGGGG - Intergenic
933732309 2:85466441-85466463 TGGAGGTAGGGCCTGGAGGGAGG - Intergenic
933866519 2:86523170-86523192 GGAAGGAAGGTCTGGGAGGTTGG - Intronic
934051409 2:88214388-88214410 TGAAGGCAGGGGTAGGAGTGGGG + Intergenic
934236722 2:90238889-90238911 GGAAGGTAGGGAGGGTAGGGAGG + Intergenic
935146594 2:100399673-100399695 TAAAGGAAGAGCTGGGTGGGGGG - Intronic
935171164 2:100612464-100612486 TGAGGGCTGTGCTGGGAGGGAGG + Intergenic
935303906 2:101718558-101718580 GGAAGGTGGGGGTGGGGGGGTGG + Intronic
935330102 2:101970865-101970887 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
935333433 2:101994244-101994266 TGGAGGTCGGGGTGGGAGTGGGG - Intronic
935553594 2:104483384-104483406 GGAAGGTGGGGCTGGGTGGGAGG + Intergenic
936140114 2:109932154-109932176 TGAGGACAGGGCTGAGAGGGTGG + Intergenic
936176803 2:110230099-110230121 TGAGGACAGGGCTGAGAGGGTGG + Intergenic
936204582 2:110439332-110439354 TGAGGACAGGGCTGAGAGGGTGG - Intronic
936348651 2:111695533-111695555 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
936386047 2:112030273-112030295 TGAAGGTGGGGTCTGGAGGGAGG - Intergenic
936469869 2:112789558-112789580 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
936544717 2:113381099-113381121 TGGAGGTAGGGCCTGGGGGGAGG + Intergenic
936604239 2:113933221-113933243 TGAAGGTAGGCCTGGCACAGTGG + Intronic
936780891 2:116030781-116030803 GGGAGGTAGGGAGGGGAGGGAGG - Intergenic
937344458 2:121116067-121116089 TGAAAGTGGGGCTTGGTGGGAGG - Intergenic
937599412 2:123712107-123712129 TGAAGTTAGGCCTGGGCAGGTGG - Intergenic
937855124 2:126666689-126666711 TGTAGGGAGGGAGGGGAGGGGGG - Intronic
938297508 2:130187581-130187603 TGCAGGTTGGGGTGTGAGGGCGG - Intronic
938364478 2:130724003-130724025 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
938501135 2:131831777-131831799 GCAAGGCAGGGCTGGGAGGCAGG - Intergenic
938618830 2:133028753-133028775 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
938670630 2:133583195-133583217 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
938765906 2:134460323-134460345 TGAGGACAGGGCTGGGAGGGAGG - Intronic
938797509 2:134730754-134730776 TGGAGGTAGGGCCTGGAGGGAGG + Intergenic
939111774 2:138017225-138017247 TTAAGGTGGGGCTTGGATGGTGG - Intergenic
940233385 2:151483100-151483122 TGAATTTGGGGGTGGGAGGGTGG + Intronic
940259051 2:151761526-151761548 TGGAGGTAGAGCTTGGAGTGAGG + Intergenic
940438056 2:153678526-153678548 TGAAGGTGGGGCATGGAAGGAGG + Intergenic
940694526 2:156961731-156961753 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
940708912 2:157138476-157138498 TGAAGGGAAGGGTGGGAGGTGGG - Intergenic
940787162 2:157993967-157993989 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
941122494 2:161546879-161546901 TGAAGGTGGGGCCTGGTGGGAGG - Intronic
941740237 2:169028235-169028257 TGAGGGTAGGGCTGGCTGGAGGG - Intronic
941867616 2:170351050-170351072 GGAAGGGAAGGCAGGGAGGGAGG + Intronic
941891813 2:170590436-170590458 TTAATGTAGGGGTGTGAGGGTGG - Intronic
941919990 2:170840647-170840669 GGGAGGTAGGGAAGGGAGGGAGG + Intronic
942313258 2:174675841-174675863 TGAGGGGAGGAGTGGGAGGGTGG + Intronic
942342310 2:174961188-174961210 GGAAGGGAGGGAAGGGAGGGAGG + Intronic
942358373 2:175144682-175144704 TGAGGGTTGGGCTGGGAAAGGGG + Intronic
942505197 2:176634539-176634561 TAAAGGGAGGGCTGGGGGTGGGG + Intergenic
942536892 2:176974676-176974698 AGAGGGTAGGGGAGGGAGGGAGG - Intergenic
942980155 2:182071022-182071044 TGGAGGTGGGGCTTGGTGGGAGG - Intronic
943430594 2:187796261-187796283 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
943580296 2:189675772-189675794 TGGAGGTAGGGCTTGGTGCGAGG + Intronic
943675908 2:190716331-190716353 TGAAGGTAGGACAGGGAGAAGGG + Intergenic
943853603 2:192760336-192760358 TGAAGATAGGTCTTGAAGGGTGG - Intergenic
944097820 2:195989652-195989674 TGCAGGTAGGGCCTGGTGGGAGG + Intronic
944479907 2:200145779-200145801 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
944822435 2:203444054-203444076 AGAAGGAAGGGGAGGGAGGGAGG + Exonic
944927426 2:204479489-204479511 TGAAGGTGAGGATGGGGGGGTGG - Intergenic
945109812 2:206351548-206351570 AGAAGGAAGGGATGGGAGAGAGG - Intergenic
945218724 2:207463136-207463158 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
945328908 2:208516341-208516363 TGAAGGTAGGGCCTGGTGGGAGG - Intronic
945410409 2:209499904-209499926 TGGAGGTGGGGCCTGGAGGGAGG - Intronic
945533918 2:210988583-210988605 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
945829190 2:214762885-214762907 TGACAGTAGTGGTGGGAGGGGGG - Intronic
946182937 2:217959868-217959890 TGCGGCTGGGGCTGGGAGGGTGG + Intronic
946248467 2:218399982-218400004 GGAGGGGAGGGGTGGGAGGGAGG - Exonic
946333208 2:219021984-219022006 TGAAAATGGGGCTGGGAGAGTGG - Intronic
946374554 2:219300166-219300188 TGGAGGTAGGGCTGGCAGTGGGG + Exonic
946613204 2:221481332-221481354 TGACGTGGGGGCTGGGAGGGTGG - Intronic
946616625 2:221517156-221517178 TGAGGATGGGGCTGGGAAGGTGG + Intronic
946810108 2:223514645-223514667 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
946973613 2:225123125-225123147 GGAAGGAAGGGGAGGGAGGGAGG - Intergenic
947106263 2:226670893-226670915 AGAAGGTAGGGATGAGATGGAGG - Intergenic
947159064 2:227193792-227193814 GGAAGGAAGGGGAGGGAGGGAGG + Intronic
947183537 2:227433749-227433771 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
947224444 2:227826429-227826451 TTATGGTAGGGCAGGGAGGAGGG - Intergenic
947512186 2:230766508-230766530 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
947565351 2:231189872-231189894 GGAAGGGAGGCCTGGGATGGAGG + Intergenic
947796389 2:232896571-232896593 TGAAGGTAGGGGTGAGGGTGAGG + Intronic
947796461 2:232896741-232896763 TGAAGGTAGGGGTGAGGGTGAGG + Intronic
947806121 2:232969436-232969458 GGAAGGAAGGGGAGGGAGGGAGG - Intronic
947817128 2:233045127-233045149 TGAGGGAAGGGCAGGGAAGGCGG - Intergenic
948003568 2:234589247-234589269 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
948081306 2:235207428-235207450 TGAAGGCAGGGCTGGGTGTGAGG - Intergenic
948098375 2:235354533-235354555 TGAAGCCAGGGGTGGGAGGCAGG - Intergenic
948283769 2:236768804-236768826 AGAAGGAAGGGCTGGGATGGTGG - Intergenic
948478185 2:238234627-238234649 CGTAGGGAGGGCTGGAAGGGAGG + Intergenic
948588300 2:239034926-239034948 GGAAGGTAGGGCAGGGAGGTTGG - Intergenic
948729124 2:239952285-239952307 TGAAGGCAGAGTGGGGAGGGGGG + Intronic
948838948 2:240640102-240640124 GGAAGGTAGGTCAGGGAAGGAGG - Intergenic
948838965 2:240640156-240640178 GGAAGGTAGGTCAGGGAAGGAGG - Intergenic
948838992 2:240640248-240640270 GGAAGGTAGGTCAGGGAAGGAGG - Intergenic
948839153 2:240640786-240640808 GGAAGGTAGGTCAGGGAAGGAGG - Intergenic
948894744 2:240922825-240922847 AGAAGGCACGGCTGGGAAGGGGG + Intronic
948918347 2:241049805-241049827 TGATGGCAGGGCTGGGGGCGGGG - Exonic
1168844844 20:937085-937107 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1168904445 20:1392389-1392411 TGAAGGGAGGGATGGAAGTGGGG + Intronic
1169017681 20:2305055-2305077 TCATGGAAGTGCTGGGAGGGGGG - Intronic
1169074097 20:2750953-2750975 TGAAGGTAGGGCTCTGAGACTGG + Intronic
1169211277 20:3767531-3767553 TGATGGCAGGGCTGGGGTGGGGG - Intronic
1169291953 20:4360416-4360438 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1169394602 20:5218551-5218573 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1169460464 20:5790125-5790147 TGAATGTAGGCAGGGGAGGGAGG - Intronic
1170020672 20:11833881-11833903 GGAAGGGAGGGAGGGGAGGGAGG + Intergenic
1170126091 20:12965699-12965721 TGAAGTGAGGGGAGGGAGGGTGG + Intergenic
1170196246 20:13692529-13692551 TCAAGGTGGGGCTTGGTGGGAGG + Intergenic
1170368019 20:15618523-15618545 TGGGGGCAGGGTTGGGAGGGTGG - Intronic
1170388018 20:15841652-15841674 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
1170405629 20:16032777-16032799 GGAAGGAAGGGCAGGAAGGGAGG + Intronic
1170638304 20:18128888-18128910 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1170783481 20:19447935-19447957 TGAATGTAGGGTTGGAAGGCAGG + Intronic
