ID: 1143246159

View in Genome Browser
Species Human (GRCh38)
Location 17:5487053-5487075
Sequence TCCCATTAGGACCTCTCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143246159_1143246163 2 Left 1143246159 17:5487053-5487075 CCCGAAGAGAGGTCCTAATGGGA 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1143246163 17:5487078-5487100 TCGAAGAAAGGAGTTAATCAAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1143246159_1143246162 -10 Left 1143246159 17:5487053-5487075 CCCGAAGAGAGGTCCTAATGGGA 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1143246162 17:5487066-5487088 CCTAATGGGAATTCGAAGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143246159 Original CRISPR TCCCATTAGGACCTCTCTTC GGG (reversed) Intronic
903814871 1:26057566-26057588 TCCCACCAGGACCTCTGTCCAGG - Intronic
904326245 1:29728527-29728549 CCACATTTGGACCTCTTTTCAGG - Intergenic
904951154 1:34240117-34240139 TCCCATTAGCACATCTATACTGG - Intergenic
907428810 1:54398611-54398633 TCCCATTGGGGCATCTCTTTGGG - Intronic
911760129 1:101604163-101604185 TCCCACTAGGATCTCTCGTTTGG + Intergenic
916506674 1:165434528-165434550 TCCCATTAGCAACCCTCTTCAGG + Intronic
916853554 1:168727474-168727496 TCCCATCATCACCTCTCTACTGG + Intronic
918308161 1:183265927-183265949 TCCCATTATCTTCTCTCTTCTGG - Intronic
919851517 1:201676189-201676211 TTCCAGGAGGACCTCTCTGCAGG - Intronic
922380499 1:225018879-225018901 TCCCTTTAGGACCTCTTGTAAGG - Intronic
1067171085 10:43906541-43906563 TCCCCTCTGGGCCTCTCTTCTGG - Intergenic
1069205593 10:65680543-65680565 TTCAATAAGGACCTCTCTGCAGG - Intergenic
1073221232 10:101875946-101875968 TCACATTAGAACTTCTCTTCTGG + Intronic
1074171582 10:110944650-110944672 TCACATTTTGCCCTCTCTTCAGG + Intronic
1075090365 10:119441073-119441095 TCCCATGCAGACCTCTCTTCAGG - Intronic
1076604826 10:131682665-131682687 GCCCACGGGGACCTCTCTTCTGG - Intergenic
1081389539 11:42513514-42513536 TCCCTTAAGGACCTCTCATAAGG + Intergenic
1084783321 11:71425743-71425765 TCCCATCAGCACCTCCCTCCAGG + Intergenic
1087592929 11:100215212-100215234 GCCCATTGGGACATCTATTCTGG - Intronic
1088342664 11:108787009-108787031 TCCCTTTAGGACCTCTTGTAAGG + Intronic
1088501982 11:110491887-110491909 TCCTTTCAGGAACTCTCTTCTGG - Intergenic
1089089208 11:115853563-115853585 TTCCATTATGTCCTCACTTCTGG - Intergenic
1092964215 12:13626143-13626165 TCCAATGAAGACCTGTCTTCTGG + Intronic
1093134967 12:15439250-15439272 TCCCTTAAGGATCTCTCTTAAGG - Intronic
1101368993 12:104107546-104107568 TCCCATTTTGACCTCTATTTAGG - Intergenic
1101788161 12:107904128-107904150 TCCTCTCAGTACCTCTCTTCTGG + Intergenic
1106242425 13:27922014-27922036 TCCCCTCCAGACCTCTCTTCTGG + Intronic
1108115803 13:47126587-47126609 TACCAGAAGGACCTCTCTTCTGG + Intergenic
1108447535 13:50524923-50524945 TCCTCCTAGGACCTTTCTTCTGG - Intronic
1110200039 13:72839178-72839200 TTCCATTATCACCTCTCATCTGG - Intronic
1110540413 13:76701066-76701088 TCCCATCAGGCCCTAACTTCAGG + Intergenic
1115391034 14:32855326-32855348 TTCCTTTAGGAGCTCTTTTCGGG + Intergenic
1118646381 14:67845265-67845287 TCCCTTCAGGACCTCTCGTAAGG + Intronic
1120928903 14:89827453-89827475 TCCCTTTAGGTCCTGTCCTCCGG - Intronic
1121014086 14:90537836-90537858 TCCACTTAGGACCTACCTTCTGG - Exonic
