ID: 1143253516

View in Genome Browser
Species Human (GRCh38)
Location 17:5539375-5539397
Sequence CCTTCTGGGCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 507}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143253516_1143253534 20 Left 1143253516 17:5539375-5539397 CCCTCTTCCCTCTGCCCAGAAGG 0: 1
1: 0
2: 3
3: 48
4: 507
Right 1143253534 17:5539418-5539440 AGGCGTATGAGTTTGCAGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 89
1143253516_1143253526 0 Left 1143253516 17:5539375-5539397 CCCTCTTCCCTCTGCCCAGAAGG 0: 1
1: 0
2: 3
3: 48
4: 507
Right 1143253526 17:5539398-5539420 GACCCACAGGGCCTTACCCCAGG 0: 1
1: 0
2: 1
3: 20
4: 174
1143253516_1143253531 16 Left 1143253516 17:5539375-5539397 CCCTCTTCCCTCTGCCCAGAAGG 0: 1
1: 0
2: 3
3: 48
4: 507
Right 1143253531 17:5539414-5539436 CCCCAGGCGTATGAGTTTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143253516 Original CRISPR CCTTCTGGGCAGAGGGAAGA GGG (reversed) Intronic
900764370 1:4494233-4494255 CCTTCTGGTCAGAGGCCAGTGGG - Intergenic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
901049054 1:6417141-6417163 CCCTCTGGGCACAGGGAGGTGGG + Exonic
901221857 1:7587935-7587957 CCATCTGGGCCGAGGGAGGCGGG - Intronic
901236815 1:7671641-7671663 TTTTCTGGGCACAGGGTAGATGG - Intronic
901646688 1:10720702-10720724 CCATCTGGGGAGAGGGAGGACGG + Intronic
901837517 1:11934139-11934161 CCTTTTGGGGAGAGTGGAGACGG + Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902118254 1:14139678-14139700 CCTGCTGGGCACTGGGTAGAAGG - Intergenic
902482014 1:16717063-16717085 CATTCAGGGCAGAGTGAGGAGGG - Intergenic
902659244 1:17889976-17889998 CCTTCTGGGCAGAAAGAAGTGGG + Intergenic
903189859 1:21650534-21650556 CCTCCTGCCCAGAGGTAAGAAGG + Intronic
903261965 1:22136379-22136401 CCTGCTGGGCTGAGGGAACCTGG + Intronic
903271372 1:22190452-22190474 GCATCTGGGCAGATGGAGGACGG + Intergenic
903541748 1:24100369-24100391 CCTTCTGGGGGCAGAGAAGAGGG + Intronic
904093770 1:27962080-27962102 ACTTCTGGGCACAGGCCAGATGG - Intronic
904492967 1:30871634-30871656 CCTGCCAGGCAGAGGGCAGAGGG + Intronic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
904677411 1:32206864-32206886 CTATCCCGGCAGAGGGAAGACGG - Intronic
905267198 1:36762822-36762844 CATTCTAGGCAGAGGGAACAGGG + Intergenic
906253079 1:44326318-44326340 CCTCCTGGCCACAGGGAAGAGGG + Intronic
907422541 1:54357007-54357029 TCTTCTGGGTGGAGGGAACAGGG + Intronic
907443654 1:54493590-54493612 CCTGCTGGGTAGAGGGAATGTGG - Intergenic
907459133 1:54594759-54594781 CCCACTGGGCAGAGGCAGGAAGG + Intronic
908167333 1:61471423-61471445 TGTTCTGGGCATTGGGAAGAGGG - Intergenic
908513896 1:64873060-64873082 CCTTATGTGCAGAGGTCAGAGGG - Intronic
908590919 1:65632282-65632304 ATTTCTGGGCATAGGGGAGATGG - Intronic
908787418 1:67749024-67749046 CCTCCAGGGGAGTGGGAAGAGGG - Intronic
909070567 1:70988535-70988557 CCTTCTGGTCAGTAGGAAGGAGG - Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
910457794 1:87416185-87416207 CTTTCAGGGCAGAGGAAACAAGG - Intergenic
910482317 1:87672406-87672428 CCTACAGGGTAGAGAGAAGAGGG + Intergenic
910986880 1:93013914-93013936 AGTTCAGGCCAGAGGGAAGATGG - Intergenic
912056098 1:105599711-105599733 CCTTTTGGGCAAAGGACAGACGG - Intergenic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912735324 1:112145097-112145119 CCAGCTGGGCAGGGGGAGGATGG + Intergenic
915014312 1:152719075-152719097 TTGTCTGGGCAGAAGGAAGAAGG + Intergenic
915300857 1:154950901-154950923 GGGCCTGGGCAGAGGGAAGATGG - Intronic
915624676 1:157107335-157107357 ACTACTGGGCAGAGGGAGGCAGG - Intergenic
915837252 1:159187827-159187849 CCTTCTGTGCACATGGAGGATGG - Intronic
917056316 1:170985790-170985812 CCCACTGGGCAGAGGGGTGATGG - Intronic
918086602 1:181250762-181250784 CCTTCTGAGCAGAGGTATAAGGG - Intergenic
918106417 1:181419208-181419230 CTGGCTGGGCAGGGGGAAGAGGG - Intronic
918132735 1:181643789-181643811 CATTCTTGGCAGCGGGGAGATGG + Intronic
918302134 1:183214237-183214259 CATGCTGGGCAGTGGGAATACGG + Intronic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
918894123 1:190317471-190317493 CCCTTTGGCAAGAGGGAAGAAGG - Intronic
919186251 1:194154464-194154486 CATTTTGGGCTGAGGGAATACGG + Intergenic
919767892 1:201139105-201139127 GCTTCTGGGCAGACTGAAGAGGG - Intronic
919946580 1:202323443-202323465 CCTTCTCAGGGGAGGGAAGATGG + Intergenic
920250065 1:204617557-204617579 GCCTCTGGGCAGAGAGAAGATGG + Exonic
920517937 1:206600300-206600322 CCTTCGGGGCTGATGGCAGATGG + Exonic
922217257 1:223530251-223530273 CCTTGTGGACAAAGGAAAGACGG + Intergenic
922568237 1:226616081-226616103 GCTTCTGCACAGAGGGGAGAGGG + Intergenic
922718971 1:227890701-227890723 CCTCCAGGGCAGAAAGAAGAGGG + Intergenic
922955201 1:229593859-229593881 CCTTGTTGGCAGAGGGATGTGGG - Exonic
923017926 1:230141228-230141250 CCTTCTGCGCAGTGTTAAGATGG - Intronic
