ID: 1143244008

View in Genome Browser
Species Human (GRCh38)
Location 17:5468124-5468146
Sequence AAGAGGCAGAGTTGTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 503}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143244008_1143244014 14 Left 1143244008 17:5468124-5468146 CCTGCCCCACAACTCTGCCTCTT 0: 1
1: 0
2: 3
3: 45
4: 503
Right 1143244014 17:5468161-5468183 ACTACACCTTCCCTTTCGACCGG 0: 1
1: 0
2: 0
3: 2
4: 60
1143244008_1143244018 26 Left 1143244008 17:5468124-5468146 CCTGCCCCACAACTCTGCCTCTT 0: 1
1: 0
2: 3
3: 45
4: 503
Right 1143244018 17:5468173-5468195 CTTTCGACCGGAATGTGTTCAGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143244008 Original CRISPR AAGAGGCAGAGTTGTGGGGC AGG (reversed) Intronic
900289364 1:1917336-1917358 AACAGGCAAAGGCGTGGGGCTGG + Intergenic
900604535 1:3517983-3518005 AAGGGGCAGAAATGTCGGGCCGG - Intronic
901337494 1:8463723-8463745 AAGAGGCAGGGAAGTGGGGAAGG + Intronic
901646467 1:10719506-10719528 AAGAAGCAGCGCTGTGGGGAAGG + Intronic
903175036 1:21575654-21575676 CAGCAGCAGTGTTGTGGGGCTGG + Intronic
903177064 1:21587561-21587583 AAGGGGCAGAGTGCTGGGTCAGG + Intergenic
903349402 1:22709316-22709338 AAGAGCCAGTGGGGTGGGGCTGG - Intergenic
905039496 1:34943614-34943636 AGGAGGCAGAGTTGTAGGATAGG + Intergenic
905318644 1:37099770-37099792 AAGAGGCAGCATTGTGGAGCAGG - Intergenic
905349439 1:37334633-37334655 AGGAGGCAGAGTGATGGAGCAGG - Intergenic
905912820 1:41665278-41665300 GAAAGGCAGAGTTGAGGTGCAGG + Intronic
906108320 1:43307629-43307651 CAGAGGCAGAGTGGAGGGTCCGG - Intronic
906202549 1:43969552-43969574 AAGAGGCAGAGGTGGGAGGATGG + Intergenic
906244395 1:44262872-44262894 GAAAGGCTGAGTTTTGGGGCAGG - Intronic
906524915 1:46488362-46488384 CACAGGCAGAGTTGAGGGTCCGG - Intergenic
906642670 1:47450665-47450687 AGGTGGCTGAGTTGTGGGGAGGG + Intergenic
906674765 1:47685265-47685287 AAGAGAAAGAGGGGTGGGGCGGG + Intergenic
907472943 1:54686089-54686111 GAGAGCCAGAGGTTTGGGGCTGG + Intronic
908311248 1:62886752-62886774 AAGAGGCAGCTTTTGGGGGCAGG - Intergenic
908769563 1:67583671-67583693 GAAAGGCAAATTTGTGGGGCAGG - Intergenic
910210902 1:84791900-84791922 TAGTGGCTGAGGTGTGGGGCCGG + Intergenic
910968052 1:92827368-92827390 AAGAGACAGAGTCTTGGGCCAGG - Intergenic
912552080 1:110490941-110490963 AAGAGGAGGAGTTGTGGGTGAGG + Intergenic
913330170 1:117660727-117660749 TGGAGGCAGAGTGGTGTGGCAGG + Intergenic
913494803 1:119418587-119418609 CAGACGCAGAGTTGTGGCGTAGG - Intronic
913508594 1:119541991-119542013 CAGAAGCAGAGTTGTGATGCAGG - Intergenic
913594173 1:120357517-120357539 ATTAGGCAGGGTTGTGGGGATGG + Intergenic
913709529 1:121468517-121468539 AAAAGGCAGTATTGTGGTGCTGG - Intergenic
914196536 1:145450797-145450819 AGGAGGCAGAGTCCTGTGGCAGG + Intergenic
914305440 1:146412405-146412427 ATTAGGCAGGGTTGTGGGGATGG + Intergenic
914596619 1:149160398-149160420 ATTAGGCAGGGTTGTGGGGATGG - Intergenic
915119249 1:153618247-153618269 TAGGGGCAGAGATGTGGGGCAGG - Intergenic
915360749 1:155285108-155285130 CAGAGGGAGAGATTTGGGGCCGG - Intronic
915549706 1:156625016-156625038 AGGAGGCGGAGTTGGGGTGCGGG - Intronic
915594733 1:156889918-156889940 AGCAGGCAGAGCTGGGGGGCAGG + Intergenic
915596322 1:156898348-156898370 AAGGGGCAGGGGTGAGGGGCTGG - Intronic
915896293 1:159813703-159813725 AAGAGGGAGTGCTGTGGAGCTGG + Intronic
916795770 1:168165714-168165736 AACAGGCAGAGTGGTGGAGTTGG - Intergenic
916868720 1:168888569-168888591 CAGAGGCAGAGTTGCAGTGCTGG + Intergenic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
917512168 1:175677664-175677686 GAGAGGCAGAGTTGTGGCAATGG + Intronic
917840548 1:178974046-178974068 AAGTGGCAGGGTTGGGGGGAGGG - Intergenic
918912367 1:190591017-190591039 GAGAGGGAGATTTCTGGGGCTGG - Intergenic
920665437 1:207959621-207959643 GAGGGGGGGAGTTGTGGGGCTGG - Intergenic
920796689 1:209144293-209144315 AAGGGATAGAGTTGTGGGGCAGG - Intergenic
920962016 1:210671819-210671841 AGGAGGTGGAGCTGTGGGGCTGG + Intronic
920966144 1:210702635-210702657 ATGAGGTAGAGCTGTGGAGCTGG + Intronic
921102763 1:211944750-211944772 AAGAGGCAGAATTGTGATACAGG - Intronic
921138598 1:212285181-212285203 TTGAGGCAGAGGAGTGGGGCGGG - Intergenic
921348042 1:214207318-214207340 AAGAAGCAGAGTTGGGGTCCAGG + Intergenic
921350762 1:214232149-214232171 AAGAAGCAGAGATGTTGGCCCGG + Intergenic
921938170 1:220813784-220813806 AAGAGGAAGAGTGGGTGGGCTGG + Exonic
921979356 1:221238762-221238784 AAAAGAAAGATTTGTGGGGCAGG - Intergenic
922473090 1:225888670-225888692 AAGGGGCAGTGAGGTGGGGCCGG - Intronic
922942798 1:229482492-229482514 AAGGGGCAGAGCAGGGGGGCTGG + Intronic
923206896 1:231767955-231767977 AAGAGACAGAGTTGTAAGTCCGG + Intronic
923556698 1:235006577-235006599 AAGATGAAAAGTTGTGGGGATGG + Intergenic
923752340 1:236757424-236757446 AAGAGGCAGAGTTGACATGCTGG + Intronic
924434935 1:244030881-244030903 AAGAGGGAGACTTGAGAGGCGGG - Intergenic
924470645 1:244339975-244339997 AAGTGGCTGAGTTGTGAGGCTGG - Intergenic