1121574566 14:94973152-94973174 TCCCAGGAGGATGTCTCTTCTGG - Intergenic
1122959553 14:105088210-105088232 TCCCGCCAGGACCTCTCTTCTGG + Intergenic
1123902433 15:24890216-24890238 TCCCATTATGACCTACTTTCAGG - Intronic
1131639918 15:94281721-94281743 TCCCATAAGGACCTCTTATAAGG + Intronic
1132971639 16:2692086-2692108 TGCCAGCAGGATCTCTCTTCAGG + Intronic
1136667596 16:31826118-31826140 TCCCATAAGGACCTCTTGTAAGG - Intergenic
1142064009 16:88049982-88050004 TCCAATTAAGAACCCTCTTCAGG + Intronic
1142966879 17:3587168-3587190 TCCTATCTGGACCTCTCCTCTGG + Intronic
1143246159 17:5487053-5487075 TCCCATTAGGACCTCTCTTCGGG - Intronic
1144255340 17:13462142-13462164 TTCCAGAAGGACCTGTCTTCTGG + Intergenic
1145246681 17:21274143-21274165 TCCCATGAGGACCTCAATTTGGG + Intergenic
1146207096 17:30914255-30914277 TCTATTTAGGACCTCTTTTCTGG + Intronic
1148000129 17:44382978-44383000 TCCCATTCAGATCTCTCTTGTGG + Intronic
1150060911 17:62067453-62067475 TTCCTTTAGTGCCTCTCTTCAGG - Intergenic
1150357437 17:64498676-64498698 TCTCCTGAAGACCTCTCTTCTGG + Intergenic
1150487599 17:65554728-65554750 TCCCATTGGGCCCTCTGCTCTGG - Intronic
1150970977 17:70028130-70028152 TCCTTTAAGGACCTCTTTTCAGG + Intergenic
1151692350 17:75694299-75694321 TCCCAGTAGGGCCTTTCTGCTGG + Intronic
1152431036 17:80248445-80248467 TCCCCTTAGCACCCCTCTCCCGG + Intronic
1152827392 17:82475862-82475884 TCCCAGTAGGACCTCTCATAAGG + Intronic
1153461971 18:5345435-5345457 TCCCTTAAGGACCTCTTTTAAGG - Intergenic
1153493258 18:5671462-5671484 TCCCATTAGGGACTCTCTGAGGG - Intergenic
1155774018 18:29736509-29736531 TCCCTTTAGGACCTCTTGTAAGG + Intergenic
1163631730 19:18421014-18421036 TCCCATGAGGACCTGCCTTGAGG + Intronic
1165398613 19:35583047-35583069 CCCCATTAAGACATCTCTCCTGG + Intergenic
1165680239 19:37768340-37768362 TCCTCTTAGGATCTCTATTCTGG + Intronic
1167415754 19:49370909-49370931 TGCCCTGAGGACATCTCTTCAGG - Intronic
931557526 2:63521038-63521060 TCCCTTTAGGACCTCTTGTAAGG - Intronic
933315120 2:80706145-80706167 TCCCATATGGCCCTCTCCTCTGG - Intergenic
933354419 2:81195591-81195613 TCCCCAGAGGCCCTCTCTTCTGG + Intergenic
933806641 2:86003080-86003102 TGTCATTAGGACCTCCCTTGTGG + Intergenic
933886732 2:86724920-86724942 TCCCATTAGCACCTCTGTGGTGG + Intronic
933923448 2:87071787-87071809 TCCCATTAGCACCTCTGTGGTGG - Intergenic
935194417 2:100803911-100803933 TCCAATGAGCATCTCTCTTCTGG - Intergenic
941308430 2:163898614-163898636 TACCAGTTGGACCTATCTTCAGG - Intergenic
943287836 2:186027119-186027141 TACCCTCAGGATCTCTCTTCAGG + Intergenic
946465477 2:219908323-219908345 TCCCATTAAAACCTCTCCTTTGG - Intergenic
1176905237 21:14492612-14492634 TCACATAAGGACCTCTCTAATGG - Intronic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
949511008 3:4767114-4767136 GCCCAGTACGACTTCTCTTCTGG - Intronic
949798794 3:7880065-7880087 TCCCTTTAGGACCTCTTGTAAGG - Intergenic
950681070 3:14585487-14585509 GCCCATTAGGCCCCCACTTCTGG + Intergenic
954771890 3:52978259-52978281 TCCCTTTAGGCCCTTTCTGCTGG - Intronic
955223940 3:57045738-57045760 TCCCTTTGGGACCTCTGTTTGGG - Intronic
958160641 3:89813479-89813501 TCCCTTAAGGACCTCTTTTAAGG - Intergenic
958817736 3:98934628-98934650 TCCCTTTAGGACTTCTTATCAGG - Intergenic