923107519 1:230866100-230866122 GCTCCTGGGCACAGGGATGATGG - Intronic
1063472605 10:6300251-6300273 CCTTGTGGGCAAAGGCAGGAAGG - Intergenic
1064179529 10:13102165-13102187 CATTTCGGGCAGAGGGCAGAAGG + Intronic
1064918267 10:20486679-20486701 CTTACTGGCCAGAGAGAAGAGGG + Intergenic
1065479448 10:26177648-26177670 TCTTCTGGGCAGAGGTCAGCAGG - Intronic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1068923357 10:62509581-62509603 GCTTCTGGGTAGGGAGAAGAAGG - Intronic
1069680748 10:70283730-70283752 CCTTCGGGCCAGCGGGCAGAGGG + Intergenic
1070159697 10:73858709-73858731 CATTCTGAGCCGAGGGCAGATGG + Intronic
1070652232 10:78245698-78245720 GCTCCCTGGCAGAGGGAAGAAGG + Intergenic
1070746343 10:78936161-78936183 CCTTCTGGGCAAATGGAAGAGGG - Intergenic
1070931609 10:80264905-80264927 CCTTCCAGGCAGAGAGAACAGGG - Intergenic
1070972890 10:80582164-80582186 TCTTCTGGCCAGAGGGAGGGAGG - Intronic
1071443469 10:85725022-85725044 CCTTCTTGGTGGAGGGTAGAGGG - Intronic
1071970128 10:90896678-90896700 CCTTCTGGTGAGGGAGAAGAAGG - Intronic
1072041974 10:91615271-91615293 ACTTCTGGGTAGAGGGATGGAGG - Intergenic
1072307548 10:94121934-94121956 CCAGCTGGGCAGAGAGAGGAAGG + Intronic
1072335165 10:94391396-94391418 CTTTATGGGCAGTAGGAAGAAGG - Intergenic
1073265570 10:102226415-102226437 ACTCCTGGGCAAAGGGAGGAGGG - Exonic
1073311937 10:102549130-102549152 CCTTGTGGGCAGAGTGGAGGTGG + Intronic
1073570294 10:104575681-104575703 CCTACTGGAGAGAGAGAAGAGGG + Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074115944 10:110457665-110457687 CCACCTGGGGACAGGGAAGAGGG - Intergenic
1074689331 10:115990301-115990323 CTTTCTGAGCAGAGGGCAGAGGG + Intergenic
1074956012 10:118390564-118390586 CCATTTGGGGAGAAGGAAGAAGG - Intergenic
1075077928 10:119363682-119363704 GCCTCTGGGAAGAGGGAAGCTGG + Intronic
1075086897 10:119419707-119419729 CCTTCTCAGCAGATGGGAGAAGG - Intronic
1075303548 10:121347224-121347246 CCTCCTGGGTAGAGGGAATGAGG - Intergenic
1075660769 10:124194022-124194044 TCTTTTGAGCAGAAGGAAGAAGG + Intergenic
1075726555 10:124613546-124613568 CATGCAGGGCAGAGGGCAGAAGG - Exonic
1076677021 10:132152407-132152429 CCTTCTGGGTAGAGTGATTATGG - Intronic
1077526337 11:3067903-3067925 CCTTCTGGGGAGGGGTAGGATGG + Intergenic
1078004700 11:7523791-7523813 CCTCCTGGGAATAGGGAAGGAGG + Intronic
1078105760 11:8357079-8357101 CCTGCCGGGAGGAGGGAAGAGGG - Intergenic
1079990268 11:27239337-27239359 CCTTCTGGGGAGAGGGTAACGGG - Intergenic
1080007302 11:27423461-27423483 CCATCAGAGCAGAGGGGAGAAGG - Intronic
1080425621 11:32151452-32151474 CCTTCTGGCCACAGAAAAGAAGG + Intergenic
1080462857 11:32471027-32471049 GATTCTGGACAGTGGGAAGATGG - Intergenic
1080678814 11:34453937-34453959 CCTTTGGGGCAGAGGGTACAAGG + Intronic
1080691972 11:34565877-34565899 CCTGGTGGGCACAGGGAAGAGGG + Intergenic
1080886873 11:36376174-36376196 CCTGCTGGGGAGAGCGGAGAGGG - Intronic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1082114168 11:48309709-48309731 CATGCTGGGTTGAGGGAAGAGGG + Intergenic
1082657053 11:55868998-55869020 CCTTCTGAGCAAAGAGAAGGGGG + Intergenic
1082828242 11:57597170-57597192 CCTACAGGGCACAGGGGAGATGG + Intergenic
1082849574 11:57753286-57753308 ACTTGAGGGCTGAGGGAAGATGG + Intronic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083421229 11:62554403-62554425 AGTTCAGGGCTGAGGGAAGAAGG - Intronic
1083439951 11:62669577-62669599 TGTTCTGGGCAGAGCCAAGATGG - Intronic
1083687292 11:64384242-64384264 CCTCCTAGGCAGAGGGCAGGAGG + Intergenic
1083770485 11:64864289-64864311 CCTTCTGGGCACAGGGAACCTGG - Intronic
1084043299 11:66555111-66555133 CCAGCTGGACAGAGAGAAGAGGG - Exonic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1084668622 11:70592210-70592232 CCCTGCGTGCAGAGGGAAGACGG - Intronic
1087118395 11:94546616-94546638 TTTTCTGGGAAGAGGGAAAAAGG - Exonic
1087177413 11:95108349-95108371 CCTTCCTGGCTGTGGGAAGAAGG - Intronic
1089560725 11:119341833-119341855 TCTTCTGGGTGGAGGGAAGGAGG - Intronic
1089612890 11:119679446-119679468 CCAGCTAGGCAGAGGGAAGTGGG + Intronic
1089615278 11:119691580-119691602 CCTTCTGGGCACTGGGGAAAGGG - Intronic
1089713606 11:120336106-120336128 CCTACGGGGCAGAGGGAGGTGGG - Intergenic
1090185154 11:124734042-124734064 ACCTCTGGGCAGAAGGAAGGGGG - Intergenic
1090396922 11:126425105-126425127 CCTTATGCGGGGAGGGAAGAGGG + Intronic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1091135435 11:133184469-133184491 CCTTCCGTGGGGAGGGAAGAAGG + Intronic
1091239949 11:134045710-134045732 CCCTCTGGGAATAGGCAAGAAGG + Intergenic
1091255051 11:134176383-134176405 CCTCCTGTGCAGAGAGAAGCCGG + Exonic
1091381738 12:66576-66598 CCTGCAGGGCAGAGAGGAGAGGG - Intergenic
1091712771 12:2753356-2753378 CCCGCTGGGCAGAGAGGAGAGGG + Intergenic
1092025059 12:5233091-5233113 CCTCCTTGCAAGAGGGAAGAGGG - Intergenic