1063142272 10:3265761-3265783 AAGATGCAGAGTTCTGTGGAGGG + Intergenic
1063557741 10:7096894-7096916 CTGAGGCAGAATTGTGGGGTAGG - Intergenic
1063984221 10:11483700-11483722 AAAAGGCAGTGTTGGGGGGCCGG + Intronic
1064065993 10:12181945-12181967 TAGAGGCAGTGTTGTTGGCCAGG - Intronic
1064364915 10:14699043-14699065 AGCAGGCAGAGGTGGGGGGCAGG + Intronic
1064450285 10:15435881-15435903 AAAAGGCATAGTTCTGGGGCTGG + Intergenic
1064460457 10:15530103-15530125 AAAAGGCAGAGTTTTGGTGATGG + Intronic
1067538291 10:47133257-47133279 GAGTGGCAGAATTGTGGAGCAGG + Intergenic
1067564648 10:47327694-47327716 AGGAGGCAGAGGGGAGGGGCAGG + Intergenic
1070056882 10:72943849-72943871 AAGAGGCAGATATGTGGTGAAGG - Intronic
1070737465 10:78873514-78873536 AAGAGACAAAGTTGTGGTGATGG - Intergenic
1070809166 10:79288960-79288982 AGGAGGCAGTGTTTAGGGGCAGG + Intronic
1071843253 10:89495019-89495041 TAGGGCCAGAGTTGTGGGACAGG - Intronic
1072317073 10:94213526-94213548 AAGAGGAAGAGGTCTGGGTCAGG - Intronic
1072782611 10:98260871-98260893 AGGAGGCAGGGTTGTGGGGCAGG - Intronic
1072911647 10:99507060-99507082 AAGAGGCAGAGTAGCTGGCCTGG - Intergenic
1073208981 10:101783209-101783231 AAGAGGTAGGGATGTGAGGCGGG - Intronic
1074162792 10:110847691-110847713 AAGAGCCAGAGGAGCGGGGCTGG + Intergenic
1074584856 10:114757930-114757952 AGGAGGCAGGCTTGTGTGGCTGG - Intergenic
1074876949 10:117621292-117621314 GAGAAGCAGAGCTCTGGGGCAGG - Intergenic
1075083716 10:119400419-119400441 AATTGGCAGAATTGTGGGGGAGG + Intronic
1075166941 10:120077101-120077123 ACGAGGCAGCTTTGTGGGGATGG + Intergenic
1075598604 10:123750368-123750390 AAAAGGAAGACTTGTGTGGCTGG - Intronic
1076417704 10:130303202-130303224 AAGAGGCAGAGAGATGGGGAGGG + Intergenic
1077024623 11:433701-433723 GAGGGGCAGGGCTGTGGGGCCGG - Intronic
1077077950 11:709684-709706 ACCAGGCACAGCTGTGGGGCAGG - Intronic
1078021171 11:7656936-7656958 ATGAAGCAGAGCTGTGGGACAGG + Intronic
1079135772 11:17775325-17775347 AAGAGGTGGAGGTGAGGGGCAGG - Intronic
1079299657 11:19266637-19266659 AAGAGGAAGAGTGGTGGGTTAGG + Intergenic
1080037229 11:27722320-27722342 AAAAGGGAAAGTTGTTGGGCTGG - Intergenic
1081064514 11:38523954-38523976 CAGAGGCATAGTTGTAGTGCTGG + Intergenic
1081800182 11:45853350-45853372 AGGAAGCAGAGATGTGAGGCTGG - Intronic
1081992320 11:47344465-47344487 AGGAGGCATTGTTGTGGAGCAGG - Intronic
1084668550 11:70591719-70591741 AAAATGCAGAGATGTGGGCCGGG + Intronic
1085851504 11:80125348-80125370 AAGAGGCAGAGTTGGGGAGGAGG - Intergenic
1085999476 11:81963592-81963614 TAGAGGCATAGTTGTGGTGTTGG + Intergenic
1086510598 11:87553795-87553817 AAGAGTCAGAGATGATGGGCTGG + Intergenic
1087593882 11:100228872-100228894 CATAAGCAGAGCTGTGGGGCTGG + Intronic
1088484886 11:110330927-110330949 CAGAGAGAGAGTTGTGGGGGAGG + Intergenic
1088611543 11:111582128-111582150 AAGAGTCAGAGTGCTGAGGCAGG - Intergenic
1089156551 11:116407174-116407196 AAGAGGCAGAGAAGTTGGGTCGG - Intergenic
1089498614 11:118920113-118920135 AGGAAGCAGAGTGCTGGGGCCGG - Intronic
1089678680 11:120107501-120107523 AAGAGGCAAAGGAGTGGGGAGGG - Intergenic
1090534310 11:127624155-127624177 TAGAGGAAGAGGTTTGGGGCAGG + Intergenic
1090786304 11:130050832-130050854 AAGAGGCAAAGATGAGGAGCTGG - Intergenic
1090968263 11:131617067-131617089 CAAAGTCAGAATTGTGGGGCTGG + Intronic
1091129850 11:133136560-133136582 AAGAGGCAGAGGTGGGAGGAAGG + Intronic
1091542477 12:1474633-1474655 GAGAAGCAGAGCTGAGGGGCGGG - Intronic
1091563197 12:1629965-1629987 AACAGGCAGGTGTGTGGGGCCGG - Intronic
1091616274 12:2053207-2053229 AAGAGGCGGAGAGGAGGGGCGGG - Intronic
1091672049 12:2458906-2458928 AAGAGGCAGTGCTGTATGGCAGG - Intronic
1091883611 12:3999981-4000003 TAGAGGCAGAGATATGGGGTGGG - Intergenic
1092033387 12:5309001-5309023 TAGAGGCAGAATAATGGGGCTGG - Intergenic
1093058450 12:14578489-14578511 TAGAGACAGAGTTGTTGGCCAGG - Intergenic
1094032548 12:26029245-26029267 ATTAGGGAGAGGTGTGGGGCAGG + Intronic
1094347054 12:29482199-29482221 GAGAGCCAGAGTTGAGTGGCTGG - Intronic
1096547026 12:52347144-52347166 CAGAGGCAGAGAGGTGGGCCAGG + Intergenic
1096885569 12:54715780-54715802 AAAAGGCAGAGTATTGGGGTTGG + Intergenic
1098512386 12:71332009-71332031 CAGAGGCTGAGCTGTGGGGAGGG + Intronic
1099040767 12:77651822-77651844 AAGAGTCAGAGGTGCTGGGCTGG + Intergenic
1100588307 12:95999742-95999764 GAGAGGCAGAGGTGAGGGACAGG + Intergenic
1101556910 12:105818779-105818801 GAGAGGCTGAATTGTGGTGCAGG + Intergenic
1102421605 12:112807823-112807845 AGGAGGCAGAGTTCTGGGGAGGG - Intronic
1102470203 12:113155444-113155466 AAGAGGGAGTGTTTGGGGGCTGG - Intronic
1102650576 12:114439536-114439558 AAGAGGGAGAGCTGAGGCGCAGG - Intergenic
1102997779 12:117362866-117362888 AAGTGGCAGAGCCCTGGGGCTGG - Intronic
1104345274 12:127991164-127991186 TACAGGCAATGTTGTGGGGCGGG - Intergenic
1104523550 12:129497397-129497419 AAGAGGTGGAGTCGTGGAGCAGG - Intronic
1104635557 12:130436130-130436152 TAGGGGAAGAGATGTGGGGCTGG - Intronic
1105255989 13:18744383-18744405 CAGGGACAGAGTTCTGGGGCCGG + Intergenic
