ID: 1143243358

View in Genome Browser
Species Human (GRCh38)
Location 17:5462764-5462786
Sequence ATTAAATAGCTTGAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143243358_1143243361 -10 Left 1143243358 17:5462764-5462786 CCTTCTACCTCAAGCTATTTAAT 0: 1
1: 0
2: 0
3: 18
4: 190
Right 1143243361 17:5462777-5462799 GCTATTTAATAGTTTCATGTGGG 0: 1
1: 0
2: 2
3: 16
4: 227
1143243358_1143243367 30 Left 1143243358 17:5462764-5462786 CCTTCTACCTCAAGCTATTTAAT 0: 1
1: 0
2: 0
3: 18
4: 190
Right 1143243367 17:5462817-5462839 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
1143243358_1143243363 -5 Left 1143243358 17:5462764-5462786 CCTTCTACCTCAAGCTATTTAAT 0: 1
1: 0
2: 0
3: 18
4: 190
Right 1143243363 17:5462782-5462804 TTAATAGTTTCATGTGGGCCGGG 0: 1
1: 0
2: 0
3: 38
4: 355
1143243358_1143243364 0 Left 1143243358 17:5462764-5462786 CCTTCTACCTCAAGCTATTTAAT 0: 1
1: 0
2: 0
3: 18
4: 190
Right 1143243364 17:5462787-5462809 AGTTTCATGTGGGCCGGGTGTGG 0: 1
1: 2
2: 16
3: 70
4: 598
1143243358_1143243362 -6 Left 1143243358 17:5462764-5462786 CCTTCTACCTCAAGCTATTTAAT 0: 1
1: 0
2: 0
3: 18
4: 190
Right 1143243362 17:5462781-5462803 TTTAATAGTTTCATGTGGGCCGG 0: 1
1: 1
2: 2
3: 29
4: 319
1143243358_1143243365 3 Left 1143243358 17:5462764-5462786 CCTTCTACCTCAAGCTATTTAAT 0: 1
1: 0
2: 0
3: 18
4: 190
Right 1143243365 17:5462790-5462812 TTCATGTGGGCCGGGTGTGGTGG 0: 1
1: 5
2: 70
3: 615
4: 3447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143243358 Original CRISPR ATTAAATAGCTTGAGGTAGA AGG (reversed) Intronic
904218134 1:28940952-28940974 ATTTATTACCTTGAGGTATAGGG + Intronic
905158106 1:36005451-36005473 TTTAAATAACTTGAGATAAATGG - Intronic
906185425 1:43858810-43858832 AATAAATAGCCAGAGCTAGAGGG + Intronic
906857843 1:49327645-49327667 ATAAGACAGCTTGAGGTTGAAGG - Intronic
909387945 1:75081746-75081768 ATTAAGCAGCTTAAGGTAGTGGG - Intergenic
909553670 1:76928754-76928776 ATTAATCAGCTTCAGGCAGAGGG - Intronic
917663831 1:177204430-177204452 ATTGAATGACTTGATGTAGAAGG + Intronic
917810215 1:178651254-178651276 ATTATATAGCTTGAGGCCAAAGG + Intergenic
919274045 1:195389292-195389314 ATTGTATATATTGAGGTAGAAGG + Intergenic
921447881 1:215267953-215267975 ATTGAATAAATTGAAGTAGAAGG - Intergenic
921657666 1:217759641-217759663 ATTGAAAAGTTTGAGGCAGAGGG + Intronic
921919985 1:220657069-220657091 ATTAAATATCTTGTGATAAAGGG - Intronic
923071718 1:230571287-230571309 ACTAAAGACCTTGAGGTAGGGGG + Intergenic
1062977470 10:1695422-1695444 AGTGGATAGCTTGAGGTAAAAGG - Intronic
1064499070 10:15949024-15949046 ATGAAATAAATTGAGCTAGAGGG - Intergenic
1068052195 10:51964219-51964241 ATTAAGAATCTTGAGGTGGAGGG - Intronic
1068409072 10:56631481-56631503 ATTAAAAAGCCAGAGATAGAAGG + Intergenic