1092108990 12:5945636-5945658 CCTTTGGGGCGGCGGGAAGAAGG - Intronic
1092935697 12:13362139-13362161 ACTTCTGGGCTGAGGGAAAGTGG + Intergenic
1093056152 12:14557679-14557701 ACTTCAGGGTGGAGGGAAGAAGG + Intronic
1093436437 12:19140151-19140173 CCGTCTGGGGAGTGGGATGATGG + Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094046106 12:26168641-26168663 CATTCTGGGCAGCAGGAAGAAGG + Intronic
1096241846 12:49963828-49963850 ACCTCTGGGCTGAGGAAAGATGG + Intronic
1096744337 12:53715694-53715716 CCCTCTGGGAGGAGAGAAGAGGG - Intronic
1097234044 12:57527909-57527931 CCAACTGGCCAGAGAGAAGAGGG - Exonic
1099997325 12:89793247-89793269 CCACCTGGGCTGAGGGAAAAAGG - Intergenic
1100390002 12:94139903-94139925 TCTTGTGGGCAGGGGCAAGATGG + Intergenic
1100685969 12:96986071-96986093 CCTTTGGGGAAGAGGGAGGAAGG + Intergenic
1100857208 12:98768059-98768081 CCTTCTGGGCAGTGAGAACTTGG - Intronic
1101330415 12:103753332-103753354 CCTTCTGGGCATAGGAGAGCTGG - Exonic
1101412318 12:104479873-104479895 CCTTCCTGCCAGTGGGAAGAGGG + Intronic
1101842553 12:108339030-108339052 CCTTCCGGGCAGAGACCAGAGGG - Exonic
1102655828 12:114481437-114481459 GCTTGTGGGCTGAGGAAAGATGG + Intergenic
1102880187 12:116479014-116479036 CTTTCTGGGCAGAGGGGTTATGG + Intergenic
1103214893 12:119194407-119194429 ACATCTGGGCAGAGGGCAGAAGG - Exonic
1103302248 12:119937049-119937071 CCCTCTAGGCTGAGGGAACAGGG - Intergenic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1104636186 12:130439011-130439033 CGGTCCGGGCAGAGGGTAGAGGG - Intronic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1105557645 13:21461305-21461327 CCTTCTCGGCAGAAGGCAAAGGG - Intergenic
1105777882 13:23679981-23680003 CCTTCTGGGGACAGTGAGGAGGG + Intergenic
1106305163 13:28503315-28503337 CCTTCTGTGAAGAGGCCAGAAGG - Intergenic
1106328254 13:28715417-28715439 CCTCTTGGACTGAGGGAAGACGG - Intronic
1107200395 13:37708879-37708901 CCTTCTCGGCAGGTTGAAGATGG + Intronic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1107784287 13:43939180-43939202 TCTTCTGGGCTGAGGCCAGATGG - Intergenic
1107918612 13:45179502-45179524 CCTTCAGGGCAGTGATAAGAAGG - Intronic
1108027310 13:46191466-46191488 CCTTCTGGGCACAGGCTAGGAGG + Intronic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1108335509 13:49437410-49437432 GCTTCTGGGGAAAGGAAAGAGGG - Intronic
1109198626 13:59407002-59407024 ACTTGAGGGCAGAGGGTAGAAGG - Intergenic
1109239558 13:59868722-59868744 GGTTCTGAGGAGAGGGAAGAAGG - Intronic
1109372743 13:61445284-61445306 CCTTCTGGGTAGAGGGTTGGAGG + Intergenic
1109821627 13:67664629-67664651 CCTGAAGGGCAGAGAGAAGAGGG + Intergenic
1110289315 13:73785877-73785899 CCTTCTGGGCAGATAGCGGAAGG + Intronic
1110543882 13:76735447-76735469 TGTTCTGGGCAGTGGGATGAAGG - Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1112214170 13:97413002-97413024 TCTTCTAGGCAGAAGGAACATGG - Intergenic
1112430504 13:99346568-99346590 CATTCTGGGCAGAGAGGAAAGGG - Intronic
1112569374 13:100580005-100580027 CCTTCAGCGCTGAGGAAAGAGGG + Intronic
1113010642 13:105761857-105761879 CCTTCTGGGCTGAGGAGAGCTGG + Intergenic
1113422960 13:110184214-110184236 GCTTCTGGGGAGGGGGAACAGGG - Intronic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1113800285 13:113082869-113082891 CCTGCTGGGCAGGTGGAAGCCGG + Intronic
1115541983 14:34429362-34429384 TCTTCTGGGCAGATAGAAAAAGG - Intronic
1117561642 14:56946483-56946505 ACTGCTGGGAAGAGGGAAGCAGG - Intergenic
1118708800 14:68503034-68503056 GCTTCAGGTCAGAGGGAGGAGGG - Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119389518 14:74281528-74281550 GCCTCTGGGCAGAGGAAGGAGGG - Intergenic
1119423983 14:74524216-74524238 CCTGCTGAGCAGAGGCCAGAAGG + Intronic
1121291215 14:92777140-92777162 CCTTCTGCCCAGAGGCAAGAAGG - Intergenic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1121876849 14:97460680-97460702 CCTTCAGGGCAGAGAGAAGATGG + Intergenic
1122294821 14:100699455-100699477 CCTGGTGGCCAGTGGGAAGAGGG + Intergenic
1124216648 15:27812979-27813001 CCTCCTGGGGAGGGGGCAGAAGG - Intronic
1124475051 15:30025914-30025936 CCTTTCAGGCAGAGGAAAGATGG + Intergenic
1124503857 15:30254985-30255007 CCTTCTGGGCAAGAGGATGAGGG + Intergenic
1124739697 15:32283653-32283675 CCTTCTGGGCAAGAGGATGAGGG - Intergenic
1124983677 15:34584812-34584834 CCCTCAGGGCAGCAGGAAGATGG - Intronic
1125728333 15:41879496-41879518 CCACCTGGGCAGAGGGTACAAGG + Exonic
1126800436 15:52293197-52293219 CCCTGTGGGAACAGGGAAGAGGG - Intronic
1127958355 15:63872193-63872215 CTGGCTGGGGAGAGGGAAGAAGG + Intergenic
1127960464 15:63886795-63886817 CCTACTGGGGAGTGGGCAGAAGG - Intergenic
1128609922 15:69065268-69065290 CTTTAGGGGCAGAGGGCAGAAGG + Intergenic
1129107661 15:73320566-73320588 CCATCTGGGAGGAGGGAGGATGG + Exonic
1129170941 15:73807464-73807486 CCAGCAGGGCAGAGGGAACATGG - Intergenic