1105374134 13:19828176-19828198 AAAATGCAGAGGTGTGGGCCAGG + Intronic
1105547487 13:21361449-21361471 AACAGGCAGAGTTGTGATGCTGG + Intergenic
1105970608 13:25426312-25426334 AAGAGACAGAGTGGTGGGGGAGG + Intronic
1106027118 13:25966165-25966187 AAGGGACAGAGTTGGGGTGCTGG - Intronic
1106416881 13:29553208-29553230 AAGATGAAAAGTTCTGGGGCAGG + Intronic
1106470423 13:30049475-30049497 AACTGGCAGAGATGTGAGGCAGG + Intergenic
1107221711 13:37989137-37989159 AAGAGGCAGAGTTCAAGGTCAGG - Intergenic
1107336815 13:39364159-39364181 AAGGGGCAGGGTTATGTGGCAGG + Intronic
1107376817 13:39812509-39812531 AAGATGCCCAGATGTGGGGCTGG - Intergenic
1107404025 13:40096192-40096214 AAAAGAGAGAGTTGTGGGGAGGG + Intergenic
1107410752 13:40156440-40156462 AGGAAGGAGACTTGTGGGGCAGG + Intergenic
1107573551 13:41690508-41690530 AAGAGAAAGGGTTGTGGGGAGGG + Intronic
1108506182 13:51114392-51114414 CAGAGGCAGAGTGGGGGTGCAGG - Intergenic
1108678888 13:52762504-52762526 AAGAGGCAGAGGTGATGGGCTGG + Intergenic
1109894550 13:68667524-68667546 TAGAGACAGAGTTGTTGGACAGG + Intergenic
1110216499 13:73030182-73030204 AACAGGTAGAGTTTGGGGGCAGG - Intergenic
1110500232 13:76219181-76219203 TAGGGGCAGAGTTGGGGGGAAGG - Intergenic
1112433775 13:99375906-99375928 AGGAGGCAGAGTTGGGAGGATGG - Intronic
1113043575 13:106130104-106130126 AGGAGGTAGAGTTGTGGAGTAGG + Intergenic
1113193455 13:107777547-107777569 AAGAGAAAGAGTTGCGGGGAAGG - Intronic
1113629891 13:111875028-111875050 AAGAGGCAGAGGTCTGGGGGGGG + Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114081494 14:19204575-19204597 AAGAGAGAGAGTTGTGGGGGAGG - Intergenic
1114491511 14:23105132-23105154 CAGAGGCAGAGTGCTGGGGGAGG + Intergenic
1114585737 14:23811985-23812007 AAGAGGCTGAGGTGTGAGGTTGG - Intergenic
1114988783 14:28262740-28262762 AGGAGGCAGAGTGGTTGTGCTGG - Intergenic
1117063100 14:51982705-51982727 AAGAGTCACAGTGGTGGAGCTGG + Intergenic
1119730902 14:76950578-76950600 AAGCTGCAGAGTGGTGGGACTGG + Intergenic
1119774904 14:77242309-77242331 AAGAGGAAGAAATGTGGGTCTGG - Intronic
1119968519 14:78943501-78943523 AAGAGGCAGGGTTATGAGGAGGG + Intronic
1120237627 14:81910884-81910906 CAGAGGTAGGGTAGTGGGGCAGG - Intergenic
1120347302 14:83307227-83307249 AGGAGGCTGAGTTGTGGCACTGG - Intergenic
1120499536 14:85277798-85277820 AAGAGCCAGAGTGGTAGAGCTGG - Intergenic
1120908150 14:89639045-89639067 TAGAATCAGAGTTGTGGAGCTGG - Intronic
1121456572 14:94042474-94042496 ATGAGGCAGAGGTTTGGGGGTGG + Intronic
1121697619 14:95926537-95926559 AAGAGGCAGAGATGGGGCTCAGG - Intergenic
1122175998 14:99919649-99919671 AAGAGGTACAGATGAGGGGCTGG - Intronic
1122461982 14:101903531-101903553 ACGAGGGCGAGTTGGGGGGCTGG - Intronic
1122797623 14:104213914-104213936 CAGAGGCAGAGATGGGGGGATGG - Intergenic
1122890940 14:104731934-104731956 AAGAGGGAGACCGGTGGGGCTGG + Intronic
1122937407 14:104966572-104966594 GGGAGGCAGAGCGGTGGGGCTGG - Intronic
1123042260 14:105495280-105495302 AAGAGGCAGAGAAGGGGGACTGG - Intronic
1123983012 15:25621074-25621096 AAGACGAAGAGTTCTGGGGATGG + Intergenic
1124856136 15:33391140-33391162 TATAAGCAGAGTGGTGGGGCTGG - Intronic
1124916558 15:33980680-33980702 AATGGGCCAAGTTGTGGGGCAGG - Intronic
1125202385 15:37111369-37111391 AAGAGGAAGAAATGTGGGGAAGG - Intergenic
1125698162 15:41656783-41656805 AAGAGACAGGGTTGGGGGGTAGG + Intronic
1127274747 15:57432286-57432308 GAGAATTAGAGTTGTGGGGCGGG + Intronic
1127704167 15:61530890-61530912 TACAGGCAGAGTTGAGGGGGGGG - Intergenic
1127755302 15:62086228-62086250 AAGAGGCTGAGGGGTGGGCCTGG - Intergenic
1127922208 15:63503238-63503260 AAGAGGCCGACTTGTGGCGTGGG + Intergenic
1128700803 15:69802814-69802836 AAGAGGCAGAGAGGAGTGGCTGG + Intergenic
1128943675 15:71807812-71807834 AGGAGGCCTAGTTGTGGGGAGGG - Intronic
1130146007 15:81274008-81274030 AGGAGGCAAAGTTCAGGGGCTGG + Intronic
1130649065 15:85751798-85751820 CAGTGGGAGAGTTGTGGGGAGGG + Intergenic
1130841249 15:87703298-87703320 AAGAGGAAGGGTCGGGGGGCAGG - Intergenic
1131491467 15:92866901-92866923 AAGAGGGAGAGTTGGGGGAGAGG + Intergenic
1133760955 16:8797892-8797914 AAGAGGCAGAGCGCTGGGCCAGG - Exonic
1134337225 16:13311729-13311751 AGGAGGCAGTGTTATGTGGCAGG + Intergenic
1134515785 16:14885716-14885738 AAGAGGCAGAGAGGAGGGGAGGG + Intronic
1134703456 16:16284360-16284382 AAGAGGCAGAGAGGAGGGGAGGG + Intronic
1134964087 16:18427754-18427776 AAGAGGCAGAGAGGAGGGGAGGG - Intronic
1134968374 16:18510290-18510312 AAGAGGCAGAGAGGAGGGGAGGG - Intronic
1135161099 16:20097116-20097138 AAAAGGAAGAAGTGTGGGGCTGG - Intergenic
1135656659 16:24256136-24256158 AAAAGACAGAGTCCTGGGGCGGG - Exonic
1136116749 16:28099378-28099400 AAGAGGAATAGTGGTTGGGCAGG - Intronic
1136119903 16:28126061-28126083 CAGAGACAGAGTTGTGGGAAGGG + Intronic
1136463878 16:30429010-30429032 TAGAGTCTGAGTTGTGGGGGAGG - Intronic
1137551823 16:49442781-49442803 AAGGGGCAGAGTGGCAGGGCTGG - Intergenic
1137784702 16:51128618-51128640 AAGAGGCAGGGAAGTGGGGAGGG + Intergenic