1170798101 20:19567504-19567526 TGAGGGTAGGGGTGGGAGGAAGG + Intronic
1171239277 20:23551857-23551879 TGGGGGTAGGGGTGGAAGGGTGG + Intergenic
1172123939 20:32614137-32614159 TGAATGGATGGATGGGAGGGTGG + Intergenic
1172124005 20:32614349-32614371 TGAATGGATGGATGGGAGGGTGG + Intergenic
1172187486 20:33040155-33040177 TGGTGGTAGTGCTGGGAGGGTGG + Intronic
1172200885 20:33125284-33125306 TTCAGGTGGGGCGGGGAGGGAGG - Intergenic
1172389657 20:34558489-34558511 TCAAGGTAAGGCCCGGAGGGCGG - Intronic
1172781010 20:37437126-37437148 TAGAGGTAGGGCAGGGAGAGGGG - Intergenic
1172783926 20:37453570-37453592 TGAAGGCAGGGGTGGGAGAAGGG - Intergenic
1172834494 20:37864193-37864215 TGAAGGAAGGGTGGGGTGGGGGG - Intronic
1172838978 20:37890704-37890726 TGGAGGGAGGGCAGGGCGGGTGG + Intergenic
1172878217 20:38179341-38179363 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1172899118 20:38321074-38321096 TGAATGAATGGATGGGAGGGTGG + Intronic
1173102572 20:40100547-40100569 TGAATGTTTGGCTGGAAGGGTGG - Intergenic
1173366511 20:42390677-42390699 TGAAGGTTGGACTGGGACTGGGG - Intronic
1173438863 20:43057351-43057373 GGAAGGAAGGGCAGGGAGGTAGG + Intronic
1173616987 20:44409768-44409790 TGCAGGTAGGTCAGGGAGTGAGG - Intronic
1173619965 20:44429417-44429439 TCAAGGTGGGGCAGGGTGGGAGG + Intronic
1174172622 20:48626965-48626987 TGAAGAGAGGGCAGGGTGGGAGG + Intronic
1174304862 20:49607984-49608006 TGAATGTATGGGTGGGTGGGTGG - Intergenic
1174444113 20:50579029-50579051 TGGAGGTGGGGCTGGGTGGGAGG - Intronic
1174571661 20:51506494-51506516 GGGAGGTGGGGCTGGGTGGGTGG - Intronic
1174843557 20:53921750-53921772 AGAAGCTTGGGCTGGGAGAGCGG + Intergenic
1175046978 20:56116217-56116239 TGAAGGGAGGCAGGGGAGGGAGG + Intergenic
1175096959 20:56548818-56548840 TGGAGGTAGGGCATGGTGGGAGG + Intergenic
1175249458 20:57600363-57600385 AGAAGGGAGGGGTGGGTGGGCGG + Intergenic
1175260348 20:57670188-57670210 TGGAGGTAGGGGTGGGGTGGGGG + Intronic
1175301460 20:57946143-57946165 TGAGGGTTGGGCGGGGAGGCTGG + Intergenic
1175336249 20:58198230-58198252 TGCAGGATGGGCGGGGAGGGGGG + Intergenic
1175392858 20:58637975-58637997 TGAAGTTAGAGCAGGGAGGCTGG - Intergenic
1175522816 20:59613063-59613085 TGGAGGTGGGGCTGGGTGGGAGG - Intronic
1175971921 20:62690813-62690835 TGACGGCAGGCCCGGGAGGGCGG - Intergenic
1176049512 20:63110350-63110372 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1176170574 20:63694661-63694683 TGGAGGAAGGGCGGGCAGGGCGG + Intronic
1176414637 21:6467624-6467646 TGGAGGAGGGGCTGGGCGGGCGG - Intergenic
1177010201 21:15722721-15722743 TGAAGGTAGGGCCTGGCGGGAGG - Intergenic
1177141213 21:17360171-17360193 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1177470288 21:21552539-21552561 TGGAGGAAGGGCTGGGTAGGAGG + Intergenic
1177497174 21:21903901-21903923 GGAAGGGAGGGGAGGGAGGGAGG + Intergenic
1177565654 21:22818106-22818128 TGGAGGTGGGGCTAGGTGGGAGG - Intergenic
1177658876 21:24056549-24056571 TGGAGGTGGGGCCTGGAGGGAGG + Intergenic
1177774410 21:25551888-25551910 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1178029097 21:28504665-28504687 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1178155939 21:29854340-29854362 TGGAGGTGGGGCTTGGTGGGGGG - Intronic
1178286109 21:31326764-31326786 GGAAGGTAGGGAAGGGATGGAGG - Intronic
1178392235 21:32208271-32208293 TGAAGGTAGGGCCTGGTGGGAGG + Intergenic
1178474625 21:32926683-32926705 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1178495972 21:33086492-33086514 GGAAGGAAGGGCTGGGTGAGGGG + Intergenic
1178589830 21:33900150-33900172 TGAGGGTGGGGTTGAGAGGGCGG + Intronic
1178957101 21:37032452-37032474 GGAAGGGAGGTCAGGGAGGGGGG - Intergenic
1178961763 21:37072735-37072757 GGAGGATAGGGCAGGGAGGGGGG + Exonic
1179187430 21:39095778-39095800 TGAAGGAAGGCCTGGGAGCCAGG + Intergenic
1179236116 21:39547927-39547949 TGGAGGTGGGGCCTGGAGGGAGG - Intergenic
1179487013 21:41716940-41716962 TGTAGGTGGGGGCGGGAGGGAGG - Intergenic
1179508253 21:41855983-41856005 GGAAGGGAGGGGAGGGAGGGAGG - Intronic
1179508255 21:41855987-41856009 GGAAGGAAGGGAGGGGAGGGAGG - Intronic
1179508267 21:41856018-41856040 GGAAGGGAGGGGAGGGAGGGAGG - Intronic
1179508269 21:41856022-41856044 GGAAGGAAGGGAGGGGAGGGAGG - Intronic
1179508282 21:41856057-41856079 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1179508294 21:41856083-41856105 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1179508308 21:41856118-41856140 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1179508322 21:41856153-41856175 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1179508334 21:41856179-41856201 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1179508348 21:41856214-41856236 GGAAGGAAGGGAGGGGAGGGAGG - Intronic
1179508362 21:41856249-41856271 GGAAGGAAGGGAGGGGAGGGAGG - Intronic
1179690135 21:43075946-43075968 TGGAGGAGGGGCTGGGGGGGCGG - Intronic
1179874869 21:44262425-44262447 TGGAGGTAGGGCAGGGCGGGGGG + Intergenic
1179952945 21:44721695-44721717 CTAAGGTAGGGCGGGGAGAGTGG + Intergenic
1179987024 21:44927717-44927739 TGCAGGCAGGGCTGGCAGAGGGG + Intronic
1180630311 22:17224905-17224927 TGTGGGAAGGGCAGGGAGGGAGG - Intergenic
1180869236 22:19137157-19137179 TGAAGGCAGGTGTGGGTGGGTGG - Intronic
1180920859 22:19520911-19520933 TGGAGGGATGGCTGAGAGGGTGG - Intergenic
1181173645 22:21023857-21023879 TGGAGGAAGGGCTGGCAGTGAGG - Intronic
1181583192 22:23839035-23839057 CGAAGGCGGGGCTGGGAGGCGGG - Intronic
1181602648 22:23961371-23961393 TGAACGCACAGCTGGGAGGGTGG + Intergenic
1181605866 22:23979936-23979958 TGAACGCACAGCTGGGAGGGTGG - Intronic
1181774173 22:25147782-25147804 AGAAGGGAGGGCTGGCAGGTGGG + Intronic
1182007671 22:26974841-26974863 TGGAGGGAGGGGTGGGAAGGTGG + Intergenic
1182090894 22:27594133-27594155 TGAAGGGAGGGACTGGAGGGAGG + Intergenic
1182125022 22:27810033-27810055 TGATGGTGGGGGTGGGAGGTGGG - Intergenic
1182320854 22:29478012-29478034 TGCAGGTGGTGCTGGGAGGATGG - Intergenic
1182443124 22:30375659-30375681 TCAAGGTGGGCCTGAGAGGGCGG + Exonic
1182739971 22:32560614-32560636 TGGAGGGAGGGCTGAGAGGTGGG + Intronic
1182891698 22:33824490-33824512 TGGAGGAGGGGCTTGGAGGGAGG - Intronic
1182904367 22:33922259-33922281 TCGAGGTCGGGCTGGGGGGGTGG + Intronic
1182917431 22:34048011-34048033 TGGTGGTAGGGATGGGAGGTAGG - Intergenic
1183089141 22:35509542-35509564 CGGAGGTGGGGCTGGGAGGGCGG + Intergenic
1183267723 22:36839600-36839622 AGGAGGAAGGGCTGGGTGGGAGG - Intergenic
1183452726 22:37905810-37905832 TCAAGCTAGGGGTGGAAGGGGGG + Intronic
1183598497 22:38826478-38826500 GGTAGGCAGGGCTGGCAGGGAGG - Exonic
1183625269 22:38997815-38997837 TGAAGGGAGGGAAGGAAGGGAGG - Intergenic
1183742366 22:39675871-39675893 GGAAGATCAGGCTGGGAGGGGGG + Intronic
1183965113 22:41436847-41436869 TGAAGGTAGGGCTGGGTGACTGG + Exonic
1184096794 22:42320479-42320501 TGGAGGAAGGGCTGGCAGTGGGG - Intronic
1184200674 22:42967132-42967154 GGAAGGTGGGGCTGGGACAGGGG + Intronic
1184343000 22:43896312-43896334 TGAGGGCAGGTCTGGGAAGGTGG + Intergenic
1184594673 22:45506594-45506616 TGTGGGTAGGGCTGGGAGGATGG + Intronic
1184642440 22:45879606-45879628 GGAAGGGAGGGAAGGGAGGGAGG - Intergenic
1184710545 22:46247024-46247046 GGTAGGGAGGGCTGGGAGAGAGG - Intronic
1184855121 22:47142475-47142497 TGAAGGGATGGGTGGGTGGGCGG - Intronic
1184865195 22:47198264-47198286 GGAGGCCAGGGCTGGGAGGGCGG + Intergenic
1184902893 22:47458508-47458530 TGCAGATGGGGCTGGGAGGAGGG - Intergenic
1184935643 22:47718456-47718478 TGAAGGATGGGCTGGAAGGAGGG - Intergenic
1185056460 22:48581262-48581284 TGCAGGGAGGCCTGGGAGGCTGG - Intronic
1185299586 22:50072459-50072481 TGAAGAGAGGGTTGGGAGTGTGG + Intronic
949434157 3:4009888-4009910 TTGAGATAGGGCTTGGAGGGTGG + Intronic
949850667 3:8417164-8417186 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
949850842 3:8418784-8418806 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
949889393 3:8722271-8722293 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