1129296819 15:74604335-74604357 CCCTGTGGGCAGAGGGGAGGTGG + Intronic
1130383721 15:83393585-83393607 CTTTCTGGGAAGATGAAAGATGG - Intergenic
1130709338 15:86264413-86264435 CCTTCTGTGCAGGGTGAAGACGG + Exonic
1131532158 15:93203031-93203053 CCTCTTGGGCAGAGAGAAGAAGG - Intergenic
1131965775 15:97840754-97840776 ACTGGTGGGCAAAGGGAAGAGGG + Intergenic
1132467586 16:84595-84617 CCTGCAGGGCAGAGGGAATTCGG + Intronic
1132864254 16:2085807-2085829 GCTTCTGAGCAGAGGGCACATGG + Intronic
1133233043 16:4375257-4375279 CCTCCTGGGTGGAGGGAGGAGGG + Intronic
1133465175 16:6020775-6020797 CCTCCTGGGCGGTGGGGAGATGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133752358 16:8734827-8734849 TGTTCTGGGGAGAGGGAACAGGG + Intronic
1133791659 16:9013689-9013711 CCATCTGGGCAGTAGGAATAAGG + Intergenic
1133877983 16:9752694-9752716 CCTTATGGCAAGAGGGAAAAGGG - Intergenic
1134100324 16:11447407-11447429 TCTTCTGGGCACATGGAAAATGG - Intronic
1134332190 16:13261177-13261199 CCTCATGGGCATAGGCAAGATGG - Intergenic
1135671141 16:24376623-24376645 CATGGTGGGGAGAGGGAAGAAGG - Intergenic
1135718529 16:24794398-24794420 CCTTCTGTGCAGATGCAGGAAGG + Intronic
1136298956 16:29320572-29320594 AGTTCAGGGCAGAGGGAAGTTGG + Intergenic
1138781675 16:59796116-59796138 CCATCTGAGCAGAGACAAGAAGG - Intergenic
1139390951 16:66605835-66605857 CACTCAGGGCAGAGGGCAGAAGG + Intronic
1139591841 16:67937323-67937345 CCCTCTTGAGAGAGGGAAGATGG - Intergenic
1140456379 16:75107921-75107943 CCTCCTGGGCTGAGGGGTGAGGG - Exonic
1140897872 16:79341021-79341043 CCTTCCAGGCAGAGGGACAAAGG + Intergenic
1141015589 16:80446279-80446301 CCTTCTGGCGAGAGGGGTGAAGG - Intergenic
1141723170 16:85768113-85768135 ACACCTGGGCAGAGGGAAGCAGG - Intergenic
1142020777 16:87780876-87780898 ACTTGTGGGCAGAGGGAGGAAGG - Intergenic
1142131238 16:88432480-88432502 CTTCCTGGGCACAGGGGAGAAGG - Exonic
1142183058 16:88681044-88681066 CGGTCTGGGCTGGGGGAAGAGGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142899737 17:3004538-3004560 ACCTCTGTGCAGAGGGAAGGCGG + Intronic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143365453 17:6405622-6405644 GCTTGTGGGCAGAGGGAAGGAGG - Intronic
1143662857 17:8337709-8337731 CCTTCTGGCCTGAGTGATGAAGG + Intergenic
1144232321 17:13220478-13220500 GCTTCTGGGAAGAGGGAGGCTGG + Intergenic
1144658994 17:17056319-17056341 CATTCATGGCAAAGGGAAGAGGG - Intronic
1145921655 17:28614323-28614345 GCTTCAGGGCAGAGGAAGGAAGG + Intergenic
1146658810 17:34651221-34651243 ACTACTGGGAAGATGGAAGATGG - Intergenic
1146929837 17:36769131-36769153 CCTTATGGCCAGAGGGAATCTGG + Intergenic
1147141785 17:38464567-38464589 CTTCCTGGGGAGAGGGAGGAAGG + Intronic
1148336969 17:46848452-46848474 CCCACAGGGCAGAGGGAAGGTGG + Intronic
1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG + Intergenic
1148841662 17:50502680-50502702 CCTTCTGCCCAGAGCGAGGATGG + Intergenic
1149219014 17:54393155-54393177 CCTTCTTGGCTGGGGGCAGAGGG + Intergenic
1150584519 17:66505317-66505339 ACCTCTGGCCACAGGGAAGAGGG + Intronic
1151855899 17:76721649-76721671 CCCTCTGGGTAGAGGAGAGAGGG - Intronic
1151996242 17:77611098-77611120 CCTTCTCGGTGGAGGGAGGATGG - Intergenic
1152188602 17:78874429-78874451 TTTTCTGGGCTGAGGGCAGAGGG + Intronic
1152512822 17:80801970-80801992 CCCCACGGGCAGAGGGAAGACGG + Intronic
1152607775 17:81301681-81301703 CCGTCTGGGAAGAGGGATGGAGG + Intergenic
1153820640 18:8828657-8828679 CCATCTGCCCAGAGAGAAGAAGG - Intronic
1153820643 18:8828664-8828686 CTCTCTGGGCAGATGGCAGAGGG + Intronic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1154499452 18:14987975-14987997 CCTGCAGGGCAGAGGGGAGGTGG + Intergenic
1155064218 18:22254791-22254813 CCACCTGGAAAGAGGGAAGAAGG - Intergenic
1155911908 18:31513690-31513712 TCCTCAGGGCAGAGGGAAGCGGG - Intronic
1157423439 18:47564921-47564943 CCTGATGGGCAGAGGACAGAGGG + Intergenic
1157424183 18:47570848-47570870 CCTTCTGGGAAGAGGGTACCCGG - Intergenic
1158695206 18:59697416-59697438 CCTGCCGGGAAGAGGGAAGGCGG - Intergenic
1160152535 18:76406082-76406104 CCTTCAGGGCAGATGGCACACGG + Intronic
1160507948 18:79437685-79437707 CCGTCAGGGCAGAGGGTGGAGGG - Intronic
1160588195 18:79924406-79924428 CCGTCGGGGCTGGGGGAAGACGG + Intronic
1160816875 19:1040150-1040172 GCTGCTGGGCGGAGGGAAGGCGG + Exonic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1160988684 19:1851887-1851909 CCTAGTGGGAATAGGGAAGAGGG - Intergenic
1161274929 19:3410584-3410606 CCTTGTGGGCCACGGGAAGAAGG + Intronic
1161614260 19:5261170-5261192 CCCTCTGGGCTGAGGGAGGGAGG + Intronic
1162100958 19:8338372-8338394 CCTGCTGGGCAGGAGGAAGCAGG + Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1162566577 19:11448211-11448233 CCTCCTGGGCAGCTGGGAGAGGG - Exonic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1163631008 19:18417847-18417869 CCTTCTGGCCGGCGGGAAGTCGG - Intergenic