1068895066 10:62189895-62189917 ATTACATTTCTTTAGGTAGAAGG - Intronic
1071016812 10:81007255-81007277 ATGAAATAGGTTGAGCCAGAAGG + Intergenic
1073698623 10:105898991-105899013 TTTAAAGAGTTTTAGGTAGATGG - Intergenic
1074954333 10:118373097-118373119 ATAAAATCTCTTGAAGTAGATGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1079278178 11:19061281-19061303 AATAAATATCATGATGTAGAGGG - Intergenic
1079639616 11:22788669-22788691 ATTAAATAGCTTGAATTTGCTGG - Intronic
1079821504 11:25136500-25136522 ATTAAATAGCTTGAGAAATATGG - Intergenic
1080573009 11:33574101-33574123 AGTAATTAGCTTGTGATAGAAGG + Intronic
1081683340 11:45024226-45024248 AATAAATAGTTTGTGATAGAAGG + Intergenic
1085894020 11:80615300-80615322 ATTATATGATTTGAGGTAGAGGG - Intergenic
1085964650 11:81507698-81507720 ATGGAATATCTTGAGGTATATGG + Intergenic
1086171501 11:83841860-83841882 ATTAAAGAGCCTGGGGTAGGAGG + Intronic
1086733466 11:90277353-90277375 ATTAAATACCATGATGTAAAAGG + Intergenic
1088062415 11:105671274-105671296 AAGAAATAGCTTGAGGAAAAAGG + Intronic
1088308677 11:108437176-108437198 ACTCAGTAGCTTGAGGTAGGAGG + Intronic
1088666341 11:112097586-112097608 GTTAATAAGCTAGAGGTAGAAGG + Intronic
1090167971 11:124571328-124571350 ATTAAAGGGCTTGGGGTAGAGGG - Intergenic
1093259005 12:16911250-16911272 ATTAAACATATGGAGGTAGAAGG - Intergenic
1094078219 12:26502197-26502219 TTTAAAATGGTTGAGGTAGAAGG - Intronic
1094406103 12:30118014-30118036 ACTAAATGTCTTGAGGCAGAGGG - Intergenic
1094429256 12:30348784-30348806 ACTAAATACCTTAAGGCAGAAGG - Intergenic
1094555611 12:31496839-31496861 ATGAAATATTTTAAGGTAGACGG + Intronic
1095125917 12:38477037-38477059 CTAAAATTGCTTGAGGTATAGGG + Intergenic
1095540524 12:43304206-43304228 ATTACTTAGCATGAGCTAGAAGG - Intergenic
1095827796 12:46548318-46548340 ATTAAAAAGATTGAGAAAGAGGG - Intergenic
1098220556 12:68265748-68265770 ATTAAATAGACTAGGGTAGAAGG - Intergenic
1098965512 12:76783751-76783773 ATTAAGTATCTTGAGATGGAGGG + Intronic
1099342376 12:81453710-81453732 ATTTAATAACTTGAGGCAGTTGG + Intronic
1099921355 12:88961182-88961204 ATTAAATAGCAAGAGGTCAATGG + Intergenic
1100085426 12:90904630-90904652 ATTAAAATGCTTGAGGAAGTGGG - Intergenic
1101518010 12:105454937-105454959 ATAAAATGGCTTGAGGTTGAAGG + Intergenic
1103655197 12:122465159-122465181 ATTTAAGAGGTTGAGGTAGGAGG + Intergenic
1108406159 13:50104465-50104487 ATTTAATAGCTTGAATTAAATGG - Intronic
1110383613 13:74882477-74882499 ATTAAATAAATTGTGGTACATGG + Intergenic
1110398693 13:75064638-75064660 ATAAAAGGGCTTGAGGTTGAAGG - Intergenic
1110759268 13:79212662-79212684 ATTAAATACCTTAATGTAGATGG - Intergenic
1110980217 13:81888910-81888932 ATTAAATATCTAGAGATTGAAGG + Intergenic
