ID: 1143251779

View in Genome Browser
Species Human (GRCh38)
Location 17:5528186-5528208
Sequence TCTTCTTGATAGAGTACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143251772_1143251779 4 Left 1143251772 17:5528159-5528181 CCACTGACTCTATTAGCCAGGCC 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1143251779 17:5528186-5528208 TCTTCTTGATAGAGTACCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 128
1143251771_1143251779 5 Left 1143251771 17:5528158-5528180 CCCACTGACTCTATTAGCCAGGC 0: 1
1: 0
2: 0
3: 5
4: 131
Right 1143251779 17:5528186-5528208 TCTTCTTGATAGAGTACCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143251779 Original CRISPR TCTTCTTGATAGAGTACCTG GGG Intronic
908135027 1:61123000-61123022 TCTTCTAGAGAGATTCCCTGTGG + Intronic
909145663 1:71927658-71927680 CCTACTGGATAAAGTACCTGGGG + Intronic
910044286 1:82892662-82892684 TCTTGTAGATAGAGTAACTGAGG + Intergenic
911268894 1:95776554-95776576 TCTTCTTGAAAGAGTCTTTGAGG - Intergenic
915914599 1:159933389-159933411 TTTTCATCATAGTGTACCTGGGG - Intronic
916962888 1:169906981-169907003 TCTTCTTGATCTAGAACCTGTGG + Intergenic
917716386 1:177741941-177741963 TCTTATAGATTGAGAACCTGAGG - Intergenic
918388027 1:184030345-184030367 TCTTCATGATATGGTAACTGGGG + Intronic
918976778 1:191498573-191498595 TCTACCTGATAGAATACATGGGG - Intergenic
919453565 1:197798986-197799008 TCTTCTCCTTAGAGTAACTGTGG + Intergenic
919557690 1:199080584-199080606 TCTTCATGATATAGTGACTGAGG - Intergenic
921508829 1:216007367-216007389 TCTTCTGGACAGAGTGACTGAGG + Intronic
922828658 1:228539156-228539178 CCATCTTGTTAGAATACCTGGGG + Intergenic
1065711670 10:28523929-28523951 TATGCTTGATAGAGTCCCAGAGG + Intergenic
1068140174 10:52996078-52996100 TATTCTTGTTTGAGTCCCTGAGG + Intergenic
1070513471 10:77181967-77181989 TCTTCTTAATATAGTATGTGTGG - Intronic
1074635766 10:115315526-115315548 TGTTCTGGATTGAGAACCTGTGG + Exonic
1076153911 10:128188170-128188192 CCTTCTAAATAGACTACCTGTGG - Intergenic
1078469032 11:11572239-11572261 TCTTCTAGATAAAGAAACTGAGG - Intronic
1081568852 11:44277125-44277147 TCTTCCTCATAGGGTAGCTGTGG + Intronic
1083246761 11:61434546-61434568 TCTCCTTGATGGAGTCCCTAAGG + Intronic
1084598017 11:70128718-70128740 TCTTCTTCAGAGAGGACCGGAGG - Intronic
1084604419 11:70164265-70164287 TCTTCTTGAAAAAGACCCTGTGG + Intronic
1085296337 11:75433825-75433847 TCTTCTGGATAGAATTCTTGGGG - Intergenic
1087712064 11:101566449-101566471 TCATGTTGATAGAATACCTATGG - Intronic
1087799349 11:102487299-102487321 TCTTCATGATATAGTACTTGTGG - Intronic
1087941048 11:104097701-104097723 TCTTCTTCATAGAGTTGGTGCGG - Intronic
1088936979 11:114412103-114412125 TCTGCTTGAAAGACTTCCTGTGG + Intronic
1089296472 11:117471920-117471942 TCTTGTTGAAAGAGTACATGCGG + Exonic
1089855454 11:121540213-121540235 TCTTCCTTTTAGAGTATCTGTGG + Intronic
1091996114 12:4995528-4995550 TTTTCTAGATAGAATAACTGAGG + Intergenic
1094220049 12:27983027-27983049 TCTTCTTGATATAAAGCCTGTGG - Intergenic
1094534916 12:31312656-31312678 TCTTCTGGATACAAGACCTGTGG + Intronic
1095295042 12:40517901-40517923 CCTTCTTGTTAAACTACCTGTGG - Intronic
1103961132 12:124609930-124609952 TCTTCTTGAGGGAGCCCCTGGGG + Intergenic
1106821793 13:33472972-33472994 TACTCCTGATAGAGTTCCTGAGG - Intergenic
1109138549 13:58683538-58683560 TCTGCCTGCTAGAGTCCCTGGGG + Intergenic
1110284793 13:73737089-73737111 TCTTCTTACTAGATTACCTGAGG + Intronic
1110352789 13:74529271-74529293 TCTGCTAGATAGATTGCCTGGGG - Intergenic