1137908494 16:52351204-52351226 AGGAGGGAGAGTCGTAGGGCTGG - Intergenic
1139145177 16:64315230-64315252 AATGGTCAGAGTTGGGGGGCAGG - Intergenic
1139374482 16:66488205-66488227 AAGAATCACAGTGGTGGGGCAGG + Intronic
1139830255 16:69791813-69791835 AAGAGGCCGAGGTGGGGGCCAGG - Intronic
1140104415 16:71946702-71946724 AAGAAGTGGATTTGTGGGGCAGG + Intronic
1140406141 16:74712900-74712922 AAGGGGCAGTGGTGTGGGGAGGG - Intergenic
1140928517 16:79605858-79605880 AAAAGGCAAAGTGGGGGGGCGGG - Intergenic
1141478790 16:84292508-84292530 CAGAGGCAGAGAGATGGGGCAGG + Intergenic
1141785544 16:86198178-86198200 CAGAGGCTGATCTGTGGGGCTGG + Intergenic
1141790804 16:86232794-86232816 AAGAGGGAGCGGTGAGGGGCTGG - Intergenic
1142155461 16:88530953-88530975 AAGAGGCAGAGGTGGCGAGCAGG + Intronic
1142902787 17:3023508-3023530 AAGAGGCAGGGTTATGGAGAAGG + Intronic
1143244008 17:5468124-5468146 AAGAGGCAGAGTTGTGGGGCAGG - Intronic
1143965737 17:10755544-10755566 AAGAGGCAGGGTTGCGGGATGGG - Intergenic
1143989542 17:10944911-10944933 AAGCTGCAGAGTTTTGGGGTGGG - Intergenic
1144038407 17:11387447-11387469 AGGAGGAGGAGCTGTGGGGCTGG + Intronic
1144404953 17:14943166-14943188 CAGAGGCTGAGTTCTGGGTCTGG - Intergenic
1145752237 17:27363479-27363501 AGAAGGGAGAGTTGTGGGGTGGG - Intergenic
1145909152 17:28532736-28532758 ATGAGTCAGGGATGTGGGGCTGG + Intronic
1146273128 17:31497576-31497598 AGGAGGAAGAGTGGTGGGGTGGG + Intronic
1146638972 17:34526063-34526085 AAGAGGCAGAGTTGGGGTGTGGG - Intergenic
1146761430 17:35482528-35482550 ATGGGGCAGGGTTGTGGGGCAGG - Intronic
1147489153 17:40847784-40847806 AAAGGGCAGAGTTTTGGGGCCGG - Intergenic
1147904274 17:43812896-43812918 AAGTGGCAGGGATGTGGGGGAGG - Intronic
1148194663 17:45704700-45704722 GAGATGCAGGATTGTGGGGCGGG + Intergenic
1148236763 17:45974315-45974337 AAGAAGCAAAGGTGAGGGGCTGG + Intronic
1148499534 17:48079103-48079125 AAGAGGGGGAGGTGCGGGGCCGG - Intronic
1148556997 17:48584790-48584812 AAGAGGCAGATATCTGGGGAAGG - Intronic
1148565989 17:48633400-48633422 GAGAGGCAGAGGTGAGGAGCGGG - Intronic
1148600814 17:48892934-48892956 AATAGGCAGGGTTGTGGGCTGGG + Intronic
1149370417 17:55988642-55988664 AGCACGCAGAGTTGTGGGGTTGG + Intergenic
1150257664 17:63761147-63761169 AAGATGCTGAATTGGGGGGCTGG + Intronic
1150628315 17:66858159-66858181 AGGAGGCAGAGATTTGGGGTGGG - Intronic
1151007160 17:70450916-70450938 AAGATGCAAATTTGTGGGGGGGG - Intergenic
1151663426 17:75531784-75531806 GAGAGGCAGGGCTGTGGGGAAGG - Intronic
1152031763 17:77847274-77847296 CAGAGGCAGAGTTTTGGGACGGG - Intergenic
1152084279 17:78208075-78208097 AAGAGGCGGTGTGGTGGGGTGGG - Intergenic
1152630221 17:81407591-81407613 AAGGGGCTGCGCTGTGGGGCAGG + Intronic
1152872383 17:82763442-82763464 AAGAGACAGGGTTTTGGGCCAGG + Intronic
1153604638 18:6819632-6819654 AAGGGGCAGAGTTGTTGAGTGGG - Intronic
1154192166 18:12239381-12239403 AGGAGGCAGAGTTGTGGGGAGGG - Intergenic
1154435044 18:14336295-14336317 CAGGGACAGAGTTCTGGGGCCGG - Intergenic
1155356465 18:24958511-24958533 ATGAGGGAGAGTTGGGAGGCTGG - Intergenic
1156597708 18:38566429-38566451 GAGAGGATGGGTTGTGGGGCAGG + Intergenic
1156917091 18:42474402-42474424 AAGAGGCAGAGATTTGGGTGAGG - Intergenic
1157298160 18:46460912-46460934 GAGAGGCAGGGTTGTGGTGGGGG - Exonic
1157410048 18:47455873-47455895 TGGGGGCAGAGTGGTGGGGCAGG - Intergenic
1157766814 18:50303950-50303972 AGGAGGCAGAGCTGTGAGGATGG - Intergenic
1158317753 18:56230410-56230432 AAGAGGCAGAGTTGGAGGTAAGG + Intergenic
1159814446 18:73055195-73055217 AAGAGACAGAGTTTTCGGCCGGG - Intergenic
1160076978 18:75686727-75686749 AAGAAGCAGTGTTGAAGGGCGGG + Intergenic
1160136962 18:76280524-76280546 AGGAGGGAGAGTTGTGGAGAAGG - Intergenic
1160241160 18:77124175-77124197 CAGAGGCAGAGATGAGGGGGAGG - Intronic
1160804890 19:988304-988326 GAGAGCCAGGGCTGTGGGGCGGG + Intronic
1161514375 19:4688656-4688678 AAGAGGCAGAGGCCTGGAGCTGG - Intronic
1161769380 19:6223093-6223115 AGGAGGCTGAGATGAGGGGCAGG - Intronic
1161897815 19:7095728-7095750 AAGAAGGAAAGTTTTGGGGCTGG + Intergenic
1162000776 19:7743704-7743726 ATGAGTCAGAGTGGTGGGGAGGG - Intronic
1162016758 19:7850383-7850405 CTGAGGCAGAGGGGTGGGGCAGG + Intronic
1162476594 19:10904177-10904199 AAAAGGACAAGTTGTGGGGCAGG - Intronic
1164579097 19:29423289-29423311 AAGAGCCAGAGGTCTGGGCCTGG - Intergenic
1164743347 19:30593386-30593408 GAGAGGAAGAGATTTGGGGCAGG + Intronic
1164819869 19:31241441-31241463 GACAGGCAGTGTGGTGGGGCTGG - Intergenic
1164985413 19:32644810-32644832 AAGAGGCACAATGCTGGGGCTGG + Intronic
1165867659 19:38948842-38948864 GAGAGTCACAGTTGTGGGGTAGG - Intronic
1166305261 19:41933974-41933996 GAGAGGCAGAGTGGAGGGGTGGG + Intergenic
1166373992 19:42316788-42316810 CAGGGGCAGGGTTGGGGGGCTGG + Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166816064 19:45546962-45546984 AAGAAGCAGAGTTTTAGGCCAGG - Intronic
1167220863 19:48197135-48197157 AAGGGGCAGAGCTGGGGGGAGGG + Intronic