1111427814 13:88111542-88111564 ATTAAACAACATGAGGTAAAAGG + Intergenic
1111602165 13:90488536-90488558 ATTTAATAGATTGAGAGAGATGG - Intergenic
1111821711 13:93223871-93223893 AACAAATAGCATGAGGTAAACGG - Intergenic
1114786171 14:25602063-25602085 ATAACATAGATTGAGATAGAAGG - Intergenic
1114854223 14:26418202-26418224 AGGCAATAGCTTGAGGGAGAGGG + Intergenic
1115797456 14:36954829-36954851 CTTAAATAGGTGGAAGTAGAGGG - Intronic
1116444777 14:44996342-44996364 AATAAATAGTTTCAGGAAGAGGG + Intronic
1120270294 14:82304332-82304354 ATTAAATAGCCTGGGAGAGATGG - Intergenic
1124797138 15:32792717-32792739 ATTAAATAGCATGAGCTGGAAGG - Intronic
1125668434 15:41451431-41451453 ATTAAAGTGCTTGATGAAGATGG + Intronic
1128897400 15:71387956-71387978 ATTAAATAGCTCTGGGTTGAGGG - Intronic
1129911373 15:79229898-79229920 ATAAAAGGGCTTGAGGTTGAAGG + Intergenic
1130401683 15:83561525-83561547 ATTAAATCACTCTAGGTAGAAGG + Intronic
1130778220 15:87007843-87007865 ATTAAATAGCCTAATGTATATGG + Intronic
1131499507 15:92948204-92948226 ATTAAAGGGTTTAAGGTAGATGG + Intronic
1132135258 15:99331238-99331260 TTCAAATACCTTTAGGTAGATGG + Intronic
1137836919 16:51601210-51601232 CTTAGATAGCTTTAGGTTGAGGG + Intergenic
1143243358 17:5462764-5462786 ATTAAATAGCTTGAGGTAGAAGG - Intronic
1145067833 17:19774302-19774324 ATTAAAGGTCTTGGGGTAGATGG - Exonic
1145988542 17:29063962-29063984 ATTAGCTAGGTTGAGGTAGAAGG - Intergenic
1149205115 17:54234848-54234870 ATAAAAGGGCTTGAGGAAGATGG + Intergenic
1150090655 17:62322307-62322329 ATTAAAAAGTTTGAGGAGGAGGG + Intergenic
1150560180 17:66287870-66287892 ATTCAGGAGGTTGAGGTAGAAGG + Intergenic
1153052479 18:912834-912856 ATTAAAATGCTTTAGGTAGAAGG + Intergenic
1155246515 18:23915679-23915701 ATTAAATATTTTGTGGTAGGAGG - Intronic
1155416871 18:25607612-25607634 ATAGAATACCCTGAGGTAGAGGG + Intergenic
1158176429 18:54662188-54662210 ATTAAATAGCTTTAGAAACATGG - Intergenic
1158246842 18:55441594-55441616 ATAGAACAGCTTGAGCTAGATGG + Intronic
1159715970 18:71823706-71823728 ATAAAAGGGCTTGAGGTTGAAGG + Intergenic
1159939625 18:74396900-74396922 ATGAAAAAGCTTGAGGAAGCTGG - Intergenic
1164526556 19:29017396-29017418 ATGAAATTGTTTGAGGTAGGGGG + Intergenic
1165887626 19:39089965-39089987 AATAAATATCTTGAGGGAGATGG + Intronic
1166570182 19:43790824-43790846 ATTAAAAGGCTGGAGGCAGAAGG - Intergenic
1202641461 1_KI270706v1_random:93447-93469 ATGAAATAGCTGGAAGTACAAGG + Intergenic
926523586 2:13948163-13948185 ATGAAATAAATTGAGGAAGATGG - Intergenic
931484847 2:62680306-62680328 ATTCAATAACTTGAGGAACAGGG - Intronic
931664627 2:64601358-64601380 ATTAAATAGGGTGGGGGAGAAGG - Intergenic
933269701 2:80220376-80220398 ATTAATTGCCTTGAGGCAGAAGG - Intronic