949892677 3:8745049-8745071 TGGAGGTGGGGCCGGGTGGGAGG + Intronic
950169527 3:10828520-10828542 GGAAGATAGGCCTGGGAGAGAGG - Intronic
950452398 3:13072710-13072732 TGAATGTGGATCTGGGAGGGGGG + Intronic
950456031 3:13093308-13093330 AGCAGGCAGGGCTGGGATGGAGG - Intergenic
950658488 3:14452121-14452143 GGGAGGAAGGGCTGGCAGGGAGG - Intronic
950717791 3:14862060-14862082 TGAAGGTAAGCCTGGGAGGAAGG + Intronic
950750904 3:15127198-15127220 TGAAGGGATGGCTGAGTGGGTGG - Intergenic
951461093 3:22952743-22952765 TGGAGGTAGGGCTTAGTGGGAGG - Intergenic
951494562 3:23311947-23311969 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
951528810 3:23679796-23679818 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
951577854 3:24131904-24131926 TGAAGCTGGGGCTAAGAGGGAGG + Intronic
951934177 3:28003216-28003238 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
952044762 3:29305132-29305154 TTAAGATTGGGCTGGGAGAGGGG - Intronic
952074321 3:29677188-29677210 TGGAGGTGGGGCTTGGTGGGAGG - Intronic
952221592 3:31328861-31328883 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
952512427 3:34070785-34070807 TGAAGGTGGGGGTGTGAAGGAGG - Intergenic
952972980 3:38666470-38666492 TGAAGGTGGGGCTTGGTGGGAGG + Intergenic
953196033 3:40734262-40734284 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
953312172 3:41890804-41890826 GGAAGGAAGGGATGGGAGGGGGG + Intronic
954107376 3:48416518-48416540 TGACAGTAGGGCAGGGAGAGGGG - Intronic
954299424 3:49691505-49691527 AGCAGGTATGGCTGGGTGGGTGG + Exonic
954419513 3:50411227-50411249 TGGTGTGAGGGCTGGGAGGGAGG - Intronic
954445285 3:50543007-50543029 AGAAGGTGGAGCTGGGAGGTGGG + Intergenic
954623068 3:52006646-52006668 TGAAGATGGGGATGGCAGGGGGG - Intergenic
954660490 3:52224404-52224426 TGCAGGTAGGGCTTGGAGAGAGG - Intronic
955102663 3:55867091-55867113 GGAAGGAAGGGAAGGGAGGGAGG - Intronic
955167387 3:56527736-56527758 TGAAAGTAGGGCCTGGTGGGAGG + Intergenic
955208886 3:56922477-56922499 TGAATATGGGGGTGGGAGGGAGG + Intronic
955415842 3:58690104-58690126 TGAGGGTGGAGGTGGGAGGGAGG + Intergenic
955997019 3:64688028-64688050 TGAATGGGGGGCTGGGGGGGCGG + Intergenic
956321950 3:68007605-68007627 GGAAGGGAGGGGAGGGAGGGAGG - Intronic
956351113 3:68337407-68337429 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
956565001 3:70626298-70626320 AGAAGGTAGAGTTGGAAGGGAGG - Intergenic
956647557 3:71471696-71471718 TGAAGGTATGGCTTTCAGGGTGG - Intronic
956893944 3:73640711-73640733 TGAGGGTGGGGCTGGGAAGACGG + Intergenic
957070538 3:75564595-75564617 TGAAGGGATGGCTGAGTGGGTGG + Intergenic
958736524 3:98015841-98015863 TGGAGGTGGGGCTTGAAGGGAGG + Intronic
959027292 3:101254788-101254810 TGAAGGTGGGGCCTGGTGGGAGG + Intronic
959416240 3:106078994-106079016 GGAAGGAAGGGGAGGGAGGGAGG - Intergenic
959510874 3:107210261-107210283 TCAATGTAGAGCTGGGGGGGGGG + Intergenic
960134141 3:114088859-114088881 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
960324300 3:116276519-116276541 TGCAGGGAAGGGTGGGAGGGAGG + Intronic
960442150 3:117702056-117702078 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
960520075 3:118644482-118644504 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
961009188 3:123424625-123424647 TGGAGGAAGGGCTGTAAGGGTGG - Intronic
961051181 3:123748316-123748338 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
961066882 3:123883787-123883809 GGAAGGTAGGGCGGGGAAGGCGG - Intronic
961283546 3:125781941-125781963 TGAAGGGATGGCTGAGTGGGTGG - Intergenic
961441048 3:126953407-126953429 CCAACGTAGGGCTTGGAGGGTGG - Intronic
961505782 3:127369852-127369874 TGAGGGTGGGGCTGGGTGGTGGG - Intergenic
961556788 3:127701567-127701589 TTAAGGGAGGGCAGGGATGGAGG - Intronic
961575242 3:127830620-127830642 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
961869500 3:129977331-129977353 TGAATATGGGGCTGGGAGGGAGG - Exonic
962177044 3:133166190-133166212 GGAGGGTAGGGTTGGGAGGAGGG + Intronic
962894142 3:139698753-139698775 TGAAGGTAGGGCCTGGTAGGGGG + Intergenic
963130708 3:141855372-141855394 TGAAGATGGGGTTGGGAGGGTGG - Intergenic
963179213 3:142336443-142336465 GGAAGGAAGGGAAGGGAGGGAGG + Intronic
963392299 3:144680872-144680894 TGAATGGTGGGGTGGGAGGGTGG + Intergenic
963490104 3:145989001-145989023 TGAAGGTAGGGCCTAGTGGGAGG + Intergenic
963500434 3:146119065-146119087 TGGAGGTGGGGTTGGGTGGGAGG + Intronic
964436701 3:156660541-156660563 AAAAGTTAGGGGTGGGAGGGTGG - Intergenic
964920303 3:161887904-161887926 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
965001938 3:162965535-162965557 TGAAGGTAGGGCCTGGTGAGAGG - Intergenic
965125299 3:164619883-164619905 TGGAGGTAGGTCTTGGTGGGAGG - Intergenic
965294228 3:166923448-166923470 TAAAGGTGGGGTTGGGTGGGAGG - Intergenic
965360755 3:167735327-167735349 TGAAGGGAGGGCTTGGTGTGGGG + Intronic
965751515 3:171979435-171979457 TGGAGGTCGGGCAGGGAGAGGGG - Intergenic
965807145 3:172553322-172553344 TGGAGGTGGGGCCTGGAGGGAGG - Intergenic
965833421 3:172824509-172824531 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
965870247 3:173255856-173255878 TGAAGGTAGGGCCTGGTGGGAGG - Intergenic
965979540 3:174670852-174670874 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
966204751 3:177394797-177394819 TGAGGGGAGGGGAGGGAGGGAGG - Intergenic
966259048 3:177953337-177953359 TGAGGGTGGGTCTGGGTGGGAGG + Intergenic
966477430 3:180366575-180366597 TGAAGGAGGGGCTGCGTGGGAGG - Intergenic
966939232 3:184734999-184735021 TTCAGGTGGGGCTGGGAGGCTGG - Intergenic
967200233 3:187066430-187066452 TGGAAATAGGGCTGTGAGGGAGG - Intronic
967548975 3:190767131-190767153 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
967593107 3:191300676-191300698 TGAAGGTGGGGCCTGGTGGGAGG + Intronic
967777992 3:193404495-193404517 TGCAGGAAGGGCTGGATGGGAGG + Intronic
967809915 3:193749437-193749459 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
968029895 3:195474798-195474820 AGAAGGTGGGGGAGGGAGGGAGG + Intergenic
968206908 3:196811243-196811265 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
968458459 4:711148-711170 TGGAGCTAGGGCCGGGAAGGGGG + Intronic
968488109 4:874324-874346 GGAAGGAAGGGCAGGGAGGCTGG - Intronic
968511371 4:997332-997354 TGAGGGTGGGGGTGGGAGTGCGG - Intronic
968614690 4:1572109-1572131 TGGTGGTGGGGCTGGGATGGGGG - Intergenic
968614896 4:1573343-1573365 TGAAGGAAGAGTTGGGATGGGGG - Intergenic
968736495 4:2299635-2299657 GGAAGGGAGGGGAGGGAGGGAGG + Intronic
968762992 4:2451912-2451934 TGAAGGGAGGGGTGGGTGGATGG + Intronic
968829586 4:2926078-2926100 TGATGGGAGTGCTGGGAGGCGGG - Exonic
968937132 4:3617325-3617347 GGAAGAGAGGGATGGGAGGGAGG - Intergenic
968937235 4:3617602-3617624 AGAAGGGAGGGATGGGAGGTGGG - Intergenic
968950283 4:3687894-3687916 TGGAGGTGGGGCTGGGTGGGTGG + Intergenic
968963208 4:3756177-3756199 TCACAGGAGGGCTGGGAGGGTGG - Intergenic
969036354 4:4256959-4256981 TGCAGGTGGGGGTGGGTGGGTGG - Intergenic
969207669 4:5659487-5659509 TGAATGTTGGGACGGGAGGGAGG + Intronic
969364681 4:6687325-6687347 TGCAGGGAAGGCTGGGAGAGGGG - Intergenic
969739827 4:9016157-9016179 TGAAGGGATGGCTGGGTGGGTGG - Intergenic
969741513 4:9031348-9031370 TGAAGGCTGAGATGGGAGGGTGG + Intergenic
969798982 4:9547677-9547699 TGAAGGGATGGCTGAGTGGGTGG - Intergenic
970444547 4:16112762-16112784 AGAAGGGAGGGGAGGGAGGGAGG + Intergenic
971265695 4:25094445-25094467 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
971345737 4:25810269-25810291 TGAAGGCAGAGAGGGGAGGGGGG - Intronic
971506367 4:27370292-27370314 AGAAGGTTGGGGAGGGAGGGAGG - Intergenic
971729981 4:30365649-30365671 TGAAGTTTGGGCAGGGATGGTGG + Intergenic
971741482 4:30526800-30526822 TGAAGGTGGGGCTTGGTGGGAGG - Intergenic
972041918 4:34613025-34613047 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
972336797 4:38114136-38114158 GGAAGATAAAGCTGGGAGGGTGG + Intronic
972367562 4:38390670-38390692 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
972384795 4:38554491-38554513 TGAAGGGAGGAGTGGGAGAGGGG - Intergenic