1167326968 19:48832609-48832631 AGGAAACAGAGTTGGGGGGCAGG + Intronic
1168062463 19:53900584-53900606 ACGATGCAGGGGTGTGGGGCAGG - Intronic
1168239229 19:55081008-55081030 AAGAAGCAGAGTTCTGGAGAAGG - Intronic
925602854 2:5626872-5626894 ATTAGGCAGGGTTGTGGGGATGG + Intergenic
926978252 2:18536352-18536374 AAGTGGCTGACCTGTGGGGCTGG + Intergenic
927138216 2:20112786-20112808 CAGAGCCAGAACTGTGGGGCTGG + Intergenic
927145680 2:20164218-20164240 CAGAGCCAGGGTTGTGGGGAGGG - Intergenic
927981760 2:27378859-27378881 GAGGGGCCGTGTTGTGGGGCAGG - Exonic
928197505 2:29226088-29226110 AAGAGGGACACTGGTGGGGCGGG + Intronic
928480129 2:31675163-31675185 CAGAGGCACAGTTGTAGTGCTGG - Intergenic
929222487 2:39478677-39478699 GAGAGGCAGAATTAAGGGGCTGG + Intergenic
929686596 2:44040359-44040381 AAAAGGCACAGTTGTGGGAGAGG + Intergenic
929914069 2:46119097-46119119 AGTAGGCAGATTTGTGGGGTTGG + Intronic
930059541 2:47276868-47276890 CAGAGGCTTAGTTCTGGGGCAGG + Intergenic
932054786 2:68433045-68433067 GGGAGGCTGAGTTGGGGGGCTGG - Intergenic
932264755 2:70358051-70358073 AGGAGGAATAGATGTGGGGCGGG + Intergenic
932471405 2:71961882-71961904 CAGAGGCAGGGTTGGTGGGCAGG - Intergenic
932484776 2:72077590-72077612 TAGAGGCAGAGTTGGGGGAGGGG - Intergenic
932486275 2:72086114-72086136 AAGAATCAGGGTTGAGGGGCTGG - Intergenic
932574550 2:72955540-72955562 CAGAGGCAGGGATGTGGGGAGGG + Intronic
933775937 2:85771205-85771227 AAAGTGCAGAGTTCTGGGGCTGG + Intronic
933867108 2:86530286-86530308 AAGATGAAGAGTTCTGGGCCAGG - Intronic
934101506 2:88657493-88657515 AAGAGGAAGAATTCTGGGGCGGG + Intergenic
935417194 2:102831459-102831481 AAGAAGAAGAGTGGTGGGCCAGG + Intronic
935443433 2:103130958-103130980 AAGAGGGAGAGTGGAGGGGTTGG + Intergenic
935805319 2:106740941-106740963 AAGTGGAAGAGTTGTGATGCTGG + Intergenic
937077504 2:119117754-119117776 GAGATGCAGAGGGGTGGGGCAGG - Intergenic
937197562 2:120173254-120173276 AGAAGGCAGGATTGTGGGGCTGG + Intronic
937353408 2:121183114-121183136 ACGAGGCAGAGTTGGGGAACAGG - Intergenic
937419363 2:121741342-121741364 ACCAGGCAGAGTGGTGGGGAGGG - Intronic
937645405 2:124260827-124260849 TAGAGTCAGAGCTGTGGGGAAGG - Intronic
937691461 2:124760459-124760481 GAGTGGCAGAGTGGTGGGGGCGG - Intronic
937895236 2:126972769-126972791 AAGAGGCAGAGTTCTGGAGACGG - Intergenic
938245065 2:129769885-129769907 AAAAGGCAGAGTTCAGGGCCTGG + Intergenic
940242962 2:151583084-151583106 AAGAGAGAGAGATGGGGGGCAGG - Intronic
940243917 2:151593636-151593658 AAGAGAGAGAGATGGGGGGCAGG - Intronic
940244877 2:151604189-151604211 AAGAGAGAGAGATGGGGGGCAGG - Intronic
942484240 2:176422551-176422573 AAGAAGCAGAGGGGTGGGGTGGG + Intergenic
942525064 2:176844210-176844232 AAGAGGCACAGATTTGAGGCAGG - Intergenic
943716496 2:191158356-191158378 AAGAGGCAGAGTTGAGAGTTTGG - Intergenic
944587524 2:201185744-201185766 AAGGGACAGAGAGGTGGGGCAGG - Intronic
944740975 2:202612322-202612344 AAGAGGCAGAGTTCTGAAGATGG + Intergenic
945179446 2:207076803-207076825 AAGCGCAAGAGTTGGGGGGCAGG - Exonic
945715260 2:213350624-213350646 AAGAGACAAAGTAGTTGGGCAGG + Exonic
946793414 2:223324213-223324235 CACAGGCAGGGTTGGGGGGCAGG + Intergenic
947686049 2:232085954-232085976 ACCAGGCATAGTTGGGGGGCAGG - Intronic
947716628 2:232342981-232343003 AGGAGTCAGAGTGGGGGGGCTGG + Intronic
948067463 2:235091926-235091948 GAGAGGCAGTGGCGTGGGGCAGG + Intergenic
948545799 2:238727872-238727894 ATGAGGCAGAGGTGTTGTGCAGG - Intergenic
948686620 2:239674473-239674495 GTGAGGCAGAGTTGTGGTGTGGG + Intergenic
948827806 2:240581876-240581898 ATGAGGCTGAGTTGCGGGGTGGG - Intergenic
1168842246 20:916923-916945 AGGAGGCAGAGGGGTGAGGCTGG + Intergenic
1170651389 20:18245647-18245669 AAGTGGCAGAGTGGTCAGGCTGG - Intergenic
1170770611 20:19329064-19329086 GACAGGAAGAGTTGTGGTGCTGG + Intronic
1170783260 20:19446070-19446092 ATGAGTCAGAGTTCTGGTGCTGG - Intronic
1170785578 20:19464230-19464252 AAGAGCCAGAGCTGTGTGGCAGG - Intronic
1171880739 20:30616132-30616154 CAGGGGCAGAGTTCTGGGGCTGG + Intergenic
1171882750 20:30630648-30630670 CAGGGACAGAGTTCTGGGGCCGG + Intergenic
1171934522 20:31261135-31261157 TAGAGGCAGAGATGAAGGGCAGG - Intergenic
1172203633 20:33146176-33146198 ACCAGGCAGAGTCGTGAGGCTGG - Intergenic
1172447249 20:34999685-34999707 AGGAGGCAGAGGTCAGGGGCTGG + Exonic
1172916192 20:38445684-38445706 GAGAGGCAGAGTTGCAGGACAGG + Intergenic
1173161866 20:40658765-40658787 CAGAGGCATAGGTGTGGGGGTGG + Intergenic
1173852408 20:46227466-46227488 CAGAGGCGGAGCCGTGGGGCGGG - Intronic
1174441749 20:50561170-50561192 AGGAGGCAGTGATGTGGGGCAGG - Intronic
1175878596 20:62243468-62243490 AAGAGGCGGAGCTGCCGGGCAGG - Intronic
1175942603 20:62544791-62544813 AAGACAGAGAGTTGTGGGGGAGG + Intergenic
1175977529 20:62718579-62718601 AAAAGGCAAAGCTGTGGGGGAGG - Intronic
1176841993 21:13849407-13849429 CAGGGACAGAGTTCTGGGGCCGG + Intergenic
1177553265 21:22654045-22654067 AAGAGGCTGAGGTGTGAGGATGG + Intergenic
1178459921 21:32793650-32793672 GAGAGGCACAGTTGTGGGTAGGG + Exonic