935716505 2:105943823-105943845 TTTCAATAGCTGGAGGTGGAAGG + Intergenic
936998443 2:118439480-118439502 ATTAAAAAGCTTGAAGAAGGAGG - Intergenic
939390297 2:141560192-141560214 ATTAAATATCTTAAAGTGGATGG - Intronic
939473144 2:142650982-142651004 ATGAAATAGCTTGAGGACGTTGG - Intergenic
940840120 2:158570110-158570132 ATTAAGTAAATTGTGGTAGATGG + Intronic
941657221 2:168157049-168157071 ATTAAGGAGCTAGAGGAAGATGG - Intronic
943554218 2:189382246-189382268 ATTAAAAATATTGAGGTGGAAGG + Intergenic
944213883 2:197234603-197234625 ATTAAAAAGAATGAGGTGGATGG - Intronic
944377381 2:199062433-199062455 AAGAAAAAGCTGGAGGTAGAAGG + Intergenic
946679585 2:222199354-222199376 ATTAAATACATTCAGGAAGAAGG + Intergenic
948875054 2:240821579-240821601 ATTAAAAAGCATGAGGAAAACGG - Intergenic
1173195158 20:40908185-40908207 TTTAAATACCTTGAGGGGGAGGG - Intergenic
1178701866 21:34840782-34840804 ATGAAACAGCTGGAGGCAGAGGG - Intronic
1181846300 22:25712028-25712050 AGTAAATGGCTGGAGGAAGATGG + Intronic
1183959502 22:41402809-41402831 ATAAAAGAGCTTGAGGTGGCTGG + Intergenic
949735823 3:7170509-7170531 ATTAAACCACTTGAAGTAGAAGG - Intronic
949818674 3:8090829-8090851 ATTAAATAGCCTGATGCAGATGG - Intergenic
951072314 3:18345452-18345474 ATTAAAGAAATTGTGGTAGAAGG - Intronic
951554229 3:23904451-23904473 ATAAAAGGGCTTGAGGTTGAAGG - Intronic
953376784 3:42435525-42435547 AGTAAATAACTTGAAGGAGAAGG + Intergenic
953519819 3:43631224-43631246 ATTAAAGGGCTTGTGGGAGAAGG - Intronic
954551267 3:51483474-51483496 ATTAAACAGCTTCAGGAAGTAGG + Intronic
955241145 3:57179218-57179240 ATTGAATGGGTAGAGGTAGAAGG + Intergenic
955847798 3:63185304-63185326 ATTAAATTGCTTTAGAAAGATGG - Intergenic
956477569 3:69639142-69639164 TTAAAATAGCATGAGTTAGATGG + Intergenic
956907116 3:73777850-73777872 AATAAATTGCTTGGGGTAGAGGG - Intergenic
961434808 3:126909571-126909593 ATTAAATAACGTGAGTAAGAAGG - Intronic
961869874 3:129979520-129979542 ATTAAAGAGCTGGAGGGAGCGGG - Intergenic
964649616 3:158996134-158996156 AATAGACAGCTGGAGGTAGATGG - Intronic
965615459 3:170587380-170587402 AGTAACAAGCTTGAGGTAGGTGG - Intronic
965685398 3:171296979-171297001 TTTAAACAGCTGAAGGTAGAAGG - Intronic
966509998 3:180751721-180751743 ATAAAATAGCTTGAGGCTGCAGG + Intronic
966645601 3:182243603-182243625 ATTCAGTAGGCTGAGGTAGAAGG - Intergenic
970098548 4:12493093-12493115 ATGAGATAGATTGGGGTAGATGG - Intergenic
970272783 4:14365184-14365206 ATTTAACAGCTTGTGATAGAGGG + Intergenic
972018282 4:34274268-34274290 ATAAAATATCTTGAGAAAGAAGG - Intergenic
974095108 4:57354547-57354569 ATTAAATATTTTGCGGTAGTGGG + Intergenic
974136820 4:57828301-57828323 ATTAAATGCCTTGGGGGAGAAGG - Intergenic
974855540 4:67456619-67456641 ATTCAATAGGCTGAGGTAGAAGG + Intergenic