972415793 4:38839122-38839144 GGAAGGGAGGGAAGGGAGGGAGG + Intronic
972829770 4:42801956-42801978 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
972905071 4:43735938-43735960 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
972957837 4:44414763-44414785 TGAAGGTAGGGCTTAGTGGGAGG + Intronic
973367442 4:49219118-49219140 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
974705664 4:65512417-65512439 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
974920689 4:68235483-68235505 TGAAGATAGTGGTGGTAGGGAGG - Intronic
974942130 4:68482270-68482292 TGAAGGTAGGACCTGGTGGGAGG - Intronic
975563077 4:75725130-75725152 TGAAGCTCGGGCTAGGAGAGTGG + Intronic
975800385 4:78055396-78055418 TAAAGGTCGGGCGGGGCGGGGGG - Intergenic
976011741 4:80497042-80497064 TGAAGGTGGGGCCTGGTGGGAGG - Intronic
976015398 4:80546578-80546600 TGAAGGTAGGACCTGGTGGGAGG + Intronic
976030319 4:80744401-80744423 AAAAGGTGGGGGTGGGAGGGAGG + Intronic
976133579 4:81910978-81911000 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
976389433 4:84493672-84493694 AAAAGGGAGGGCTGCGAGGGAGG - Intronic
976601997 4:86946454-86946476 TGCAGGTGGGGGTGGGTGGGGGG - Intronic
976717180 4:88135509-88135531 TGTGTGTAGGGATGGGAGGGTGG - Intronic
976751682 4:88456387-88456409 TGGGGGTAGGGGTGGGGGGGAGG + Intergenic
976775262 4:88699293-88699315 AGAGGGTGGGGCTGGGTGGGTGG - Intronic
976804881 4:89035627-89035649 TAGAGGAAGGGCTGGGTGGGAGG + Intronic
976822122 4:89218275-89218297 TGGAGGTGGGGCCGGGTGGGAGG + Intergenic
976946878 4:90781151-90781173 TGGAGGTGGGGCTTGGTGGGAGG - Intronic
976987799 4:91324953-91324975 TGAAGGTGGGGCCTGGTGGGAGG + Intronic
976987929 4:91326476-91326498 TGAAGGTAGGGCCTGGTGGGAGG - Intronic
977521424 4:98089198-98089220 AGAGGGTAAGGTTGGGAGGGGGG - Intronic
978100768 4:104838811-104838833 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
978615643 4:110592609-110592631 TGAAGGAAGGGCCGGGTGGGAGG + Intergenic
978667323 4:111199902-111199924 TGGAGGTGGGGCTGGGTGGGAGG + Intergenic
978983539 4:114981892-114981914 TGAAGGTGGGGCTTGGTGGGAGG + Intronic
979046313 4:115870148-115870170 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
979682482 4:123477104-123477126 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
979718148 4:123866512-123866534 TGAAAGTGGGGCCGGGTGGGAGG + Intergenic
979795366 4:124839666-124839688 GGAAGGGAGGGATGGGAAGGGGG - Intergenic
979799778 4:124894385-124894407 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
979858834 4:125668005-125668027 TGGAGGTAGGGCTTGGTGGAAGG + Intergenic
980731150 4:136825423-136825445 TGGAGGGAGGGATGGGTGGGTGG + Intergenic
981016817 4:139982386-139982408 TGATTGTAGGGCTGGGTGGGGGG - Intronic
981046154 4:140267204-140267226 TAAAGGTAGCACTGGGTGGGAGG + Intronic
981052478 4:140323114-140323136 TGAAGGTGGGGCTTGGTGGGAGG + Intronic
981335826 4:143567982-143568004 TGAAGGCAGGGCTTGGCTGGAGG + Intergenic
981704097 4:147640998-147641020 TAAAGGTAGGGCTGGTGTGGTGG - Intronic
982229376 4:153194586-153194608 TGCAGGAAGGACTGGAAGGGAGG + Intronic
982686091 4:158490607-158490629 TGAAGGTTGGGCTAGGAGCTGGG + Intronic
983075312 4:163318292-163318314 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
983454514 4:167945867-167945889 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
983466604 4:168101047-168101069 TGAAGGTGGGGCCTGGTGGGAGG + Intronic
983546526 4:168970632-168970654 TGCAGGGAAGGGTGGGAGGGGGG - Intronic
983682693 4:170371871-170371893 TGAAGCTAAGGCTGGCAGGGTGG - Intergenic
983830670 4:172322752-172322774 TGAAGGTGGGGCCTGGTGGGAGG - Intronic
984035950 4:174667942-174667964 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
984090901 4:175374331-175374353 GGAAAGGAGGGCTGCGAGGGGGG + Intergenic
984116161 4:175683565-175683587 TGAAGGTAGGGCCTGATGGGAGG + Intronic
984157584 4:176210508-176210530 GGAAGGTTTGGCTGGGAGGAGGG + Intergenic
984262484 4:177458706-177458728 TGAAGGTAGGCCGGGCACGGTGG + Intergenic
984355754 4:178655089-178655111 TGGAGGCAGGGCTTGGTGGGAGG + Intergenic
984424175 4:179562683-179562705 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
984653339 4:182291872-182291894 TGTGTGTAGGGCTGGGAGGGAGG + Intronic
984831953 4:183984045-183984067 TGGAGGTGTGGATGGGAGGGAGG - Intronic
984870178 4:184318371-184318393 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
985085452 4:186308329-186308351 TGAGGGTAGGGAAGAGAGGGAGG + Intergenic
985173548 4:187176990-187177012 TGCAGGTAGGGCATAGAGGGTGG - Intergenic
985190516 4:187367444-187367466 TGAAGGTGGGGCTGGGGTGAGGG - Intergenic
985702495 5:1382135-1382157 AGAAGGGAGGCCTCGGAGGGAGG + Intergenic
985702517 5:1382209-1382231 AGCAGGGAGGCCTGGGAGGGTGG + Intergenic
985702528 5:1382246-1382268 AGCAGGGAGGCCTGGGAGGGTGG + Intergenic
985702539 5:1382283-1382305 AGCAGGGAGGCCTGGGAGGGTGG + Intergenic
985746563 5:1651768-1651790 GGAAGGTGGGGCTGGGGAGGGGG + Intergenic
985981440 5:3469640-3469662 TGAGTGTAGGGCTGGCAGGGTGG - Intergenic
986214132 5:5702298-5702320 TGGAGGTGGGACTGGGCGGGAGG - Intergenic
986233231 5:5885671-5885693 TGAGGGTAAGGGTGGAAGGGGGG + Intergenic
986360672 5:6975261-6975283 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
986510706 5:8503659-8503681 TGAAGGTAGGGCCCGATGGGAGG - Intergenic
986926937 5:12766258-12766280 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
986959122 5:13191905-13191927 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
987040181 5:14055055-14055077 AGAAGGTTGGGGTGGGAGGTGGG + Intergenic
987459481 5:18190944-18190966 TGGAGATGGGGCTGGGTGGGAGG - Intergenic
987796328 5:22631943-22631965 TGCAGGTAGGGCCTGGTGGGAGG - Intronic
987971767 5:24955510-24955532 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
987979544 5:25064079-25064101 TGCATGTAGGGCTGGGTGTGTGG + Intergenic
988079090 5:26393079-26393101 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
988671482 5:33386349-33386371 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
989116704 5:37961629-37961651 GGCAGGGAGGGGTGGGAGGGAGG + Intergenic
989229231 5:39067395-39067417 TGGAGGTGGGGCTTGGTGGGAGG - Intronic
989397372 5:40972167-40972189 TGAGGGGAGGGGTGGGAGAGGGG + Intronic
989678523 5:44002453-44002475 TGATGGTGTGGCTGGGAGGTGGG - Intergenic
990287212 5:54311661-54311683 TGAGGGTGGGGATGGGGGGGGGG - Intergenic
990531041 5:56673914-56673936 TGGAAGTAGGGCTGGGTGTGAGG + Intergenic
990995731 5:61730511-61730533 TGGAGGTGGGGCTTGGTGGGAGG - Intronic
991045733 5:62220781-62220803 TGAAGGTGGGGCCTGGCGGGAGG + Intergenic
991059620 5:62359810-62359832 TGTGGGTAGGGTTGGGAGGTAGG + Intronic
991491963 5:67192702-67192724 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
991961716 5:72051321-72051343 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
992171031 5:74102269-74102291 TGAAGGAAGGGGAGGGGGGGAGG - Intergenic
992485572 5:77191196-77191218 TGAAGATAGGGCCTTGAGGGAGG - Intergenic
992573960 5:78091829-78091851 TGAAGGCAGGGTTGGGAGTAGGG + Intronic
992801842 5:80301559-80301581 GGGAGGTGGGGCCGGGAGGGAGG + Intergenic
993487734 5:88507090-88507112 TTATGGTAGGGCTGGTAGGAGGG - Intergenic
993691960 5:91012866-91012888 TGAAGGTGGAGGTGGGAGGAGGG - Intronic
993720783 5:91319847-91319869 TGAGGGGAAGGGTGGGAGGGAGG - Intergenic
994038360 5:95228655-95228677 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
994100123 5:95882661-95882683 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
994358796 5:98826526-98826548 TCTAGGCAGGGCTGGGAGAGGGG + Intergenic
994925755 5:106115128-106115150 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
995075412 5:107977858-107977880 TAAAGGAGGGGCTGGGAGGATGG + Intronic
995117576 5:108499354-108499376 TGAAGATGGGGCTCGGTGGGAGG + Intergenic
995175099 5:109167020-109167042 TGAAGGTAATGCTGAGAGGTAGG - Intronic
995254229 5:110028240-110028262 TGAGGGGAAGGCTGGGAGGATGG - Intergenic
995283718 5:110363263-110363285 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