1178847206 21:36183714-36183736 AAGAGGCAGAGTGCTGTGGCTGG - Intronic
1180499280 22:15918111-15918133 AAGAGAGAGAGTTGTGGGGGAGG + Intergenic
1180593934 22:16961732-16961754 AAGGGGCAGAGCAGTGGGGAGGG - Intergenic
1180951064 22:19720873-19720895 AACATGCAGACTGGTGGGGCAGG + Intronic
1180971231 22:19816882-19816904 AAGAAGCAGGGTTGGGGGGGTGG - Intronic
1181322423 22:22018522-22018544 AAAAATCAGAGTTGTGGGGTAGG + Intergenic
1181464361 22:23102791-23102813 AAGAGACAGAGTGATGGGGTTGG - Intronic
1182289337 22:29266461-29266483 TGGAGGAAGAGTTGTGGGCCAGG - Intronic
1183474738 22:38029933-38029955 AAGAGGCAGAGTTAGGGGAAAGG + Intronic
1183540830 22:38428431-38428453 GAGGGGCAGTGTTGAGGGGCAGG - Intronic
1183746155 22:39693208-39693230 AAGATGGAGAGTTCTGGGGATGG - Intergenic
1183831950 22:40422927-40422949 GCCAGGCAGAGGTGTGGGGCTGG + Intronic
1184331340 22:43829762-43829784 AAGTGGCAGGGGTGGGGGGCTGG - Intronic
1184661937 22:45969441-45969463 AAGAGGAAGGCTTGTGGTGCTGG - Intronic
1185026225 22:48414778-48414800 AACAGGAAGAGCAGTGGGGCAGG + Intergenic
1185030757 22:48441719-48441741 GAGAGGCAGAGGCCTGGGGCTGG - Intergenic
1185052120 22:48559462-48559484 CAGAGGAGGGGTTGTGGGGCAGG - Intronic
1185309126 22:50143935-50143957 ATGAGGCAGAGTCGTGGCCCAGG + Intronic
950410553 3:12833692-12833714 AGGAGGCAGTGGTGTGGGCCAGG + Intronic
950447823 3:13048330-13048352 TACAGGCAGTGTTGTGGGGATGG - Intronic
950767441 3:15283794-15283816 TAGAGGTGGAGTTGTGGGGAGGG - Intronic
951134928 3:19094338-19094360 AAGGGTCAGAGGGGTGGGGCAGG + Intergenic
951846998 3:27095454-27095476 GAGAGCCAGAGTTCTGGGGTAGG + Intergenic
952816350 3:37451332-37451354 AAGATGAAGAGTTGTGGAGATGG + Intergenic
952902464 3:38119304-38119326 AGGAGGCACAGATGTGGGGCAGG - Intronic
953268372 3:41415446-41415468 AAGGGGCAGAGGTGGGGTGCTGG - Intronic
954214367 3:49116246-49116268 GACAGGCACAGTGGTGGGGCCGG + Intronic
954412391 3:50376490-50376512 AAGCAGCAGACCTGTGGGGCCGG - Intronic
956629895 3:71305890-71305912 AGGAGGCAAAGCTTTGGGGCGGG + Intronic
956686035 3:71828408-71828430 AAGTGGCAGTGTTAGGGGGCTGG + Intergenic
956768639 3:72505942-72505964 GAGGGGCAGAGATGTGGGGCAGG + Intergenic
957663803 3:83196636-83196658 AATAGGGAGAATTGTGTGGCTGG - Intergenic
959935164 3:112021651-112021673 CAGAGGAAGAGTAGTGGGGGAGG - Intergenic
961354853 3:126331070-126331092 CAGAGGCAGGGTAGTGGGGAAGG + Intergenic
961918033 3:130397708-130397730 AAGGGGGTGAGCTGTGGGGCTGG + Exonic
962133710 3:132710215-132710237 AAGATGTAGCTTTGTGGGGCTGG + Intronic
962252212 3:133842272-133842294 AAGAGGCATAGGTGTGGCACAGG - Intronic
962446363 3:135469474-135469496 AAGGGGCAGAGATGTGGGTGAGG - Intergenic
962610653 3:137073438-137073460 TAGAGGCAGAATTGAAGGGCAGG + Intergenic
964413891 3:156427678-156427700 AAGAGACAGAATTGTGGGGTAGG + Intronic
965013904 3:163131558-163131580 AGGAGGCAGAGTGGGGGGTCTGG + Intergenic
966748288 3:183298991-183299013 AAGAGGAACAGCTGTGGGGATGG + Intronic
966882349 3:184357574-184357596 CAAGGGCAGGGTTGTGGGGCTGG + Intronic
970549937 4:17169502-17169524 GAGAGGCAAAGTTCTTGGGCTGG - Intergenic
971163451 4:24157842-24157864 GAGAGGGAGAATTGTGGGGTGGG - Intergenic
973366426 4:49213087-49213109 CAGGGACAGAGTTCTGGGGCTGG + Intergenic
973730456 4:53817478-53817500 AACAGGCTGATTTGTGGGGTTGG - Intronic
974012770 4:56622930-56622952 AAGATGTTGAGTGGTGGGGCTGG + Intergenic
974506026 4:62773065-62773087 AAGAAGGAGATTTGTGTGGCTGG + Intergenic
975063538 4:70035222-70035244 AAGAGACAGAGTTCTGGGTAGGG + Intronic
976263721 4:83170915-83170937 AAGAAGAAGAGATGTGGGGGCGG - Intergenic
976751870 4:88457354-88457376 AAGAGCCAGAGCTGTGCGCCCGG - Exonic
977182296 4:93891164-93891186 AAAAGAGAGAGTTGTGGGGATGG + Intergenic
977327052 4:95587335-95587357 AAGAGGCAGGGCTGTGGAGGAGG - Intergenic
978799962 4:112745885-112745907 AAGGGGGAGAGATGTGGGGATGG - Intergenic
979692470 4:123574461-123574483 AAGACGCAGAGGAGTGTGGCAGG - Intergenic
981379074 4:144050807-144050829 AGGAAACAGAGTTGTGGGGGTGG + Intergenic
983843311 4:172483226-172483248 AAGAGGCAGAGGTCAGGGGAGGG + Intronic
984651681 4:182277332-182277354 CAGAGGTAGAGTTGGGGGGTGGG + Intronic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
986482220 5:8201261-8201283 CAGAGCCAGAGTGGTGGGGCAGG + Intergenic
986612883 5:9587513-9587535 ATTAGGCACAGTTGTGTGGCAGG - Intergenic
986792919 5:11181042-11181064 CAGAGGCTGACTGGTGGGGCAGG + Intronic
987053244 5:14166102-14166124 ATGAGTCTGATTTGTGGGGCAGG + Intronic
988294008 5:29330998-29331020 AAGAGGGAGAGGGGTGGGACAGG - Intergenic
989038456 5:37200137-37200159 AAGAAGCCTAGTTGTAGGGCAGG - Intronic
989967341 5:50480049-50480071 AAAAGGCAGTATTGTGGTGCTGG + Intergenic
991703436 5:69336131-69336153 AACAGGCAGAGGTGGGGAGCTGG - Intergenic
992213589 5:74504648-74504670 AGGTGTCAGAGTTGTGGGGATGG - Intergenic
992219225 5:74555436-74555458 GCAAGGCAGAGTTGTGGCGCAGG + Intergenic
992557373 5:77916677-77916699 AAGAGAGAGAGTTGTGGGGGAGG - Intergenic