960700673 3:120436426-120436448 TCCCAGTAGGAACACACTTCAGG - Intronic
962078927 3:132116397-132116419 TCCCTTTAGGACCTCTTGTACGG + Intronic
964405550 3:156344822-156344844 TCCCATTACGTCCTATCTCCAGG + Intronic
965147575 3:164926419-164926441 TCCCTTAAGGACCTCTTTTAAGG + Intergenic
967043050 3:185711586-185711608 TCCCATGTGCACCTCTCTGCTGG - Intronic
969633107 4:8349964-8349986 TCCCATGCTGACCTCACTTCTGG + Intergenic
971709172 4:30089423-30089445 TCCCATAAGGACCTCTTGTAAGG + Intergenic
973534103 4:51863879-51863901 TCCCAGTAGGAAATCTCTTCTGG + Intronic
974662817 4:64916326-64916348 TCCCATAAGCATCTTTCTTCAGG - Intergenic
976640549 4:87333378-87333400 TCCCTTTAGGACCTCTTATAAGG + Intergenic
977501421 4:97843583-97843605 TCCCATTAGCATCTCTCTTCAGG - Intronic
982210847 4:153034546-153034568 TTCCCTTAGGACCTTACTTCAGG + Intergenic
983960629 4:173749124-173749146 TCCCAATCCTACCTCTCTTCTGG - Intergenic
986575805 5:9211632-9211654 TCCCCAAAGCACCTCTCTTCAGG + Intronic
989952781 5:50320199-50320221 TCCCATTAACACCTGTGTTCTGG - Intergenic
992330442 5:75711963-75711985 TCCCATGTAGTCCTCTCTTCAGG - Intronic
994031385 5:95147863-95147885 TCCCTTTAGGACCTCTTGTAAGG + Intronic
996371724 5:122760333-122760355 GCCCATTAGGAAATATCTTCAGG - Intergenic
997193249 5:131959762-131959784 TCCAATTACCACCTCTCATCTGG + Intronic
997846646 5:137292302-137292324 TCCCATTCGAAACTCTCCTCAGG - Intronic
1003817204 6:9854852-9854874 TCCCTTTAGGATCTCTCATAAGG - Intronic
1008432195 6:51432383-51432405 TTCCATCAGGACCTCTGTTGTGG - Intergenic
1009915287 6:69987787-69987809 TTCCATTAGGGGCTCTCTCCAGG - Intronic
1012226125 6:96705089-96705111 TCTGGTTAGTACCTCTCTTCTGG + Intergenic
1022261340 7:28707932-28707954 TCCCATTAAGTCTTCCCTTCCGG + Intronic
1023624748 7:42104857-42104879 TCTGATGAGGACCTGTCTTCTGG - Intronic
1029318739 7:99738361-99738383 TCCAAGTGGTACCTCTCTTCTGG + Intergenic
1031255911 7:119448845-119448867 TCCCATAAGGACCTCTTGTAAGG + Intergenic
1032794862 7:135269185-135269207 TCCCACCAGGAGCTCTCTCCTGG - Intergenic
1034374597 7:150630989-150631011 TCCCATAAGGTTCTCTCTGCTGG + Intronic
1037473702 8:19236799-19236821 TCCCATTGGCAGCTCTCTCCTGG + Intergenic
1038085194 8:24188456-24188478 TCCCACAAGAATCTCTCTTCCGG - Intergenic
1041805443 8:61844160-61844182 TCCCATTTGGACCTCTTATTTGG + Intergenic
1042829613 8:73012151-73012173 TCCCCTTACTCCCTCTCTTCAGG - Intronic
1049044788 8:140140945-140140967 TGCCATTTGGACATCTCCTCGGG - Intronic
1052583398 9:30391358-30391380 TCCCATAAGGACCTCTTGTAAGG - Intergenic
1057694461 9:97313432-97313454 GCCCCTGAGGACCTCTCTGCTGG - Intronic
1187549926 X:20292253-20292275 TCTGCTTAGTACCTCTCTTCTGG + Intergenic
1188844226 X:35053653-35053675 TCCCATTAGAACCTGCCTCCAGG - Intergenic
1191825225 X:65357404-65357426 TGCCATTTGGAGCTCTCCTCTGG - Intergenic
1193316720 X:80073506-80073528 TCCTTTTAGGACCTCTCCTAAGG + Intergenic
1193769600 X:85573292-85573314 TCCCTTCAGGACCTCTTTTAAGG - Intergenic
1198013977 X:132589831-132589853 TCCCATAATTACCTCTTTTCGGG - Intergenic
1198868067 X:141146795-141146817 TCTCTTAAGGACCTCTCTTAAGG + Intergenic
1199559636 X:149149137-149149159 TCCCTTAAGGACCTCTTTTAAGG + Intergenic
1201183580 Y:11374536-11374558 TCCCTTAAGGACCTCTTTTAAGG - Intergenic