995634348 5:114168927-114168949 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
996238905 5:121170626-121170648 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
996251376 5:121337604-121337626 TAAAGATAGGGGTGGGATGGTGG + Intergenic
996308342 5:122076848-122076870 TGAAGGTAGACCGGGGAGCGGGG + Intronic
996360348 5:122638494-122638516 TGAGGTGAGGGCTGGGAGTGAGG - Intergenic
996647289 5:125831498-125831520 TGAAGGTAGGGCATGGTGGGAGG + Intergenic
996798279 5:127374885-127374907 TGAAGTTTGGGCTGAGAGTGGGG - Intronic
996892072 5:128433047-128433069 TGAAGGAAGGACTTGGTGGGAGG - Intronic
996951592 5:129133207-129133229 TGAAAGTAGGGGTGGTGGGGAGG + Intergenic
997030126 5:130117902-130117924 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
997174752 5:131763638-131763660 TGGAGGTAGGGCTTGGTGGGAGG - Intronic
997241432 5:132311183-132311205 TGGAGCTAGGGCTGGGTGGGAGG + Intronic
997471031 5:134116930-134116952 TGCAGGTGGGGCTGGCAGGCTGG + Intronic
997521145 5:134525411-134525433 TGGTGGTGGGGCTGCGAGGGAGG + Intronic
997679911 5:135742972-135742994 GGAAGGGAGGGGGGGGAGGGAGG - Intergenic
997768612 5:136530723-136530745 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
997823163 5:137084121-137084143 TGGAGGTGGGGCTGGCAGAGGGG - Intronic
997893489 5:137695505-137695527 TGAAGGGAAGGCTTGGAGGCTGG + Intronic
998235343 5:140393750-140393772 GGAAGGTTGAGGTGGGAGGGTGG + Intergenic
998497797 5:142605768-142605790 TGCAAGTAGGGCTGGCAGGAAGG + Intronic
998513885 5:142735859-142735881 TGAGGGCAGGATTGGGAGGGGGG - Intergenic
998546250 5:143030329-143030351 TGAAGCTGGGGCTGAGAGGAGGG - Intronic
998758447 5:145406122-145406144 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
999134025 5:149305791-149305813 AGAAGGCAGAGCAGGGAGGGAGG + Intronic
999700949 5:154227904-154227926 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
999726810 5:154445185-154445207 TGAAGTGAAGGCTGGGAGTGGGG - Intergenic
1000101069 5:158016999-158017021 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1000106720 5:158066884-158066906 TGGAGGTGGGGCCTGGAGGGAGG - Intergenic
1000130213 5:158289955-158289977 TGCAGGTAGTGGTGGGTGGGTGG + Intergenic
1000146422 5:158457524-158457546 TGCAGGGTGGGGTGGGAGGGAGG + Intergenic
1000269607 5:159671482-159671504 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1000270370 5:159678327-159678349 TGGAGGTAGGGCATGGTGGGAGG - Intergenic
1000608007 5:163344782-163344804 TGGAGGTAGGGCGGGATGGGAGG - Intergenic
1001471517 5:172016722-172016744 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1001542803 5:172551163-172551185 GGAAGGAAGGGCTGGGAGTGGGG - Intergenic
1001542825 5:172551225-172551247 GGAAGGAAGGGCTGGGAGTCGGG - Intergenic
1001654766 5:173340889-173340911 TGTGGGTAGGGTGGGGAGGGCGG + Intergenic
1001720218 5:173851027-173851049 TGAAAGGAGGGCAGGAAGGGAGG + Intergenic
1001891290 5:175341304-175341326 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1001979729 5:176030631-176030653 TGAGGGTGGGGGTGTGAGGGTGG + Intronic
1002237688 5:177813132-177813154 TGAGGGTGGGGGTGTGAGGGTGG - Intergenic
1002289823 5:178192652-178192674 GGAAGGAAGGGAAGGGAGGGAGG + Intergenic
1002310776 5:178312569-178312591 TGCCGGGAGGGCTGGGCGGGGGG - Intronic
1002317690 5:178354473-178354495 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
1002368813 5:178733509-178733531 TGGAGGAAGGGCTGAGGGGGAGG + Intergenic
1002402957 5:179002356-179002378 TGGAGGTGGGGCCGGGTGGGAGG - Intergenic
1002477608 5:179477190-179477212 AGAAAGTTGGGCTGGGAGGATGG - Intergenic
1002642036 5:180635063-180635085 TGGAAGTATGGGTGGGAGGGTGG + Intronic
1002659017 5:180777710-180777732 TGAATGGATGGCTGGGTGGGAGG - Intergenic
1003040763 6:2685437-2685459 TCAAGATGGGGCGGGGAGGGAGG + Intronic
1003119217 6:3306268-3306290 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
1003143106 6:3487966-3487988 TGAGGGCAAGGCTGGGAGTGTGG + Intergenic
1003318953 6:5035646-5035668 GGAAGGGAGGGGAGGGAGGGAGG - Intergenic
1003333395 6:5148135-5148157 AAAAGGGCGGGCTGGGAGGGTGG - Intronic
1003403183 6:5807590-5807612 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1003923478 6:10855617-10855639 TGAGGGTAGGGCTGGGGGGAGGG - Intronic
1004031125 6:11870571-11870593 TGAAGGCAGGGTGGGGACGGGGG - Intergenic
1004131168 6:12921511-12921533 GGAAGGAAGGGGAGGGAGGGAGG + Intronic
1004307634 6:14515494-14515516 TGAGGGCAGGGTGGGGAGGGTGG - Intergenic
1004326949 6:14683784-14683806 AGAAGGTTGGGCTGTGAGCGGGG - Intergenic
1004755647 6:18607861-18607883 TGGAGGTAGGGCCAGGTGGGAGG - Intergenic
1004756846 6:18619508-18619530 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1005365336 6:25070462-25070484 GGAAGGAAGGGAAGGGAGGGAGG + Intergenic
1005402653 6:25450767-25450789 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1005682174 6:28218180-28218202 TGAAGGTGGGGCTGGGTGATGGG + Intergenic
1005939081 6:30547334-30547356 TGCAGGTATGACGGGGAGGGTGG - Exonic
1005988942 6:30891503-30891525 TGGAGTTTGGGGTGGGAGGGAGG + Intronic
1006220400 6:32484602-32484624 TGCGGGGAGGGCCGGGAGGGTGG - Intergenic
1006320343 6:33316097-33316119 TGATGGTGGGGATGGGAGGGGGG - Exonic
1006404091 6:33834084-33834106 TGAGTGCAGGGCTGGGAGTGAGG - Intergenic
1006411879 6:33878526-33878548 TGAAGCCAGGCCTGGGAAGGAGG + Intergenic
1006455481 6:34129550-34129572 TGAAGGAAGGGGTGGGAGCAGGG + Intronic
1006672840 6:35740355-35740377 TTAAGGAAGGGGTGGGAGGCAGG - Intronic
1006724810 6:36190315-36190337 TGAAGTTAGGGGAGGGAGTGGGG + Intergenic
1006811519 6:36823309-36823331 TGATGATAGGGGTGGGAGGTAGG - Intronic
1007323121 6:41041329-41041351 GGAGGGTGGGGCTGGGAGGAGGG - Intronic
1007323129 6:41041346-41041368 GGAGGGTGGGGCTGGGAGGAGGG - Intronic
1007353969 6:41296935-41296957 TGGTGGTAGGGCCTGGAGGGAGG + Intergenic
1007392536 6:41558350-41558372 TGAACCAAGGGCTGGGAGAGGGG + Intronic
1007637391 6:43307681-43307703 TGCAGCCAGGGCTGGGAGTGGGG + Exonic
1007682698 6:43645368-43645390 TGGAGGCAGGGCGGGGTGGGCGG + Intronic
1007810705 6:44483511-44483533 TCACGGTTGGGCGGGGAGGGCGG - Intergenic
1008098586 6:47366886-47366908 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1008104825 6:47430058-47430080 TGGAGGTAGGGCTTGGTGGGAGG - Intergenic
1008449666 6:51635852-51635874 TGAAGGTGGGGGGGGGCGGGGGG + Intronic
1008471230 6:51887480-51887502 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
1008532850 6:52480627-52480649 TGAAGGTAGGTCAGGGTAGGTGG + Intronic
1008567568 6:52784282-52784304 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1008871634 6:56279038-56279060 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
1009680252 6:66882317-66882339 TGGAGGTGGGGCTGGGTGGGAGG - Intergenic
1010570593 6:77469211-77469233 TGAAGGTAGGGATTGGAGGTTGG + Intergenic
1010763543 6:79751813-79751835 TGAGGGACAGGCTGGGAGGGAGG + Intergenic
1011643220 6:89433698-89433720 TGAAGGAAGGGCGGTGGGGGCGG + Intronic
1011645658 6:89455539-89455561 TGGAGGTGGGGCTGGGTGGGAGG + Intronic
1011930876 6:92710962-92710984 TGAAGGGAAGGCTAGCAGGGTGG - Intergenic
1011950896 6:92962410-92962432 TGAGGGTAGAGCAGGGAGGAGGG + Intergenic
1011981714 6:93386866-93386888 AGATGGAAGGGCTGGGATGGAGG + Intronic
1012418032 6:99031220-99031242 ATAAGGTAGGCCTGGGAGGGTGG - Intergenic
1012660778 6:101887853-101887875 TGAAGGTCGGGCTTGGCGGGAGG - Intronic
1012809497 6:103939390-103939412 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1013239404 6:108229430-108229452 GGAAGGAAGGGGAGGGAGGGAGG - Intronic
1013304674 6:108837449-108837471 TTAAGGAAGGGCAGGGAGAGGGG + Intergenic
1013599950 6:111694281-111694303 TGAAGGAAGGGAAGGGAAGGAGG + Intronic
1013634450 6:112016008-112016030 TGTAGGAAGGGCTGGAAGGCTGG + Intergenic
1014551878 6:122798472-122798494 TAAAAGCAGGGCTGGGAGGGAGG - Intronic
1014774675 6:125494750-125494772 TGAAGGGAGGAATGGGAGGGAGG - Intergenic
1015093319 6:129385124-129385146 GGAAGGAAGGGAGGGGAGGGAGG + Intronic
1015252402 6:131141180-131141202 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