975038481 4:69713349-69713371 AGCAAATAGCTTGAGTAAGAAGG - Intergenic
975252903 4:72199812-72199834 ATTAAATGCCTTGAGGTAGTTGG - Intergenic
975970089 4:80023546-80023568 ATTAAATAGGTTTAGGCACAGGG + Intronic
977350443 4:95878417-95878439 AGTAAATAGATTGAGGAATATGG + Intergenic
977712342 4:100141851-100141873 ATTATATAATTTGAAGTAGAAGG - Intergenic
982866666 4:160521768-160521790 TTTAAATACCATGATGTAGAAGG - Intergenic
984412746 4:179415502-179415524 ATTAAATACCTATATGTAGAAGG - Intergenic
984494483 4:180477784-180477806 ATAAAATAGCACGAGGTTGATGG + Intergenic
984506601 4:180626848-180626870 TTTACATAGCTTGAGGGTGAAGG + Intergenic
986548506 5:8925992-8926014 AATAAATGGCTTGAGGTAAGGGG - Intergenic
987197225 5:15538684-15538706 TTTAAATAGCTTTAAATAGAAGG - Intronic
989110669 5:37904013-37904035 ATAAAATGGCTTGAGGGAGTGGG + Intergenic
992461028 5:76960370-76960392 ATAAAACAGCTTCAGGGAGATGG + Intronic
993314072 5:86376553-86376575 ATTACAGTTCTTGAGGTAGAGGG + Intergenic
993483287 5:88451025-88451047 GTTAAAGATCTTGAGGTAGGGGG - Intergenic
994016550 5:94973300-94973322 AAATAATAGTTTGAGGTAGACGG - Intronic
994108803 5:95977313-95977335 ACAAAATGGCTTGAGGTAGTGGG - Intergenic
995827997 5:116322863-116322885 ATTACATGGCAAGAGGTAGAAGG + Intronic
996023440 5:118617012-118617034 AGTAAAGATCTTGAGGTACAGGG - Intergenic
996416350 5:123214872-123214894 ATTAAATAAGGTGAGGTAGAAGG - Intergenic
997109025 5:131054077-131054099 ATCAAAAAGCTTGAAGTAAAAGG + Intergenic
997130833 5:131274265-131274287 ATTTAATAGGATGAGGAAGACGG - Intronic
999008596 5:148009337-148009359 ATTAAAGTGATAGAGGTAGAAGG - Intergenic
999870858 5:155749302-155749324 AGTAAATAGCATGAAGTAGAGGG - Intergenic
1000826904 5:166056109-166056131 CCAAAATAGCTTGAGGTTGATGG - Intergenic
1001754147 5:174154322-174154344 ATTAAATTGTTTGTAGTAGAAGG + Intronic
1004184289 6:13408631-13408653 ATGAAATCGCTAAAGGTAGAGGG - Intronic
1004830231 6:19468849-19468871 ATAGAAAAGATTGAGGTAGAAGG + Intergenic
1005476051 6:26208969-26208991 ATTAAATATCTTAAGAAAGAAGG + Intergenic
1005906636 6:30266650-30266672 ATTCAGTTGCTGGAGGTAGAGGG + Intergenic
1006257836 6:32845069-32845091 ATTAAAAAGCTTAAGGGAAAAGG + Intronic
1006876766 6:37304282-37304304 AATAAATACCTAGAAGTAGAAGG - Intronic
1011213173 6:84976419-84976441 AATACATAGCTTGAGGTATTGGG - Intergenic
1011278870 6:85656878-85656900 GTTATATAAGTTGAGGTAGAAGG - Intergenic
1016219092 6:141644932-141644954 ACTAAAGAGCCTGAGGTAGGAGG - Intergenic
1016642397 6:146364183-146364205 AATAAATAGCTAGAGGTAAAAGG - Intronic
1020460956 7:8429612-8429634 ATCAAAAAGCTTTATGTAGAAGG - Intergenic
1020914915 7:14180903-14180925 ATTAAATAGGTTGATCTAGCTGG - Intronic
1021253121 7:18356540-18356562 ATTAAATAGCCAGAGGTGAAAGG - Intronic