1115889338 14:38009942-38009964 TCTCCATTATAGAGTAACTGAGG + Intronic
1116750935 14:48882570-48882592 TCTTCTTGATAAAGTACTGATGG - Intergenic
1117040122 14:51761650-51761672 TATTATTCATAGTGTACCTGAGG + Intergenic
1118750502 14:68804439-68804461 TTTTTTTGATAGATTACTTGGGG + Intergenic
1121585808 14:95062111-95062133 TCTTTTTGATAGGGAAACTGAGG - Intergenic
1121661642 14:95639640-95639662 ACTCCTTGATAGAGTTCTTGGGG - Intergenic
1122749052 14:103919476-103919498 CCTTCTTGTTAGAGTCCCAGTGG - Intronic
1128388924 15:67169770-67169792 CCTTCTTGATAGAGGAACAGAGG + Intronic
1137223009 16:46474057-46474079 TCTTCTTGACAGAGACCCTAAGG - Intergenic
1139061875 16:63263141-63263163 TCCTCTTCTTAGAGTGCCTGTGG + Intergenic
1139151312 16:64385283-64385305 TCTTCCTCATAGAGTATCTTGGG + Intergenic
1139973615 16:70791693-70791715 ACTTCTTGATAAAGTCCTTGAGG + Intronic
1140898172 16:79343858-79343880 TTTTCTTGATAGACAACCTCAGG + Intergenic
1143251779 17:5528186-5528208 TCTTCTTGATAGAGTACCTGGGG + Intronic
1146073450 17:29705445-29705467 TTTTTTTGATACAGCACCTGGGG - Intronic
1152247874 17:79195085-79195107 TCTTCTTGAGAGGCTACCCGTGG - Intronic
1155024136 18:21926038-21926060 TCTTCTTCATAGGGAACCAGGGG + Intergenic
1156434361 18:37111199-37111221 TCTTCTTGATAGCCTGCCTATGG - Intronic
1158680621 18:59563233-59563255 TCTGCTTGTTAGAATACATGTGG + Intronic
1159890620 18:73949784-73949806 TCTTTTTTATAGTGTCCCTGAGG - Intergenic
1163065698 19:14792520-14792542 TCCTCTTCATACAGTAGCTGGGG + Intronic
928361284 2:30664152-30664174 TGTTCTTGAAAGAGTCCTTGTGG + Intergenic
933112701 2:78424153-78424175 TCTTCTTCACAGAGCACCTAAGG + Intergenic
933598256 2:84304234-84304256 TCTTCTTAGTAGAGTTCTTGGGG - Intergenic
936748322 2:115608448-115608470 TCTTCATGACAGAGTACGTTTGG - Intronic
938522632 2:132086615-132086637 TCTTCATTATTGAGTACCTTGGG + Intergenic
940353513 2:152715927-152715949 AAATCTTGATAGAATACCTGAGG + Intronic
942912176 2:181257626-181257648 TCTTCTTGAGAAAGTATCTTTGG + Intergenic
944076713 2:195740765-195740787 TCTTTATGATACAGTGCCTGTGG - Exonic
945370676 2:209013104-209013126 TCTTCTAAATACAGTCCCTGAGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170317949 20:15062893-15062915 TCCTCTTGATGGTGTCCCTGGGG - Intronic
1171080416 20:22176771-22176793 TTTTCTTTATAGATTACCTGAGG + Intergenic
1173090650 20:39967772-39967794 GCTTCTTTACAAAGTACCTGAGG - Intergenic
1173986086 20:47262657-47262679 TGTGCTTAATAGAGTAACTGGGG - Intronic
1174385799 20:50187918-50187940 TCTTCTGGATAGAAGAACTGAGG - Intergenic
1177166425 21:17610377-17610399 TCTTCCTGAAAGAGTACTTTCGG - Intronic
1178974554 21:37209774-37209796 TCTTCTTCATAGGGTACTTGGGG - Intergenic
1179995607 21:44972670-44972692 TCTTCTAAAGAGAGGACCTGGGG + Intronic
1185003040 22:48257741-48257763 TCTTCTTCTTATAGTACGTGGGG + Intergenic
955132031 3:56179627-56179649 GCTTCCTGATAGATTGCCTGAGG + Intronic
956187397 3:66575704-66575726 TCTTTTTCATAGTGTATCTGTGG + Intergenic
964493436 3:157262037-157262059 TCTACTAGAGAAAGTACCTGTGG + Intronic
965807590 3:172558237-172558259 TTTTCTAGATAGAGAAACTGAGG - Intergenic
966501687 3:180649256-180649278 GCTTCCTGAGAGAGTATCTGTGG - Intronic
967995635 3:195164389-195164411 TCTTGTTGATAGACCAACTGGGG - Intronic
972002262 4:34053287-34053309 TCTTCTTAACTGAGTACGTGAGG + Intergenic
973720970 4:53723297-53723319 TCTTTTTGAGAGAGAAACTGAGG + Intronic
973855887 4:55009438-55009460 TCTTCTTAGGTGAGTACCTGGGG - Intergenic