1015252700 6:131143282-131143304 TGGAGATAGGGCTTGGTGGGAGG + Intronic
1015263477 6:131264993-131265015 TGAAGGTGGGGCCTGGTGGGAGG - Intronic
1015546099 6:134362821-134362843 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1016180354 6:141139065-141139087 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1016504630 6:144765037-144765059 TGAGGGTAGGGTTGGGTGGGAGG + Intronic
1016564405 6:145437097-145437119 TGAAGGTAGGGCCTGGTGGGAGG + Intergenic
1016789813 6:148056239-148056261 TGAAGGATGGGCAGGGTGGGAGG + Intergenic
1017318593 6:153062090-153062112 TGAAGGGTGGGGTGGGCGGGAGG - Intronic
1018027133 6:159815397-159815419 TGAAGGGAGGGCCAAGAGGGTGG - Intronic
1018066379 6:160127496-160127518 TAAAGGTAGGGACGGGATGGAGG - Intronic
1018515377 6:164573875-164573897 TACAGTTAGGGCAGGGAGGGAGG + Intergenic
1018564259 6:165135297-165135319 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1018652778 6:166005764-166005786 AGGAGGTAGGGCTGGGAGCCTGG - Intergenic
1018866049 6:167747774-167747796 AGAAGGAAGGGGAGGGAGGGAGG + Intergenic
1018962257 6:168457343-168457365 TGAAGGTGGGGTTGGATGGGTGG - Intronic
1019274127 7:166991-167013 TGCTGGTAGGGCTGGGAACGAGG - Intergenic
1019374476 7:682029-682051 TGAAGTAAGGGGAGGGAGGGAGG + Intronic
1019521922 7:1464758-1464780 TGAAGGTGGGGGGGGGGGGGAGG - Intergenic
1019543275 7:1560880-1560902 GGCAGGTAGGGCTGGCTGGGTGG - Intergenic
1019701279 7:2476045-2476067 TGGGGGTGGGGGTGGGAGGGAGG - Intronic
1019875682 7:3808517-3808539 TGCAGGTCGGGCTGGGATTGAGG - Intronic
1019928655 7:4209269-4209291 TGGAGGGAGGGCAGAGAGGGAGG + Intronic
1020202745 7:6093152-6093174 GGAAGGAAGGGAAGGGAGGGAGG - Intergenic
1020254991 7:6497968-6497990 TGAAGCCAGGGCTGGGAAAGGGG - Intronic
1020646579 7:10821497-10821519 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1021112440 7:16710617-16710639 GGAAGGAAGGGGAGGGAGGGAGG + Intergenic
1021117386 7:16759500-16759522 TGGAGGTGGGGCCTGGAGGGAGG - Intronic
1021293053 7:18869275-18869297 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
1021472745 7:21024346-21024368 TGAAGTCAGGGCTGGGCAGGAGG - Intergenic
1021770706 7:23997982-23998004 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1021863186 7:24927931-24927953 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
1021937643 7:25646865-25646887 GGAAGTTAGGGGTGGGATGGCGG + Intergenic
1021974862 7:26002022-26002044 GGAAGATAAGGCAGGGAGGGTGG - Intergenic
1022047504 7:26633874-26633896 TGGAGGAAAGGCTGGGAAGGGGG + Intergenic
1022601726 7:31767310-31767332 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
1022712709 7:32866623-32866645 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1022910280 7:34894357-34894379 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1023214613 7:37848568-37848590 GGAACGTAGGGATGGGAGGATGG + Intronic
1023781832 7:43663019-43663041 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
1023872256 7:44269502-44269524 AGGAGGAGGGGCTGGGAGGGTGG - Intronic
1023882441 7:44328006-44328028 TGAAGGCAGGGGTGGGAAGAGGG - Intronic
1024157638 7:46640792-46640814 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1024303999 7:47911088-47911110 TGGAGGTAGAGCTTGGCGGGAGG + Intronic
1024527014 7:50357463-50357485 TGGAGGGAGGGGTGGCAGGGGGG - Intronic
1024926482 7:54620409-54620431 TGGAGGTAGGGCATGGTGGGAGG - Intergenic
1025799829 7:64775324-64775346 TGGAGGTGGGGCCTGGAGGGAGG + Intergenic
1026050548 7:66942871-66942893 TGGAGGTGGGGGTGGGAGTGGGG + Intronic
1026058526 7:67006113-67006135 TGGAGGTGGGGCTTGGCGGGAGG + Intronic
1026117583 7:67509037-67509059 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1026277410 7:68892171-68892193 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1026300180 7:69090843-69090865 GGAAGGTAGCGGAGGGAGGGAGG + Intergenic
1026304612 7:69129775-69129797 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1026446234 7:70487232-70487254 TGGAGGGTTGGCTGGGAGGGGGG - Intronic
1026586352 7:71659172-71659194 AGAAAGTAGGGCTGGAAGAGAGG - Intronic
1026670570 7:72387231-72387253 GGAAGGGAGGGGAGGGAGGGAGG + Intronic
1026719563 7:72818910-72818932 TGGAGGTGGGGCTTGGCGGGAGG - Intronic
1026817184 7:73522039-73522061 GGAAGGGAGGGGTGAGAGGGCGG + Exonic
1027513134 7:79108765-79108787 TGGAGGTGGGGCTTGGTGGGAGG + Intronic
1027617012 7:80435950-80435972 TGGAGATAGGGCTGGGTGGGAGG + Intronic
1028498917 7:91496369-91496391 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1028870640 7:95768012-95768034 TGGAGGTAGGGCCGGGTGGGAGG + Intergenic
1029072817 7:97913897-97913919 TGAAGGGATGGCTGAGTGGGTGG + Intergenic
1029126953 7:98301119-98301141 TGAGGGTATGGCTGTGGGGGAGG - Intronic
1029198820 7:98825313-98825335 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1029371550 7:100154075-100154097 TCCAGGTAGGGGTGGGAGGTGGG - Exonic
1029379662 7:100204828-100204850 TGGAGGGAGGTCTCGGAGGGAGG + Intronic
1029536529 7:101160726-101160748 TGGAGGTAGGGGGTGGAGGGAGG - Exonic
1029638762 7:101804786-101804808 GGCAGCTATGGCTGGGAGGGTGG - Intergenic
1029641964 7:101826662-101826684 TGCAGGAAGGGCTTGGAAGGCGG + Intronic
1029917761 7:104230038-104230060 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1029920738 7:104260221-104260243 GGGAGGTTGGGCTGGGTGGGGGG - Intergenic
1030930775 7:115521339-115521361 TGAAGGTGGGGCCTAGAGGGAGG - Intergenic
1031008064 7:116497103-116497125 TGGAGGTGGGGCTTGGTGGGAGG - Intronic
1031028736 7:116712122-116712144 TTAAGGCAGGGTTGTGAGGGAGG - Intronic
1031591291 7:123595263-123595285 GGATGGTAGGGATGGGAGGTGGG - Intronic
1031749918 7:125558485-125558507 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1031988629 7:128180758-128180780 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1032577476 7:133070884-133070906 TGAAGGCAGGGCTGGAACAGAGG + Intronic
1032578459 7:133081336-133081358 AGACTGTGGGGCTGGGAGGGAGG + Intronic
1032704538 7:134410627-134410649 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1032810261 7:135406973-135406995 TGAAGGTGGGGCCTGGTGGGAGG + Intronic
1032943801 7:136826864-136826886 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1033354888 7:140591826-140591848 AGAAGGAAGGGGAGGGAGGGAGG - Intronic
1033478271 7:141712019-141712041 TGGAGGTAGGGCCTGGTGGGTGG - Intronic
1033931348 7:146526597-146526619 TGGAGGTGGGGCCTGGAGGGAGG - Intronic
1034065890 7:148136112-148136134 GGAAGGGAGGGAAGGGAGGGAGG + Intronic
1034168273 7:149042628-149042650 GGAAGGAAGGGGGGGGAGGGGGG + Intergenic
1034216092 7:149406859-149406881 AGCAGGGAGGGCTGGCAGGGAGG - Intergenic
1034275359 7:149821551-149821573 TGAGTGCAGGGCAGGGAGGGGGG + Intergenic
1034313604 7:150110812-150110834 TGAGGGCAAGGCTGGCAGGGGGG + Intergenic
1034496423 7:151425868-151425890 TGAAGGCAGGCAAGGGAGGGAGG + Intergenic
1034528780 7:151682816-151682838 TGAGGGTGGGGGTGGGACGGTGG + Intronic
1034605889 7:152314571-152314593 GGAAGGCAGGGGAGGGAGGGAGG + Intronic
1034643825 7:152626386-152626408 TGGAGGTGGGGATTGGAGGGAGG - Intergenic
1034711633 7:153197274-153197296 TGAGGGTAGGGCAGGAAGGCAGG + Intergenic
1034793292 7:153989984-153990006 TGAGGGCAAGGCTGGCAGGGGGG - Intronic
1034937029 7:155206873-155206895 TGGAGGTGGGGATTGGAGGGAGG - Intergenic
1035559259 8:592995-593017 TGAGGGGAGCGCTGTGAGGGGGG + Intergenic
1035559285 8:593101-593123 TGAGGGGAGGGATGTGAGGGGGG + Intergenic
1035559324 8:593254-593276 TGAGGGGAGGGATGTGAGGGGGG + Intergenic
1035650679 8:1261548-1261570 CGAGGGTGGGGGTGGGAGGGGGG + Intergenic
1035717366 8:1764163-1764185 GGAAGGCAGGGCTGGGACCGCGG - Intronic
1035720022 8:1784795-1784817 TAAGGGCAGGGCTGGGAGGCTGG + Exonic
1035820560 8:2587346-2587368 GGAAGGGAGGGAGGGGAGGGAGG - Intergenic
1035865199 8:3074927-3074949 TGGAGGTGGGGCCTGGAGGGAGG + Intronic
1036192226 8:6680729-6680751 GGAAGGGAGGGACGGGAGGGAGG - Intergenic
1036244855 8:7107400-7107422 TGAAGGGATGGCTGAGTGGGTGG - Intergenic
1036255880 8:7206366-7206388 TGAAGGGATGGCTGAGTGGGTGG + Intergenic