993354714 5:86891844-86891866 AAGAAGCAGATTTGTGAGGGTGG - Intergenic
994711133 5:103265474-103265496 AAGAGGCAGAGTTCTTGGCAAGG + Intronic
996472510 5:123877005-123877027 TTGGGGGAGAGTTGTGGGGCAGG - Intergenic
996565808 5:124879160-124879182 AAGAGGGAGAGTTGCTGGGATGG - Intergenic
997142639 5:131399100-131399122 AAGAGAGAGAGTTGTGGGGGAGG + Intergenic
997348288 5:133209920-133209942 GAGAGGCAGGATTGTGGGGCTGG + Intronic
997461903 5:134058609-134058631 AAGAGTCAGAGTCCTTGGGCCGG - Intergenic
997546130 5:134709601-134709623 TAGAGGCTGGGTGGTGGGGCAGG + Intronic
998133556 5:139663100-139663122 AAGAGGCTGAGCTGGGGGCCAGG + Intronic
998142468 5:139707911-139707933 AAGAGGCAGGTGTGTGGGGGTGG + Intergenic
998785513 5:145704600-145704622 AAGAGGAACAGTTGTGGGTTAGG - Intronic
999246950 5:150160120-150160142 CCCAGGCAGAGTTGTGGGGTGGG + Intergenic
999723887 5:154419065-154419087 AAGGGGCAGGGTTGTGGGGAGGG + Exonic
1000348216 5:160332184-160332206 AGGAGGCAGAGGTGTGGTGTGGG - Intronic
1000856848 5:166408978-166409000 AAGAGCCACAGTTGTGGTGGTGG - Intergenic
1001117955 5:168955413-168955435 GAGAAGCAGAGCTGTGGGGAGGG - Intronic
1002052345 5:176578139-176578161 GAGAGGCAGAGAGGTGGGCCTGG - Intronic
1002077952 5:176720482-176720504 ATGGGGCACAGATGTGGGGCAGG - Intergenic
1002198678 5:177514662-177514684 AGGTGGCAGAGGTGGGGGGCAGG + Intronic
1003164682 6:3665874-3665896 AAGACCCAGAGCTCTGGGGCTGG + Intergenic
1003349599 6:5303550-5303572 AAGAAACAGAGTCGTGGGGAGGG - Intronic
1003404190 6:5815237-5815259 AACAGGCAGAGTTGTGATGCTGG - Intergenic
1004519838 6:16351505-16351527 AAGAGGCAGAGGTGGGTGGATGG - Intronic
1005380855 6:25232696-25232718 AGGAGACAGAGCTGCGGGGCAGG - Intergenic
1005842497 6:29752830-29752852 AAAATGCAGACCTGTGGGGCAGG + Intergenic
1005859647 6:29890366-29890388 TAGAGGAAGAATTGTGGGGTGGG - Intergenic
1006055176 6:31378769-31378791 GTGAGGCAGAGTGGAGGGGCAGG + Intergenic
1006183490 6:32167573-32167595 AGGTGGCTGAGCTGTGGGGCCGG + Exonic
1006437307 6:34032762-34032784 GGGAGGCTGAGTTGGGGGGCTGG + Intronic
1006451606 6:34108836-34108858 GAGAGGCAGGGATGGGGGGCTGG - Intronic
1006466234 6:34196468-34196490 AAGCGGAAGAGTAGTGCGGCTGG - Intergenic
1006940638 6:37749812-37749834 AAGAGCCCTAGTTGTGGGCCAGG - Intergenic
1007304675 6:40894598-40894620 GAGAGGAAGAGTAGTGGGGAAGG + Intergenic
1007474125 6:42107594-42107616 GAGAGGCAAAGATGGGGGGCAGG + Intronic
1011157043 6:84344450-84344472 AAGAGAGACAGTTGTGGGGAGGG - Intergenic
1011696231 6:89916025-89916047 AAGAGGCTGAGATGGGGGGATGG - Intergenic
1012528488 6:100205745-100205767 CTGAGGCAGAGAGGTGGGGCAGG + Intergenic
1013710141 6:112887694-112887716 GAGAGAGAGAGTTGTGGGGGAGG + Intergenic
1013788164 6:113806397-113806419 AACAGGCAGAGAAGTGGGGTTGG - Intergenic
1013813503 6:114070670-114070692 GAGAGGCAGTGTTGTGGGAAGGG - Intronic
1014884310 6:126760943-126760965 AAGAGGCAGAGATAAGGAGCTGG + Intergenic
1017826237 6:158084100-158084122 AGGAGCCAGTGCTGTGGGGCCGG - Exonic
1017906533 6:158760609-158760631 AAGAGGCAGAGCTTAGGGACAGG - Intronic
1018981344 6:168604009-168604031 AAGAGGCACAGCAGTGGAGCAGG + Intronic
1020017245 7:4838245-4838267 ATGAGGCTGAGCTGTGGGGCTGG - Intronic
1020059932 7:5144310-5144332 AGGAGGCAGAGCTGCGGGGAGGG + Intergenic
1021838059 7:24700083-24700105 ATAAGGCTGAGTTCTGGGGCTGG - Intronic
1022031382 7:26494197-26494219 AAGAGGCAGGGAAGTGGAGCAGG - Intergenic
1022691664 7:32662266-32662288 AGGAGGCAGAATTGTAGGGGAGG - Intergenic
1023093048 7:36633933-36633955 TGGAGGCAGATTTGTGCGGCGGG - Intronic
1026841053 7:73670092-73670114 AGGAGGCAGAGGTGAGGGGAGGG + Exonic
1026962774 7:74419647-74419669 GAGAGTCAGAGATGTGGGGGTGG - Intergenic
1028154635 7:87415913-87415935 AAGAAGCAGGATTGAGGGGCAGG + Intronic
1028760627 7:94492167-94492189 AAGAGTCATATTTGTGGGGTGGG + Intergenic
1029246465 7:99205551-99205573 AAGATACAGAGATGGGGGGCTGG + Intronic
1029745097 7:102512238-102512260 TGGAGGGAGAGTTGTGGGGGAGG + Intronic
1029763089 7:102611399-102611421 TGGAGGGAGAGTTGTGGGGGAGG + Intronic
1031076640 7:117219627-117219649 CAGATGTGGAGTTGTGGGGCAGG + Intronic
1031830890 7:126623836-126623858 AAGAGGCTGAGTTGGGAGGATGG + Intronic
1032015714 7:128379249-128379271 AAGAAGCAGAGTGGTGAGGGGGG + Intergenic
1032514393 7:132495996-132496018 AAGAGGCAGTTCTTTGGGGCAGG - Intronic
1033899475 7:146117155-146117177 AAGAGACAGGGTTGTGACGCTGG + Intronic
1034278250 7:149833750-149833772 GAGAGGCAGAGTGGTCAGGCTGG - Intergenic
1034353063 7:150429761-150429783 AAGAGGGAGAGGTGGGGGGTTGG - Intergenic
1034500128 7:151445098-151445120 AAGAGGCAGAGAAGGGAGGCAGG - Intergenic
1034737846 7:153445722-153445744 TAGAGGTAAAATTGTGGGGCAGG - Intergenic
1035023414 7:155811663-155811685 AAGAGGAAGAGATGGGGGGCGGG + Intronic
1035100770 7:156394628-156394650 ATGATCCAGAGTTGTGGGGAAGG + Intergenic
1035640178 8:1178891-1178913 AAGGGGCAATGGTGTGGGGCAGG - Intergenic
1036184198 8:6610191-6610213 TAGATGCAGATGTGTGGGGCTGG + Intronic