1163823281 19:19508449-19508471 GCTTCAGGGCAGAGGGAATGAGG + Exonic
1163832060 19:19551795-19551817 GCTTCTAGGCAGAGGGATGTTGG + Intergenic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1164428963 19:28170102-28170124 CCTCCTGGGCAATGGGAGGAGGG - Intergenic
1164814136 19:31181408-31181430 CCATCTGAGCAGAGAGAAGAAGG + Intergenic
1164832291 19:31331919-31331941 TCTTCTGGGCAGGGGCAAGGAGG + Intronic
1165093594 19:33398871-33398893 CCTTGTGGGTAAAAGGAAGAGGG - Intronic
1165233133 19:34399889-34399911 CCTTCTTGGCAGAGTGGAGCTGG + Exonic
1165554605 19:36619313-36619335 CCTTTTGGGCTGAGTGAAGGGGG + Intronic
1166316374 19:41992096-41992118 ACTCCTGGTCTGAGGGAAGAGGG + Intronic
1166966483 19:46532155-46532177 CCTGCTGTGCAGTGGGAAGTAGG - Intronic
1167738521 19:51311227-51311249 ACTCCTGGGCTGAGGGAGGAGGG + Intergenic
1168168478 19:54571468-54571490 CCCTCTGGGCTGGGTGAAGAGGG - Intergenic
1168250185 19:55137481-55137503 ACTCCTGGGCTGAGGGAGGAGGG - Intronic
1168250270 19:55137732-55137754 ACTCCTGGGCTGAGGGAGGAGGG - Intronic
1168305690 19:55433788-55433810 CCTTCTCGGCTGCGGGGAGAGGG + Exonic
1168497831 19:56869127-56869149 CCTTCTGACAACAGGGAAGAAGG + Intergenic
1168510256 19:56968160-56968182 TCTTCTGGGAAGAGAGAATAAGG - Intergenic
1168595864 19:57676236-57676258 CCTGCTGTTCAGAGAGAAGAAGG + Exonic
1168623451 19:57897532-57897554 TCTTTTGGGAAAAGGGAAGAGGG + Intronic
925053476 2:835559-835581 GGTTATGGGCAGAGGGAGGAAGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
927266930 2:21162286-21162308 GCTCCTGGGCAGAAGGAAGGAGG - Intergenic
928016569 2:27663446-27663468 CGTTCAGGGCAGCCGGAAGACGG + Exonic
928312403 2:30221781-30221803 CCTTCTGTACACAGGGAAGCGGG - Intergenic
928410093 2:31048140-31048162 CCTTCTGGGCTCAGGGCAAATGG - Intronic
928472592 2:31589444-31589466 GCATCCGGGCAGAGGGGAGAAGG - Intergenic
929031328 2:37652295-37652317 CGTTCTGCCCAGAAGGAAGAAGG + Intronic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929486086 2:42356134-42356156 CATTCTAGGCAGAGGGAACATGG - Intronic
930909071 2:56608460-56608482 CATTATGGGCAGGAGGAAGAGGG - Intergenic
932965859 2:76473872-76473894 CCTTCTGGGCAGAGCAATGGAGG + Intergenic
933007199 2:77010704-77010726 CATCCTGGGCAGAGAAAAGAAGG - Intronic
933130978 2:78673716-78673738 CCATCTGGAAAGAGGGAAGCAGG + Intergenic
933390347 2:81658785-81658807 CCTACTGGTCAGAAGCAAGATGG + Intergenic
933804465 2:85988027-85988049 ACTGCCGGGCAGAGGGAGGATGG + Intergenic
935673382 2:105574125-105574147 CCTGCAGAGCAGAGGGAAGGTGG - Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
937631425 2:124106412-124106434 ACCTCTGGGCAGAGGAAAGAGGG + Intronic
938172244 2:129089490-129089512 CCTTCAGGGCAAAGTGAGGAGGG + Intergenic
938320589 2:130359677-130359699 CCTTGTGGGAGGAGGGAGGAGGG + Intronic
938401617 2:130997209-130997231 CCTTGTGGGGAAAGGGAAGCTGG - Intronic
938498656 2:131818343-131818365 CCTGCAGGGCAGAGGGGAGGTGG + Intergenic
939308330 2:140437797-140437819 ACTTCAGGACAGTGGGAAGAAGG + Intronic
939994324 2:148906125-148906147 CCTTGGGGCCAGAGGGAAAAAGG + Intronic
940042616 2:149376409-149376431 CCTACTGAGCAGAGTTAAGAAGG - Intronic
941917055 2:170819949-170819971 CCTCCTGGGTGGCGGGAAGAGGG - Intronic
942089904 2:172479837-172479859 AGTGCTGGGCAAAGGGAAGAGGG + Intronic
942588622 2:177515468-177515490 ACTTGGGGGCAGAAGGAAGAAGG - Intronic
943327136 2:186514352-186514374 CCTTCTTGGAAGAGAGAACAGGG - Intergenic
944417328 2:199491890-199491912 CCTTCTGGACAGAAAGAAGCGGG - Intergenic
945874942 2:215268127-215268149 CCCTCAGGTCAGAGGGAAGCTGG - Intergenic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946175695 2:217920942-217920964 ACTTCCAGACAGAGGGAAGAAGG + Intronic
946406366 2:219493999-219494021 TCTTCTGGGGAGAGTGAACAAGG - Intronic
946595634 2:221302957-221302979 CATTCTAGGCAGAGGGGACATGG - Intergenic
947393636 2:229665757-229665779 CCATCTTTGCATAGGGAAGAAGG + Intronic
947529421 2:230899285-230899307 CCTTATGGGGAGATGGGAGAGGG - Intergenic
947889282 2:233602813-233602835 CTTTCTGGGCAGAGGGCATTTGG + Intergenic
948494311 2:238337020-238337042 CCTTCTGGCCAGGGTGGAGAGGG + Intronic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169678238 20:8179527-8179549 GCTTTTGGGCAGAGGCAATAGGG + Intronic
1170756673 20:19212067-19212089 CCTTCTGTGCCAGGGGAAGAGGG - Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1171388015 20:24783163-24783185 CCACCTGGGCAGGGGGAAGGAGG - Intergenic
1171974924 20:31588154-31588176 CCTTCTGGGGAGAAGCAGGAGGG - Intergenic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1172906277 20:38372169-38372191 CTTTCTGGAAAGAGGGAAGGAGG + Intronic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1173048523 20:39536341-39536363 CCTTTTGTGCAAAGGGAAGGTGG + Intergenic