1036456448 8:8913111-8913133 TCAAGGTGGGGCTTGGTGGGAGG + Intergenic
1036521277 8:9493927-9493949 TGGAGGTGAAGCTGGGAGGGTGG - Intergenic
1036607713 8:10322368-10322390 TGGAAGTATGGGTGGGAGGGAGG + Intronic
1036662670 8:10717987-10718009 TGGATGTGGGGGTGGGAGGGAGG - Intergenic
1036731058 8:11265173-11265195 TGGAGGTGGGGCTGGGTGGGAGG + Intergenic
1036889367 8:12585893-12585915 TGAAGGGATGGCTGAGTGGGTGG + Intergenic
1036896968 8:12644056-12644078 TGAAGGGATGGCTGAGTGGGTGG + Intergenic
1037245003 8:16823306-16823328 TGGAGGTGGGGCTTGGCGGGAGG - Intergenic
1037339754 8:17831885-17831907 AAAGGGTAGGGCTGGGAGGAGGG - Intergenic
1037570504 8:20153924-20153946 TAAAGGTGGGGCTGAGTGGGAGG + Intronic
1037611582 8:20480642-20480664 TGAAAGTATGGCTTGGAGGCTGG + Intergenic
1037731988 8:21533857-21533879 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1037764299 8:21762474-21762496 TCATGGTAGGGCTGGGAATGAGG - Intronic
1037837744 8:22224164-22224186 AGCAGGAAGGGCTGGGAGGGAGG + Intronic
1037879187 8:22564922-22564944 TGAAGCCAGGCCTTGGAGGGCGG + Intronic
1037959159 8:23083720-23083742 TGAAGGCAGGGAGGGGAGGAAGG - Intergenic
1038084594 8:24180526-24180548 AGAAGGTGGGGGTGGGGGGGTGG + Intergenic
1038406979 8:27329441-27329463 TGAGGCTAGGGAGGGGAGGGAGG + Intronic
1038474847 8:27858277-27858299 TGATGGTAGGGATGGGTGGAGGG + Intergenic
1038642279 8:29338110-29338132 TGGATGTTGGGTTGGGAGGGAGG - Intronic
1038677840 8:29639641-29639663 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1038693799 8:29787001-29787023 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1038704502 8:29880953-29880975 TGGTGGTAGGGGTGGGAGTGGGG + Intergenic
1038857263 8:31347576-31347598 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1039089440 8:33812719-33812741 TGAAGATGGGGGTGAGAGGGAGG + Intergenic
1039143106 8:34415694-34415716 TGAATAGAGGGCTGGGAGTGGGG + Intergenic
1039262525 8:35787471-35787493 TGAAGGAACAGCTGGGAGAGAGG - Intronic
1039506961 8:38059181-38059203 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
1039567728 8:38563555-38563577 TGAAGGTGGGGATGGGACAGAGG - Intergenic
1039977152 8:42376917-42376939 GGAAGGTAAGGCTGCTAGGGAGG - Exonic
1040013532 8:42681988-42682010 TGAAGGTGGGGCTTGGTGGGAGG - Intergenic
1040293749 8:46138660-46138682 TGCAGGTTGGCGTGGGAGGGTGG - Intergenic
1040318093 8:46275579-46275601 GGCAGGTAGGCCTGTGAGGGTGG - Intergenic
1040319707 8:46286417-46286439 TGCAGGTGGGTCTGTGAGGGCGG - Intergenic
1040545787 8:48396984-48397006 TGAAGGCAGGGCGGGGGCGGGGG - Intergenic
1040672064 8:49703951-49703973 GGGAGGTAGGGGAGGGAGGGAGG - Intergenic
1040984757 8:53281319-53281341 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1041657271 8:60366245-60366267 TGGGGGTAGGTGTGGGAGGGAGG - Intergenic
1041875206 8:62679801-62679823 TGGAGGTAGGGCCTGGTGGGAGG - Intronic
1042002523 8:64141666-64141688 TGAAGGTGGGGCGTGGTGGGAGG + Intergenic
1042376228 8:68055970-68055992 GGAAGGTAGGGTTGGGAGTTTGG + Exonic
1042387659 8:68196611-68196633 TGAAGGTGGGGCCTGGTGGGAGG + Intronic
1042733793 8:71965268-71965290 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
1042764254 8:72302971-72302993 TGGAGGAAGGGCTTGGAGGGAGG + Intergenic
1042847157 8:73179935-73179957 TGAGGGGAAGGTTGGGAGGGGGG - Intergenic
1043423714 8:80126880-80126902 TGGAGGTTGAGGTGGGAGGGTGG + Intronic
1043492226 8:80761008-80761030 TGAAGGTGGGGCCTGGTGGGAGG - Intronic
1044140433 8:88644669-88644691 TGGAGGTGGGGCTTGGTGGGAGG - Intergenic
1044673813 8:94709999-94710021 TGGAGGTAGGGCCTGGTGGGGGG - Intergenic
1044761361 8:95521003-95521025 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1044946140 8:97391821-97391843 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1045419022 8:101995678-101995700 TGAAGGTGGGGCCTGGTGGGAGG - Intronic
1045554038 8:103197866-103197888 TGGAGGTGGGGCTGGGTGGGAGG - Intronic
1045788333 8:105952333-105952355 GGTAGGTGGGGCTGGGAGGGTGG - Intergenic
1045791189 8:105986842-105986864 TGAAGGTGGGGCCTGGTGGGAGG + Intergenic
1046126051 8:109910161-109910183 AGAAGGGAGGGGAGGGAGGGGGG - Intergenic
1046446645 8:114329582-114329604 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1046582799 8:116113687-116113709 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1046782332 8:118229129-118229151 TGAAGGGAAGAGTGGGAGGGGGG + Intronic
1047005947 8:120620877-120620899 TGGAGGTAAGGGAGGGAGGGAGG - Intronic
1047099681 8:121663178-121663200 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1047622125 8:126618628-126618650 TTAAAGTAGGGCTGTCAGGGAGG - Intergenic
1047936035 8:129779450-129779472 GGAAGGTAGAGCATGGAGGGTGG + Intronic
1048031659 8:130638978-130639000 TCAAGGTAGGCCTGGCATGGTGG + Intergenic
1048038052 8:130696246-130696268 TGGAGGTAGGGCTTGGTGGGCGG + Intergenic
1048110249 8:131460401-131460423 TGAAAGTGGGACTGGGAAGGAGG + Intergenic
1048273859 8:133050973-133050995 TAAAGGTAGGCTTGGGAGGGAGG + Intronic
1048408818 8:134150678-134150700 GGAAGGTAGGGTGGGGAGGTGGG - Intergenic
1048443760 8:134478391-134478413 TGCGGGTAGGGCAGGAAGGGTGG + Exonic
1048677241 8:136797133-136797155 TGAGGGCAGGGCTTGGTGGGAGG + Intergenic
1048733419 8:137470319-137470341 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1049085075 8:140472173-140472195 TGAAATTAGGCCTGGCAGGGTGG + Intergenic
1049096230 8:140549859-140549881 TGAAGCTGGGGCGGGGTGGGAGG + Intronic
1049416160 8:142496305-142496327 TGGAGGTATGGATGGGTGGGTGG + Intronic
1049514343 8:143045542-143045564 TGCAGGGAAGGATGGGAGGGAGG - Intronic
1049571534 8:143372292-143372314 GAAAGGTAGGGATGGGAGGCGGG + Intronic
1049574706 8:143384757-143384779 TCAAGGCAGGGCTGGGCAGGAGG + Intergenic
1049598631 8:143496928-143496950 TGCAGGAAGGGCTGGGAGTCTGG - Intronic
1049646176 8:143736791-143736813 TGAAGGCGGGGCTGGGGTGGGGG - Intergenic
1049686603 8:143941661-143941683 GGCAGGCTGGGCTGGGAGGGAGG - Intronic
1049794205 8:144489184-144489206 TTAGGGTTGGACTGGGAGGGGGG + Intronic
1050264589 9:3876681-3876703 GGAAGGGAGGGAGGGGAGGGAGG + Intronic
1050906738 9:11014727-11014749 AGAAGGTAGGCCAGGCAGGGTGG - Intergenic
1051042262 9:12825918-12825940 GGAAGGTAGGGATGGGAGGAAGG - Intergenic
1051380187 9:16449830-16449852 TAAAGGTGGGGCGGGGGGGGAGG + Intronic
1051468088 9:17403708-17403730 TGGAGGTAGGACTGGGAGGTAGG + Intronic
1051517283 9:17944053-17944075 TGGAGGTGGGGCTCGGTGGGAGG - Intergenic
1051938296 9:22471570-22471592 TGAAAGTAGGGCTTGGTAGGGGG + Intergenic
1052344546 9:27396049-27396071 TTAAGGTAGGGGTGTGGGGGAGG + Intronic
1052346367 9:27413733-27413755 TGAAAGTAGGGGTGGGACAGAGG + Intronic
1052512890 9:29444423-29444445 TGAAGGTAGGACCTGGTGGGTGG + Intergenic
1052526137 9:29622067-29622089 GGGAGGAAGGGCAGGGAGGGAGG + Intergenic
1052571310 9:30227724-30227746 TGAAGGTTGGGCCTGGTGGGAGG + Intergenic
1052622121 9:30925944-30925966 TGGAGGTAGGGCATGGTGGGAGG - Intergenic
1052830386 9:33210679-33210701 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1052861638 9:33441446-33441468 TGTGGGTAGGGCTGGGAGGAGGG - Exonic
1053157545 9:35791524-35791546 GGAGGGTGGGGCCGGGAGGGAGG + Intergenic
1053231807 9:36416492-36416514 AGAAGTTAGGGCAGGCAGGGAGG - Intronic
1053290989 9:36879555-36879577 TGTGGGGAGTGCTGGGAGGGAGG + Intronic
1053456724 9:38238724-38238746 TGGAGGAAGGGCCGGGTGGGAGG - Intergenic
1053472236 9:38355130-38355152 AGAAGGAAGGGGAGGGAGGGAGG + Intergenic
1053792050 9:41693607-41693629 TGAAGGTAGGAATGGGAGTCAGG + Intergenic
1054153106 9:61621158-61621180 TGAAGGTAGGAATGGGAGTCAGG - Intergenic
1054180455 9:61905627-61905649 TGAAGGTAGGAATGGGAGTCAGG + Intergenic
1054453910 9:65420070-65420092 AGAAGGGAGGGATGGGAGGTGGG + Intergenic
1054454012 9:65420347-65420369 GGAAGAGAGGGATGGGAGGGAGG + Intergenic
1054472900 9:65552362-65552384 TGAAGGTAGGAATGGGAGTCAGG - Intergenic
1054657136 9:67675515-67675537 TGAAGGTAGGAATGGGAGTCAGG - Intergenic
1054797573 9:69316915-69316937 TTAAGGTAGGGGTGGGGGCGGGG - Intergenic