1036607733 8:10322511-10322533 CAGAGGCAGATTTGTGGGGAAGG + Intronic
1036701765 8:11017827-11017849 AGGAAGCAGTTTTGTGGGGCTGG + Intronic
1036895447 8:12631120-12631142 TACAGGCAGAGTTATGCGGCAGG + Intergenic
1038511374 8:28139084-28139106 AGGAGGCAGAGGCGTGGTGCAGG + Intronic
1038893698 8:31756551-31756573 AGGAGGCACAGTTGTGGAGGAGG - Intronic
1039864662 8:41490521-41490543 AGGAGGCCGAGCTGAGGGGCGGG + Intronic
1040334620 8:46409749-46409771 AAGATGCAGGGTTGAGTGGCCGG + Intergenic
1041695762 8:60734510-60734532 AAGAGGGAGGGTTGAGGGTCAGG + Intronic
1042344659 8:67715220-67715242 TAGAGGCAGGCTTGTGAGGCTGG - Intronic
1042557002 8:70042045-70042067 AAGATGAAGAGTTTTGGAGCTGG - Intergenic
1042867596 8:73369308-73369330 AAGACGCTGAGCTGTGGGGTTGG + Intergenic
1048096581 8:131301678-131301700 AAGAGGGAGAGTTGGGGGGGAGG + Intergenic
1048510184 8:135055015-135055037 AAGAAGCACAGCGGTGGGGCTGG - Intergenic
1049423565 8:142527284-142527306 AGCAGGCAGAGGTGAGGGGCGGG - Intronic
1049466198 8:142752266-142752288 AGAAGCCAGAGCTGTGGGGCCGG - Intronic
1049687627 8:143945256-143945278 GAGAGGCTGTGCTGTGGGGCAGG - Intronic
1051231163 9:14957164-14957186 AAGAGTCAGAGCTTTGGGGCTGG - Intergenic
1051726108 9:20089324-20089346 CAGAGGCAGAGTGGTTGTGCTGG - Intergenic
1052441392 9:28500196-28500218 AAGAGGCAGAGCTGTGCCTCTGG + Intronic
1054453301 9:65415139-65415161 ACAAGGCTGAGATGTGGGGCTGG + Intergenic
1054854043 9:69878943-69878965 AAGAAAGAGAGTTGGGGGGCAGG + Intronic
1055182153 9:73401747-73401769 AAGAGACACAATTGTGGTGCTGG - Intergenic
1055261727 9:74444564-74444586 ACGAGGCACAGTTATGCGGCGGG - Intergenic
1055276010 9:74617093-74617115 AAGAGGCAGAGTTTTTTTGCGGG - Intronic
1056803608 9:89711356-89711378 TGGAGGGAGAGGTGTGGGGCAGG - Intergenic
1057204357 9:93162449-93162471 GCGAGGCAGAGCTGAGGGGCCGG + Intergenic
1057305658 9:93910698-93910720 AAGAGGCAGGGTTGCTGGGGAGG + Intergenic
1057428923 9:94976960-94976982 AAGAGGCTGACTTCTGGGCCAGG - Intronic
1057700492 9:97360392-97360414 AAGAGGCTGAGAGGTGGGACTGG - Intronic
1057709682 9:97428138-97428160 AAGAGGGTGGGCTGTGGGGCTGG - Intronic
1057716735 9:97501780-97501802 CGGACGCAGAGCTGTGGGGCCGG - Exonic
1058713202 9:107698866-107698888 AACAGGCAGAGTTTTGGGTTTGG - Intergenic
1058864950 9:109153278-109153300 TATAGGGAGGGTTGTGGGGCTGG + Intronic
1059252993 9:112903996-112904018 AAGAGGAAGAGATGGAGGGCTGG + Intergenic
1059680409 9:116580256-116580278 AAGAGGCAGAGGTATGGGGCAGG + Intronic
1060248392 9:121965794-121965816 AAGGGGCAGGGTTCTGGGTCTGG + Intronic
1060750478 9:126165331-126165353 AGGAGGCAGCGGTGGGGGGCGGG - Intergenic
1061079599 9:128362010-128362032 AGGAGGCAGGGTGGTGTGGCAGG - Intergenic
1061732784 9:132629429-132629451 GAGAGGCAGAGTTCTGCGGATGG + Intronic
1062171637 9:135138018-135138040 CAGGGGTAGAGTTGTGGGGGTGG - Intergenic
1062382369 9:136292588-136292610 CACCGGCAGAGCTGTGGGGCAGG - Intronic
1062453111 9:136623753-136623775 CAGGGGCAGAGCTGAGGGGCAGG + Intergenic
1062478850 9:136742359-136742381 AGCAGGCAGAGTTGGGGGCCGGG - Intronic
1062556665 9:137115938-137115960 AAGGAGCAGAGGTGTGGGGTGGG - Intergenic
1062698196 9:137886037-137886059 AGGAGGCAGAGTCCTGTGGCAGG - Intronic
1187203151 X:17155403-17155425 AAGTGGCAGTGTTGAGGGGTGGG - Intergenic
1187920138 X:24193906-24193928 AAGATGAAGAGTTCTGGGGATGG - Intronic
1188903099 X:35759465-35759487 AAGAGAGAGAGTAGTGGGGGAGG - Intergenic
1190731259 X:53227496-53227518 GGGAGGTAGAGTGGTGGGGCAGG + Intergenic
1192204582 X:69087709-69087731 AAGAGGCAGAGGTGGGGCTCAGG - Intergenic
1192340319 X:70258625-70258647 AAGAGGCAGCCGTGCGGGGCTGG + Exonic
1193197937 X:78656363-78656385 AAGAGGCAGAGTCGTTGTACAGG + Exonic
1193828519 X:86257701-86257723 AAGAGCAAGAGTTGTAGGCCAGG - Intronic
1195273113 X:103252700-103252722 AAGAGGCAGCAGTGTTGGGCAGG + Intergenic
1195281016 X:103332602-103332624 AAGAGGCAGCAGTGTTGGGCAGG - Intergenic
1196175469 X:112634899-112634921 AACAGGTAGAGTTGTGGGGAGGG - Intronic
1197095252 X:122586634-122586656 GAGAGAGAGAGTTGGGGGGCAGG + Intergenic
1197155416 X:123264912-123264934 TAGTGGCAGAGTTGGGGGCCTGG - Intronic
1197749484 X:129954812-129954834 TGGAGGCAGTGTTGTGGGGATGG + Intergenic
1197861687 X:130977912-130977934 AAGAGGCAGAGTTGAGAGGTGGG + Intergenic
1198315469 X:135461593-135461615 AAGAGAGAGATTTGTGGGGAGGG + Intergenic
1198395208 X:136212872-136212894 AAGTGGCAGAGTAGTGGGACGGG - Intergenic
1199766559 X:150945733-150945755 AAGGGGCAGAGTTGTGAGGATGG + Intergenic
1199963750 X:152801049-152801071 AAGAGGCAGTGGTGTGGGAAGGG - Intergenic
1200064708 X:153498781-153498803 CAGAGGCAGAGGTGAGAGGCTGG + Intronic
1200068216 X:153515048-153515070 AGGAGGCAAAGTGGTGGGGCAGG + Intergenic
1201796573 Y:17902873-17902895 AAGAGGCAGAGTGGTGTCCCTGG + Intergenic
1201804982 Y:18003112-18003134 AAGAGGCAGAGTGGTGTCCCTGG - Intergenic
1202357958 Y:24071935-24071957 AAGAGGCAGAGTGGTGTCCCTGG + Intergenic
1202512820 Y:25598178-25598200 AAGAGGCAGAGTGGTGTCCCTGG - Intergenic