1021344771 7:19512409-19512431 CATAAATAGCTAGAGATAGATGG + Intergenic
1021498615 7:21304459-21304481 ATTCAATAGCTTTAGGAATACGG - Intergenic
1022421733 7:30229880-30229902 ATAAAAGGGCTTGAGGTTGAAGG - Intergenic
1023254727 7:38301796-38301818 ATTAAATGGCTGGAAGTGGAGGG - Intergenic
1024811843 7:53220874-53220896 ACTAAATAGCTTGTAGAAGAGGG - Intergenic
1025754797 7:64328458-64328480 ATTAAAGATCTTCAGGTAGTCGG + Intronic
1027872672 7:83730214-83730236 ATTAAATAGCTAGAGGCAGCGGG + Intergenic
1028202289 7:87975933-87975955 CTCAAAGAGCTTTAGGTAGAGGG + Intronic
1030317707 7:108133153-108133175 ATTACAGAGACTGAGGTAGATGG + Intergenic
1030641824 7:112014794-112014816 ATTCAAGAGGTTGAGGTAGAAGG + Intronic
1032758794 7:134918021-134918043 ATTTAATAGGGTGGGGTAGATGG + Intronic
1032810824 7:135415068-135415090 ATTAGAAAGCTTGAGGGACAAGG - Intronic
1034501648 7:151454668-151454690 ATCAAAGGGCTTGAGGTAGTGGG - Intergenic
1034687436 7:152985350-152985372 ATTAAGGATCTTGAGGTAGGGGG - Intergenic
1034783586 7:153904489-153904511 ATTAAAAGGCTTGAGGGGGAGGG + Intronic
1037413360 8:18620598-18620620 ATTCAATAGGCTGAGGTAGGGGG + Intronic
1043772409 8:84222002-84222024 TTTAAATATTCTGAGGTAGATGG + Intronic
1046451154 8:114391826-114391848 ATTAAATACCTTCAGGAACATGG - Intergenic
1046976519 8:120284401-120284423 ATCCAAGAGCTTGAGGTTGATGG - Intronic
1048370397 8:133771766-133771788 ATTAAACAGATTGCAGTAGAAGG - Intergenic
1053403412 9:37849060-37849082 ATTAATTAACTAGAGATAGAAGG + Intronic
1055829617 9:80362393-80362415 GTTAAATAGCATTAGATAGATGG + Intergenic
1056146190 9:83731699-83731721 ATTAAATAGCTTCAGGGAGCTGG + Intergenic
1056280471 9:85036960-85036982 ATTAAGGAGCTTGAAATAGAAGG + Intergenic
1059470220 9:114499419-114499441 ATTAAATGGCTGGAGGTATCTGG - Intronic
1059600410 9:115771202-115771224 TTAAAATAGCTTGAGCCAGAGGG + Intergenic
1059862745 9:118483199-118483221 ATAAAAGGGCTTGAGGTTGAAGG + Intergenic
1186412675 X:9357628-9357650 ATTAAATAGCAGGGGGTATATGG + Intergenic
1186593106 X:10952561-10952583 ATTAAATAGCCCTAGGGAGAGGG + Intergenic
1188677018 X:32954195-32954217 ATTGAATGGCTTGAGGTGAAAGG - Intronic
1191895875 X:65992932-65992954 AACAAAAAGCTTGAGGTAGCCGG + Intergenic
1195416781 X:104628970-104628992 ATTAAAGAGATGGAGATAGACGG + Intronic
1197297331 X:124734880-124734902 ATTGGATAGCTATAGGTAGAAGG + Intronic
1198039898 X:132840275-132840297 ATTTAGTTGCATGAGGTAGAGGG + Intronic
1199521783 X:148744141-148744163 ATTAAATGAGATGAGGTAGAAGG - Intronic
1199799083 X:151231517-151231539 ATAAAATAGGTTGTGGAAGACGG - Intergenic
1201440129 Y:13999465-13999487 TTTAAATGCCTTGAGGCAGAAGG + Intergenic
1201444442 Y:14043243-14043265 TTTAAATGCCTTGAGGCAGAAGG - Intergenic