1054857225 9:69914196-69914218 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1054942003 9:70753710-70753732 TGAATGAAGTGGTGGGAGGGGGG + Intronic
1055095291 9:72407051-72407073 AGAAGGTAGGGATGGGAGAGGGG + Intergenic
1055874168 9:80922819-80922841 TGAAGGAAGGGCCTGGTGGGAGG - Intergenic
1055977510 9:81969319-81969341 TGATGGTAGGGTAGGGAGTGAGG - Intergenic
1056397906 9:86198157-86198179 TGGAGGTGAGGCTTGGAGGGAGG + Intergenic
1056661951 9:88550233-88550255 TGGAGGTGGGGCTTGGTGGGTGG - Intronic
1057325584 9:94060818-94060840 TGAAGGTGGGGCTTGGTGGGAGG - Intronic
1057367941 9:94441510-94441532 TGAAGGTGGGGCCTGGTGGGAGG - Intronic
1057392050 9:94648298-94648320 TGAGGGCAGAGATGGGAGGGAGG - Intergenic
1057436335 9:95044376-95044398 TGCAGGTGGGGGTGGGAGTGAGG + Intronic
1057548287 9:96034172-96034194 TCAGGGTAGGGATAGGAGGGGGG + Intergenic
1057803076 9:98201714-98201736 GGAAGGCTGGGCAGGGAGGGAGG - Intronic
1057851999 9:98573031-98573053 TGACTGTAGGGCAGGGAGGGCGG - Intronic
1059355507 9:113696424-113696446 TGGAGGAGGGGCTGGGTGGGAGG + Intergenic
1059527661 9:115007240-115007262 TGAGGGTAAGACAGGGAGGGAGG + Intergenic
1059852933 9:118364068-118364090 TGAAGTTGGGGTTGGGGGGGGGG - Intergenic
1059853055 9:118364765-118364787 TGAAGGGAAGGCTGGAAAGGTGG + Intergenic
1060007871 9:120016404-120016426 TGAGGGAGGGGCTGGGTGGGAGG - Intergenic
1060219251 9:121755649-121755671 TGGAGCTTGGGGTGGGAGGGTGG + Intronic
1060278809 9:122202143-122202165 AGAGGGTGGGGCAGGGAGGGAGG - Intergenic
1060725627 9:126003815-126003837 TGAAGGTAAGACTTGAAGGGTGG + Intergenic
1060849054 9:126860261-126860283 GGAAGGGAGGGCTGGGCTGGGGG + Intergenic
1060906848 9:127314531-127314553 TGAAGGAGGGGGAGGGAGGGAGG - Intronic
1061046167 9:128166276-128166298 TGGGTGTTGGGCTGGGAGGGTGG + Exonic
1061065887 9:128277067-128277089 TAAAGGCAGGGCTGGGTGAGGGG - Intronic
1061339204 9:129965759-129965781 TGAAGGAAGGGAGGGAAGGGAGG + Intronic
1061385247 9:130285722-130285744 TGCAGTGAGGGCTGGGAGAGGGG + Intronic
1061449004 9:130658828-130658850 TGGAGGAAGGGCTGGGTGTGGGG + Intergenic
1061551729 9:131338789-131338811 TGCAGAGAGGCCTGGGAGGGAGG + Intergenic
1061617967 9:131792632-131792654 GGAAGGTGGGGCTGGGTTGGAGG - Intergenic
1061648996 9:132030980-132031002 AGAAGGGAAGGTTGGGAGGGTGG + Intronic
1061663031 9:132143123-132143145 TGAAGACAGAGCTGGGAGGCTGG - Intergenic
1061985076 9:134125905-134125927 GGAAGGAAAGGCTGGGAAGGAGG + Intergenic
1062010836 9:134265820-134265842 TGAAGGTAGGGAGGGAAGGAGGG - Intergenic
1062021355 9:134320881-134320903 TGAAGGGAAGGGAGGGAGGGAGG + Intronic
1062025716 9:134339253-134339275 TGAAGGCCAGGCAGGGAGGGAGG - Intronic
1062091565 9:134681156-134681178 TGCAGGGAGGGCTGGGGTGGGGG + Intronic
1062156611 9:135052498-135052520 TGGAGGTAGGGCCTGGCGGGAGG + Intergenic
1062185772 9:135217714-135217736 TGAAGATAGGCCTTGGAGGTCGG + Intergenic
1062237983 9:135521778-135521800 AGTGGGCAGGGCTGGGAGGGTGG + Intronic
1062481066 9:136752107-136752129 TGGAGGTAGGGCTTGGTTGGAGG - Intergenic
1062498528 9:136842739-136842761 GCAAGGCAGGGCTGGGAGGTGGG + Intronic
1185431168 X:12965-12987 GGAAGGAAGGGAAGGGAGGGAGG - Intergenic
1185440435 X:225362-225384 GGAAGGAAGGGAAGGGAGGGAGG - Intergenic
1185511577 X:668119-668141 TGGAGGAGGGGATGGGAGGGGGG - Intergenic
1185672437 X:1823880-1823902 TGGAGGTGGGGCTGGGTGAGGGG - Intergenic
1185893008 X:3836600-3836622 GAAAGGTAAGGCTGGGGGGGGGG + Intronic
1185898117 X:3875020-3875042 GAAAGGTAAGGCTGGGGGGGGGG + Intergenic
1185903235 X:3913451-3913473 GAAAGGTAAGGCTGGGGGGGGGG + Intergenic
1186196765 X:7116772-7116794 TGGAGGCAGGGCTTGGTGGGAGG + Intronic
1186552458 X:10521243-10521265 TGGAGGTGGGGCTTGGTGGGAGG - Intronic
1186625550 X:11289500-11289522 AGAAGGGAGAGCAGGGAGGGAGG + Intronic
1187200349 X:17128401-17128423 TGGAGGTGGGGGTGGGAGGTAGG + Intronic
1187531455 X:20100602-20100624 TGGAAGTAGAGCTGGGGGGGAGG + Intronic
1187568265 X:20474585-20474607 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1187719342 X:22135110-22135132 TGAAGGAAGAACTGGGATGGTGG + Intronic
1188138186 X:26515344-26515366 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1188595036 X:31889737-31889759 TTAGAGTACGGCTGGGAGGGAGG - Intronic
1188646363 X:32572779-32572801 TGGAGGTAGGGCCTGGTGGGAGG + Intronic
1188691892 X:33139496-33139518 TGAAGGTGGGGCCTGGTGGGAGG + Intronic
1189016926 X:37294644-37294666 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1189313007 X:40033166-40033188 TGAAGGGGTGGTTGGGAGGGAGG - Intergenic
1189776028 X:44470756-44470778 TGGAGGTGGGGCCGGGTGGGAGG - Intergenic
1190381459 X:49843192-49843214 TAAAGGGAGGGCTGAGAGGGAGG + Intergenic
1190446758 X:50533403-50533425 TGGAGGTAGGGCTTTGGGGGAGG + Intergenic
1191211208 X:57886672-57886694 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1191834881 X:65453910-65453932 TGGAGGAAAGGATGGGAGGGGGG + Intronic
1191877841 X:65813879-65813901 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1191996898 X:67105349-67105371 GGAAGCTGGGGCAGGGAGGGAGG + Intergenic
1192102631 X:68280450-68280472 TGAAGGCAGGACTTGGAGGTAGG - Intronic
1192150134 X:68706974-68706996 TCAAGGCAGGGCTAGGAGGCAGG - Intronic
1192175200 X:68880917-68880939 GGAAGGGGGGGCAGGGAGGGCGG - Intergenic
1192178649 X:68901707-68901729 TAGAGGCAGGGATGGGAGGGTGG - Intergenic
1192191955 X:68996364-68996386 TGGAGGTGGGGCAGGGAGGATGG - Intergenic
1192467317 X:71366510-71366532 TGGGGGTAGGGCTCGGGGGGTGG + Intronic
1193009254 X:76657522-76657544 TGGAGGTAGGGCATGGTGGGGGG + Intergenic
1193564035 X:83055669-83055691 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1193723901 X:85018459-85018481 TGAAGGTGGGGCCCGGTGGGAGG - Intronic
1194163803 X:90489034-90489056 TGAAGGTAGGGCCTGGTGTGAGG - Intergenic
1194471579 X:94304095-94304117 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1194895128 X:99431342-99431364 TGGAGGTGGGGCTTGGTGGGAGG + Intergenic
1194961848 X:100245101-100245123 TGCAGCTATGGGTGGGAGGGAGG - Intergenic
1194988248 X:100515054-100515076 TGAAGATGGGGATGGGAGGATGG - Intergenic
1195465512 X:105174445-105174467 AGCAGGGAGGGCAGGGAGGGTGG + Intronic
1195656176 X:107333464-107333486 TGAGAGAAGGGCTGGGAGGAAGG + Intergenic
1195767045 X:108306972-108306994 TGAAGTTGGGGTTGGGAGGAGGG - Intronic
1196093436 X:111772294-111772316 TGAAGGTAGGGCTGTGAAGTAGG + Intergenic
1196768433 X:119270688-119270710 TGAAAATAGGGCTGGCAAGGTGG - Intergenic
1196973075 X:121130754-121130776 TGAAGGTAGGGATGGGACTATGG - Intergenic
1197146531 X:123178413-123178435 CCCAGGTAGGGCTGGGAGGAGGG + Intergenic
1197490758 X:127114569-127114591 TGAAGATAGAGTGGGGAGGGAGG + Intergenic
1197724851 X:129769411-129769433 TGAGGAGAGGGCTGGGAGGTGGG - Exonic
1197819839 X:130531508-130531530 TGCTGGCAGGGCTGAGAGGGTGG - Intergenic
1198187424 X:134267095-134267117 TGGAGGTGGGGCCTGGAGGGAGG - Intergenic
1198215211 X:134549362-134549384 GGAAGGAAGGGCTGGGGAGGCGG + Intergenic
1198327261 X:135586232-135586254 TTAAGTTAGGGCTGGGGGGGTGG + Intergenic
1198709988 X:139491155-139491177 TGAAGGTGGGGCCTGGTGGGAGG - Intergenic
1198944116 X:141990935-141990957 TAAAGGTTGGGCTGGCAGGCAGG + Intergenic
1198979095 X:142374444-142374466 TGGAGGTAGGACTTGGTGGGAGG + Intergenic
1199111413 X:143939775-143939797 AGAGGGTAGGGGTGGGAGGAGGG + Intergenic
1199188703 X:144945490-144945512 TGGAGGTAGGGCCTGGTGGGAGG - Intergenic
1199264946 X:145818426-145818448 GGAAGGTAGGGCTGCGCTGGCGG + Exonic
1199345230 X:146731243-146731265 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1199467755 X:148158681-148158703 TGAAGGCAGGGTTGGGGAGGTGG - Intergenic
1199574986 X:149305259-149305281 GGAAGGGAGTGCTGAGAGGGAGG + Intergenic
1199874661 X:151920654-151920676 TGAAGGTAGGGGTGGGGGAGGGG - Intronic
1199987745 X:152964606-152964628 TGGAGGTGGGGCTTGGAGGGAGG - Intronic
1200217177 X:154373099-154373121 GGGAGGGAGGGCTGGGAAGGGGG + Intronic
1200480103 Y:3691350-3691372 TGGAGGTAGGGCCTGGTGGGAGG + Intergenic
1200510066 Y:4066843-4066865 TGAAGGTAGGGCCTGGCGTGAGG - Intergenic