975185741 4:71400117-71400139 TCTTGTTGATGGAGTTCTTGAGG + Intronic
975212219 4:71714081-71714103 TCCTATTTATAGAGTACCAGAGG - Intergenic
982626750 4:157777046-157777068 TCTTGTTGATAAAGTTCCAGGGG - Intergenic
985440917 4:189981913-189981935 TCTTGGTGATGGAGTGCCTGGGG + Intergenic
985489976 5:173474-173496 CCTTCTTGACAGAGTCCATGAGG + Intronic
986977212 5:13408774-13408796 GTTTCTGGCTAGAGTACCTGTGG + Intergenic
987425296 5:17766191-17766213 TCTACTTGTTAGAGCACATGAGG - Intergenic
993062580 5:83057078-83057100 TCCTCTTCATACAGTAGCTGGGG - Exonic
994112855 5:96026466-96026488 GCTTCATGACAGAGTGCCTGTGG - Intergenic
994397588 5:99238352-99238374 TTTTGATGATAGAGTACCTCAGG - Intergenic
994829890 5:104767076-104767098 TCTTCTTTATAGAGAAGCTTGGG + Intergenic
997228349 5:132226362-132226384 TCTTGATAATAGACTACCTGGGG - Intronic
1000067471 5:157707476-157707498 ACCTCTTTATAGGGTACCTGAGG - Intergenic
1000165729 5:158646813-158646835 TCTGCTTGAAAGATCACCTGGGG - Intergenic
1012643999 6:101657057-101657079 TCTTCTTCATAGAGTTCATGTGG + Intronic
1012886192 6:104848939-104848961 TCTTCTTTATAGTGGATCTGGGG - Intronic
1013153739 6:107473042-107473064 TCTTTTTGTAAGAATACCTGAGG - Intergenic
1014087265 6:117361314-117361336 TTTTGTTGATAAAGTACTTGGGG - Intronic
1017038281 6:150286606-150286628 TCCTTTTGATGGAGTACTTGTGG - Intergenic
1021487901 7:21187307-21187329 TCTTCTGCACAGAGTTCCTGAGG + Intergenic
1023210910 7:37804069-37804091 TCTTCTCCATAGAGCAGCTGTGG - Intronic
1024399056 7:48902962-48902984 TGTTCTTGATGGAGTGGCTGAGG + Intergenic
1024720421 7:52130994-52131016 TTTTCTTGATAGTGTTCTTGAGG + Intergenic
1025260547 7:57414960-57414982 TCATCTTGGGAGAGTACTTGGGG - Intergenic
1027193315 7:76010706-76010728 TCTTCTGGGCAGAGTACCTTTGG - Intronic
1030816314 7:114041744-114041766 TCTTTTGGTTAGAGTACATGAGG - Intronic
1030906888 7:115196895-115196917 TCTTCTTCACAGACTTCCTGAGG + Intergenic
1032432783 7:131875607-131875629 TTTTCTGGAGACAGTACCTGGGG - Intergenic
1034001322 7:147416222-147416244 TGTTCTTGAAATAGTCCCTGTGG - Intronic
1044080530 8:87876874-87876896 ACTTCTTGATACCCTACCTGGGG - Intergenic
1044769254 8:95612351-95612373 TGAACTTGAGAGAGTACCTGGGG + Intergenic
1047837758 8:128712769-128712791 TCTTCTGTGTAGAGTCCCTGGGG - Intergenic
1049278090 8:141729976-141729998 TCTTCCAGATAGAGAAGCTGAGG - Intergenic
1050096721 9:2074918-2074940 TCTTAGAGATAGAGTAGCTGGGG - Intronic
1051433229 9:17002127-17002149 TCATCCTGATAGAGTAGGTGAGG + Intergenic
1054912002 9:70463709-70463731 TCTTCTTCACAGATTGCCTGGGG - Intergenic
1055117672 9:72623259-72623281 ACTTTTTGATAGAGGACTTGGGG - Intronic
1055129198 9:72754772-72754794 GCTTCTTCATACAGTACCTCTGG + Exonic
1057043959 9:91869839-91869861 TCTTCTTAAAAAAGTTCCTGAGG - Intronic
1062566859 9:137167399-137167421 TCTTATTTATAGAGCACCGGGGG + Intronic
1187982161 X:24769362-24769384 TCTTCTTGAAAATGAACCTGAGG + Intronic
1188631860 X:32373301-32373323 TCTTCTTGAATGAGTATCAGAGG - Intronic
1189365224 X:40383047-40383069 TCTTCTTAAAATAGTAGCTGGGG + Intergenic
1191231735 X:58101426-58101448 TCTTTTTGTTAGAATTCCTGGGG - Intergenic
1193364023 X:80608872-80608894 TCTTCTCTGTAGGGTACCTGTGG - Intergenic
1194074054 X:89366526-89366548 TGTTCTTGAAAGAGTACTTATGG + Intergenic
1195056901 X:101155081-101155103 TTTTTTTGACATAGTACCTGAGG - Intronic
1195114950 X:101687948-101687970 TTTTCCTTATAGAGTAACTGTGG - Intergenic
1198055063 X:132985706-132985728 TCTTCCTATTACAGTACCTGAGG - Intergenic