1173328154 20:42052266-42052288 GCTTCTGAGCACAGGGCAGATGG + Intergenic
1173741668 20:45406429-45406451 CCGGCTGGGCGGAGGGAGGAAGG + Intronic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174298785 20:49567840-49567862 CCTTCTTGGCAGGGGGAGCACGG + Intronic
1175373525 20:58509122-58509144 TGTTCCAGGCAGAGGGAAGAGGG + Intronic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175924331 20:62464661-62464683 CCTTCTGGACAGACGGCAGTCGG - Exonic
1176042202 20:63071852-63071874 CCTTGTGGGCGGAGCTAAGAGGG - Intergenic
1176120040 20:63450212-63450234 CCTCCGGAGCAGTGGGAAGAGGG - Intronic
1176283468 20:64328257-64328279 CCTGCAGGGCAGAGAGGAGAGGG + Intergenic
1177459222 21:21388393-21388415 CATTCCAGGCAGAGGGAACAAGG + Intronic
1177459993 21:21397303-21397325 CCTTCTGGGCAGAAAGCTGAGGG - Intronic
1179093774 21:38293218-38293240 CCTTCTGGTAAGTGGGAAGAAGG - Intronic
1179487178 21:41717763-41717785 CCTGCTTGGCAGAGAGAAAAGGG + Intergenic
1179578272 21:42321277-42321299 CTTTCTGGTGTGAGGGAAGAGGG + Intergenic
1180069940 21:45431220-45431242 CCTTCTGGGCCAAGGACAGAGGG + Intronic
1180245655 21:46545760-46545782 CCTGCTGGCCAGGGGGAAAAAGG - Intronic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1181885621 22:26019993-26020015 CCTACTGGGCAGAAGGCTGACGG - Intronic
1182379193 22:29872631-29872653 AGTTCTGGGCAGAAGGGAGAAGG + Intergenic
1183992633 22:41608577-41608599 CCTGCAGGGCAGAGTGAAGGGGG + Intronic
1184035687 22:41917091-41917113 CCTCCAGGGCAGTGGGCAGAGGG - Intergenic
1184931190 22:47682458-47682480 CCCTCAGGGCAGGGGGAAGGCGG - Intergenic
1185214049 22:49588291-49588313 CCATCTGGGCAGAGGGTCCAGGG - Intronic
950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG + Intergenic
951764760 3:26185349-26185371 CCCTCAGGGCAGAAGGAAGAAGG - Intergenic
951922203 3:27868855-27868877 CTTTCAGGGCAGAAGAAAGAGGG - Intergenic
952253781 3:31678329-31678351 CATGCTGTGTAGAGGGAAGAAGG + Intronic
952305407 3:32141740-32141762 CCCTCTGGGAAGAGGGAAATGGG - Intronic
952368708 3:32698693-32698715 CCTTCTTGGAAAAGGGAAGTTGG + Intronic
953864538 3:46572878-46572900 CCTTCTTTGCTGGGGGAAGAGGG + Intronic
953982253 3:47418706-47418728 CCTGCTGGGCACTGGGAAGCAGG - Exonic
954286742 3:49624853-49624875 TCTTCTGGGCAGGAGGAAGAGGG + Intronic
954331018 3:49890331-49890353 CCTCTTGGGCAGATGTAAGATGG - Intronic
954510747 3:51122763-51122785 TCTTCTGGGCAGTGGGAAGCTGG - Intronic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
954662890 3:52235414-52235436 CCTGCGGGGCAGGGGGCAGATGG - Intronic
954665462 3:52249087-52249109 CTTTCTGGGCAGATGGAAGCTGG - Intronic
954787332 3:53103624-53103646 CCCTCTGGGGTGAGGGAGGAAGG - Intronic
954787409 3:53104094-53104116 CCTCCTGGGGCCAGGGAAGAGGG + Exonic
954800996 3:53186779-53186801 TTTTCTAGGGAGAGGGAAGAAGG - Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955482535 3:59404186-59404208 CCTTATAGGCAGAGGCATGAGGG - Intergenic
956114491 3:65904590-65904612 CATTCTGGGCTGAGGGATGGTGG - Intronic
956870949 3:73417285-73417307 CCTTATGGGGAGAAGCAAGAGGG - Intronic
958188369 3:90152621-90152643 CCATCTGGACAGAGGGAATTTGG + Intergenic
958410893 3:93814455-93814477 CCATCTGGACAGAGGGAATTTGG + Intergenic
958433139 3:94065387-94065409 CCTCCTAGGTTGAGGGAAGAAGG + Intronic
960406641 3:117269038-117269060 CCTACTGGGCTGAGGAAAGGAGG + Intergenic
961038839 3:123662892-123662914 CTTGCTGGGCAGAGTGAAAAGGG - Intronic
961614544 3:128168464-128168486 CTTTCTGGGGAGAGAGAGGAAGG + Intronic
962255159 3:133865485-133865507 CCATCTGGGGTGGGGGAAGAGGG + Intronic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
962617692 3:137143646-137143668 CCTCATGGGCAAAGTGAAGATGG + Intergenic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
962874108 3:139522693-139522715 CATTCTAGGCAGAGTGAAAAAGG + Intronic
963427523 3:145151048-145151070 TCTTCTGGGCTGAGGGCAGTTGG + Intergenic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
966818724 3:183908888-183908910 GGTTCTGGGGAGAGGGAAGGAGG + Intergenic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
967171350 3:186825557-186825579 CCTTCTGGGCAGAGGCATGGCGG - Intergenic
967891446 3:194367038-194367060 CATGCTGGGCAGGGGGAAGGTGG - Intronic
968108780 3:196025063-196025085 GCTTCTGGGAAAAGGGAAAAGGG - Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969177858 4:5412909-5412931 CCTTCTGGGCTGAGACAGGATGG - Intronic
969269497 4:6089589-6089611 CCTTTGGGGCAGAGGGGACAGGG - Intronic
969636766 4:8373974-8373996 GCTCCTGGGCAGAGTGAAGCAGG + Intronic
969940193 4:10724362-10724384 AATTCTGAGCATAGGGAAGACGG - Intergenic
970222016 4:13821288-13821310 ACCCCTGGGCAGAGGGGAGAAGG - Intergenic
970477929 4:16442843-16442865 ACTTCTGGGCAGAGATAACATGG - Intergenic
972571264 4:40312446-40312468 CATCCTAGGAAGAGGGAAGATGG - Intergenic
972922747 4:43964503-43964525 TCTTCTAGACACAGGGAAGATGG + Intergenic
975245356 4:72114250-72114272 GCTTCTGGGCAGCTGGAATAGGG - Intronic
975893190 4:79053717-79053739 ACCTCTGGGCAGTTGGAAGAGGG + Intergenic
977486046 4:97647789-97647811 TGTTCTGGGCAGAGGGAAACAGG + Intronic
977786601 4:101042342-101042364 TTTTCAGGGCAGAGGGAAGGTGG - Intronic
978386192 4:108177727-108177749 GCTTCTGGGCAGAGGCAACAAGG - Intergenic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
978887083 4:113776853-113776875 CCATCTGCGCACTGGGAAGACGG + Intergenic
979528372 4:121741258-121741280 CCTTCTAGGCAGAGGGAATAGGG - Intergenic
980207706 4:129742763-129742785 TGTTCTAGGCATAGGGAAGAGGG + Intergenic
981499704 4:145436874-145436896 ACTTATGGGCAGAGACAAGAGGG + Intergenic
982857971 4:160409235-160409257 TTTTCTGGGTACAGGGAAGAAGG + Intergenic
983373779 4:166898287-166898309 ACCTCTGGGCAGGGGGAGGAAGG + Intronic
984215737 4:176910899-176910921 CCTCCTGGGCAGAGGAAGGGCGG + Intergenic
985676246 5:1232688-1232710 GCTTCTGGGCAGAGGGAGCTGGG + Intronic
986331175 5:6716961-6716983 CCTTCTGGGCACAGAGCAGGTGG - Intronic
987033837 5:14000183-14000205 CCTTCTGAAAAGAGGGAAGTTGG + Intergenic
987879396 5:23722631-23722653 CCTTCAGGTCAGAGGCAACATGG + Intergenic
988583727 5:32491002-32491024 CCTCCTGGGGCGAGGCAAGAGGG + Intergenic
990172026 5:53062200-53062222 TTTTCTAGGCAGAGGGAAGTGGG - Intronic
990194233 5:53294973-53294995 CTTTCTGGGAATAGGGGAGATGG - Intergenic
991093712 5:62717865-62717887 CCTTGTAGGCAAATGGAAGAGGG + Intergenic
991166217 5:63567325-63567347 CATTTTGGGTAGAGGGAAGGAGG - Intergenic
993501632 5:88673220-88673242 CCTTCTGGGGAGAGGGAGAAGGG + Intergenic
993526207 5:88968876-88968898 ACTTCAGGGCACATGGAAGATGG + Intergenic
998024598 5:138804475-138804497 CTTGCTGGGCAGTGGGAAGCAGG - Intronic
999619752 5:153460646-153460668 CCTTCTTGGCTGGGGGAAAATGG + Intergenic
1000822955 5:166007993-166008015 GCTGGAGGGCAGAGGGAAGAGGG - Intergenic
1000897993 5:166879441-166879463 CATTCTGGGCAGAGAAAACAAGG + Intergenic
1001514868 5:172348417-172348439 CGTTCTGGACCGAGGGATGAGGG + Intronic
1001679511 5:173545911-173545933 CCTTGTGGGAAGAGGGGAGGGGG - Intergenic
1001931537 5:175676522-175676544 GCTCCTGGGCAAAGGCAAGAAGG + Intronic
1002857187 6:1048364-1048386 CCTTGTGGGCAGAGGGACAAGGG + Intergenic
1002866311 6:1125278-1125300 CCTTCTGGACTGAGGGTAGGTGG - Intergenic
1003007070 6:2392151-2392173 CGTTCTGGGTGTAGGGAAGAGGG + Intergenic
1003333994 6:5153455-5153477 CCAGCTGGGCAGAGAGAAGCTGG + Intronic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1003980097 6:11381249-11381271 GCTTCTGGGCAGGGGAAGGAGGG + Intronic
1004196967 6:13513931-13513953 GCTGCTGGGCAAAGGGAAGTAGG + Intergenic
1004750924 6:18561130-18561152 CCATCTGGGCAGAGGGAATGTGG - Intergenic
1005826269 6:29633126-29633148 GCTCCCGGGCGGAGGGAAGAAGG + Exonic
1005967170 6:30734943-30734965 TCATCTGCTCAGAGGGAAGAAGG + Intronic
1006414528 6:33895618-33895640 CCTTCTGCCCAGAGGGAATTTGG - Intergenic
1006729023 6:36221805-36221827 AATTCTGGGCAGATGTAAGATGG + Intronic
1007723236 6:43898500-43898522 CATTCCAGCCAGAGGGAAGAGGG - Intergenic
1007809136 6:44474102-44474124 CCTTGTGGTCAGAGGGATGGTGG + Intergenic
1007935459 6:45728344-45728366 TGTTCTGGGCAGAGGAAAGGAGG + Intergenic
1007970228 6:46044534-46044556 CCTTCAGGGCAAAGGTAAAATGG + Intronic
1009929466 6:70160036-70160058 CCTCCTGGGTAGTGGGAATAGGG - Intronic
1010300099 6:74250398-74250420 CCTTCTGGGTTGTGGAAAGAGGG - Intergenic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1013178464 6:107698176-107698198 CCTTCAGGGCTGAATGAAGAGGG + Intergenic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1016471574 6:144380365-144380387 ATCTCTGGGCAGAGGGAAAATGG + Intronic
1017073706 6:150599749-150599771 CCCTCAGGGCAGAGGGGAGGCGG + Intergenic
1017635339 6:156437585-156437607 CTTTCTGGGAAGAGGGCAGCTGG - Intergenic
1018036758 6:159888590-159888612 CCTTATGGGAGCAGGGAAGAAGG - Intergenic
1018380554 6:163254720-163254742 CCTTCTGGGCAGAGTGGCAATGG - Intronic
1018520052 6:164639121-164639143 CCTTGAGGGCAGAGGGTAGGAGG - Intergenic
1018647069 6:165958864-165958886 TCTTTTGGGCAGAAGCAAGAGGG - Intronic
1018894761 6:168006022-168006044 CCTTCAGTGCAGGAGGAAGAGGG + Intronic
1019490598 7:1311461-1311483 GCTTCTGGGGAGAGGGCAGGGGG + Intergenic
1019586893 7:1809912-1809934 CCTCCTGGGCAGAGGGACAGAGG - Intergenic
1019672558 7:2289473-2289495 CCTCCTGGAATGAGGGAAGACGG - Intronic
1019986419 7:4659653-4659675 CCTGCTGGGTAAAGGGAAAAGGG - Intergenic
1020552546 7:9625036-9625058 ACTTATGGACAGAGCGAAGACGG + Intergenic
1022044253 7:26610725-26610747 CCTTCTGTTCTCAGGGAAGAGGG - Intergenic
1022113635 7:27245661-27245683 CCACCTGGGCAGAAGGAAGGAGG + Intronic
1022266949 7:28766262-28766284 CCTTCTGAAGAAAGGGAAGAAGG + Intronic
1027361807 7:77416612-77416634 CCTTCGGGGCTGAGGATAGAGGG + Intergenic
1029446025 7:100613118-100613140 CCTCCGGGGCAGAAGGCAGAGGG + Intronic
1031026614 7:116686312-116686334 ATTTCTGGGCAGAGGCAAGAAGG - Intronic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1034355751 7:150449690-150449712 CCTGCTGTGCAGAGCGCAGAGGG + Intergenic
1034433794 7:151053599-151053621 CCTCCTGGGCAGAGGAAGGGAGG + Intergenic
1034473483 7:151269224-151269246 CCTGCTGGGCAGAGTGGAGTGGG + Intronic
1034494500 7:151411440-151411462 CTTTCTGGGCAGAGGGGCCAAGG + Intergenic
1035107237 7:156452102-156452124 CATTCCAGGCAGAGGGAACAAGG - Intergenic
1035171865 7:157021554-157021576 CCGCCTGGCCCGAGGGAAGAGGG + Intergenic
1035324728 7:158057615-158057637 CCTCCTGAGCAAAGGGAAGTGGG + Intronic
1035797895 8:2376203-2376225 CCTTGTGGCCACAGTGAAGAGGG - Intergenic
1036517227 8:9455513-9455535 ACTACTGGGGAGAGGGAGGAGGG + Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1037699488 8:21261958-21261980 CCTTCAGGGCAGATGGGAGGAGG - Intergenic
1037780430 8:21864750-21864772 CCTTCAGAGCAGTGGGAAGAAGG + Intergenic
1038289871 8:26239465-26239487 GTTTCTGGGCAGAGTGAAGGAGG - Intergenic
1039197151 8:35045479-35045501 AATTCTGGGCATAGAGAAGAGGG - Intergenic
1040870118 8:52092079-52092101 CTTACTGGGCAGAGTGAACAGGG - Intergenic
1041029630 8:53723711-53723733 GGTTCTGGGCAGAGAGGAGATGG - Intronic
1041519763 8:58742398-58742420 CCTTCTGGGCCAAGGAAAGAAGG + Intergenic
1041659835 8:60391073-60391095 TCTTCTGGGCATAGAGAAGTGGG + Intergenic
1042816754 8:72886555-72886577 CTTTCTGAGCAGAGTGTAGATGG - Intronic
1042886171 8:73554478-73554500 CCTTCTAGGCAGAAAGAAGCTGG + Intronic
1044081024 8:87884043-87884065 TCTTATGGGTAGAGGGAAAAAGG - Intergenic
1044813692 8:96089394-96089416 TCCTATGGGCAGAGGGAAGTGGG - Intergenic
1045139869 8:99268278-99268300 CCTACTGGGCTGTGAGAAGAGGG + Intronic
1046372449 8:113327507-113327529 CCTACTGGGAAGAGGGGAGTGGG - Intronic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1048088945 8:131217922-131217944 CCTTCTGGGCAGAGTGTTAAAGG - Intergenic
1048841928 8:138574255-138574277 CCTTCTGGGAAAAGGGGAGTTGG - Intergenic
1049220904 8:141428375-141428397 CCCCCTGGGCAGTGGGCAGATGG - Intronic
1050168200 9:2788526-2788548 CCTTCTGTGCCAAGGGAACAGGG - Intronic
1051364816 9:16314463-16314485 CCTTCTAGGGAAAGGGATGAGGG - Intergenic
1051428905 9:16962205-16962227 TCTACAGGGCAGAGAGAAGAGGG - Intergenic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1052862606 9:33446197-33446219 CCTTCTTGGCACAGGAGAGAGGG + Intronic
1055145667 9:72931693-72931715 CCTCTTGTGCAGAGGGAACAGGG + Intronic
1055437874 9:76310628-76310650 AATTCAGGGAAGAGGGAAGATGG - Intronic
1056134988 9:83622929-83622951 ACTTCCGGGAAGAGGAAAGAGGG + Intergenic
1059341918 9:113602154-113602176 CCTGCGGGGCAGAGGGAGGGAGG + Intergenic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1061062588 9:128258075-128258097 CCTTCTGGGCCGAGGCCAGCAGG + Exonic
1061260753 9:129479716-129479738 CCTTGTGGGCAGTGGAAGGAAGG + Intergenic
1061372617 9:130206269-130206291 CCTTCTGTGCAAAGGACAGAGGG - Intronic
1061428675 9:130517483-130517505 ACTTCGGGGCAGAGGGGAGAGGG - Intergenic
1061949943 9:133930548-133930570 CTTGCTAGTCAGAGGGAAGAGGG + Intronic
1062207881 9:135347228-135347250 AGTTCTGGGCACAGGGAACACGG - Intergenic
1062234710 9:135502292-135502314 CCTTCTGGGCTGCGGGGAGGAGG + Intronic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1185817474 X:3169702-3169724 CCTTGTGGACAAAGGGCAGAAGG - Intergenic
1186517499 X:10176832-10176854 ACTGCTGGGCAGAGGACAGAGGG + Intronic
1187479583 X:19643027-19643049 TCTTCTGGCCAGAAGGAAGAGGG + Intronic
1187807210 X:23133721-23133743 TGTTCTGGGCAGCCGGAAGAAGG - Intergenic
1188820421 X:34768084-34768106 CCATCAGGGCAGAGGGAATGAGG + Intergenic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1192225996 X:69228330-69228352 GCCTCTGGGCAGACTGAAGAAGG + Intergenic
1192227294 X:69238205-69238227 CCTGCAGGGCTGAGGGCAGAGGG - Intergenic
1192536917 X:71936081-71936103 CCTATTTGACAGAGGGAAGATGG + Intergenic
1193924043 X:87464066-87464088 CATTGTGGGCAGATGGGAGAGGG + Intergenic
1197882973 X:131188770-131188792 TCTACTGGGCATAGAGAAGATGG + Intergenic
1198384292 X:136113864-136113886 CCTGGTGGGCAAAGGAAAGAAGG - Intergenic
1198480382 X:137034838-137034860 CCTTCTGGGGGCAGGGAAGAGGG - Intergenic
1199747658 X:150784107-150784129 CCTTCTGGGGATAGGGAGAAAGG + Intronic
1200091284 X:153637290-153637312 GCTCCTGGGCAGAGAGAAGGTGG - Intergenic
1200102865 X:153696717-153696739 CCTTCTGGGGACTGGGAAGGGGG + Intergenic
1200224361 X:154409080-154409102 CCCCCTGGGGAGACGGAAGAAGG - Intronic
1200267871 X:154655497-154655519 CCTTCTGGGGACTGGGAAGGGGG + Intergenic
1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202463029 Y:25126910-25126932 CCTTCTATTCAGAGGGATGATGG - Intergenic