ID: 1143254850

View in Genome Browser
Species Human (GRCh38)
Location 17:5548390-5548412
Sequence CTCTATCCTCAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 386}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143254850 Original CRISPR CTCTATCCTCAGAGGGAGGA GGG (reversed) Intronic
900426621 1:2583230-2583252 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
900664966 1:3809038-3809060 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
900693640 1:3996670-3996692 CACAAGCCTCAGAGGGAGTACGG - Intergenic
900874171 1:5329796-5329818 CTGTATCCTCACATGGTGGAAGG + Intergenic
901137431 1:7007141-7007163 CTCTCTTCTCAGAGGTAGCATGG - Intronic
901661507 1:10800613-10800635 CTCTGTCCTCGGAGTGAGAAAGG - Intergenic
901771164 1:11531053-11531075 CTGGTTCCTCCGAGGGAGGATGG + Intronic
901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG + Intronic
902173736 1:14633729-14633751 CTGAATCCTCAGAGAGAGGATGG - Intronic
902220667 1:14962540-14962562 CTCCATCCTGAGAAGGAGAATGG - Intronic
902237037 1:15064152-15064174 TTCTGTCATCAGAGTGAGGAGGG + Intronic
902907743 1:19571210-19571232 CTGTATCCTCACATGGTGGAAGG - Intergenic
902979690 1:20113907-20113929 CTGTGTCCTCTGAGGGTGGATGG - Exonic
903246463 1:22019423-22019445 ACCCATCCTCAGAGGGAGGCTGG + Intergenic
903388732 1:22948145-22948167 CTGTATCCTCACATGGTGGAAGG - Intergenic
903406039 1:23097093-23097115 CTGTTTCCTCACAGGGAAGAAGG + Intronic
904464779 1:30701322-30701344 CTCCATCTTCAGGAGGAGGAAGG - Intergenic
905233320 1:36529193-36529215 CTCTGTCCTCTGAGGAAGGGGGG + Intergenic
905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG + Intergenic
905652867 1:39668259-39668281 CTCTGTCCTTAGAGGGGTGATGG - Intronic
905793660 1:40803306-40803328 CTTATTCCTCAGTGGGAGGAAGG - Intronic
905907972 1:41632337-41632359 CTCTATCTTCAAGGGGAGCACGG + Intronic
906650818 1:47511432-47511454 CTCTATCCTCAGCCCCAGGAGGG + Intergenic
906882776 1:49610649-49610671 CTGTATCCTCACAGGGGAGAAGG - Intronic
907598664 1:55745002-55745024 CTGTATCCTCACATGGTGGAAGG + Intergenic
907945215 1:59129698-59129720 CTGTATCCTCACATGGTGGAAGG - Intergenic
909316338 1:74223981-74224003 CTCTATAATCAGCAGGAGGAGGG - Intronic
910293350 1:85619701-85619723 ATCAATCCTTAGAGGGAGGTAGG - Intergenic
910436548 1:87211430-87211452 CTGTATCCTCAGCTGGGGGAAGG + Intergenic
911035037 1:93533512-93533534 ACCTATCCTCAAGGGGAGGAGGG - Intronic
911317702 1:96375430-96375452 CTCTATCCTCACATGGTGGAAGG - Intergenic
911468286 1:98282539-98282561 TTTTATCCTCTCAGGGAGGAAGG + Intergenic
912272789 1:108227976-108227998 CCCTGTCCTCAGGGGGAGGGAGG - Intronic
912295431 1:108466346-108466368 CCCTGTCCTCAGGGGGAGGGAGG + Intronic
913707547 1:121441847-121441869 TTGTATCCTCACATGGAGGAAGG - Intergenic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
914257486 1:145972414-145972436 CTCCATCCTAAAAGGGAGCAGGG - Intronic
914827272 1:151145363-151145385 CACCTTCCTCAGAGGGAGCAGGG + Intronic
916214545 1:162384138-162384160 CCCTGGCCTCAGCGGGAGGAAGG + Intronic
916564140 1:165958600-165958622 CTCTGCCCACAGTGGGAGGAGGG - Intergenic
918077796 1:181183538-181183560 CTGTGTCCTAAGAAGGAGGATGG + Intergenic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
924814104 1:247427514-247427536 ATCTGTCCTCAGAGGAAGGAAGG - Intronic
924814132 1:247427660-247427682 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924814146 1:247427733-247427755 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924814158 1:247427806-247427828 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924814185 1:247427952-247427974 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924814199 1:247428025-247428047 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
1063132297 10:3188769-3188791 CTGTATCCTCATAGGATGGAAGG + Intergenic
1063993033 10:11586977-11586999 ATCTGTCCTCACAGGGAGGTTGG - Intronic
1065683528 10:28261705-28261727 CTCTATCCTGAGAGAGAGACCGG + Intronic
1066045214 10:31588591-31588613 CTCTATTCTCAAAGGGTGGCAGG - Intergenic
1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG + Intergenic
1067047834 10:42995683-42995705 CCCGAGCCTCAGAGGGAGCATGG - Intergenic
1067449460 10:46372705-46372727 CTCTGTCCTCACATGGTGGAAGG + Intronic
1067587915 10:47488055-47488077 CTCTGTCCTCACATGGTGGAAGG - Intronic
1067635035 10:47996163-47996185 CTCTGTCCTCACATGGTGGAAGG - Intergenic
1068293094 10:55031740-55031762 CTGTATCCTCACATGGTGGAAGG - Intronic
1069646921 10:70006802-70006824 CCCTGTCCTTAGAGGGAGGCAGG - Intergenic
1071432450 10:85617168-85617190 CTCTAGCTTCAGAGGAATGAAGG - Intronic
1071610082 10:87023868-87023890 CTCTGTCCTCACATGGTGGAAGG + Intronic
1071787459 10:88917925-88917947 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1072619558 10:97070660-97070682 CTGTGTCCTCACACGGAGGAAGG - Intronic
1072756751 10:98026633-98026655 CTTCATCTTCAGCGGGAGGAGGG - Intronic
1072976270 10:100061668-100061690 CTCCATCCTCTGAGAGAGCAAGG - Intronic
1073083994 10:100876853-100876875 TTCTATCCTTAGAGGGAAGTAGG + Intergenic
1073245228 10:102085738-102085760 CATTATCCTCAGAAGGAGGAGGG + Intergenic
1073846417 10:107560859-107560881 CTAGCTCCTCAGAGGGAGGAAGG + Intergenic
1074057447 10:109935451-109935473 CTCTAACTTCAAAGGAAGGAAGG - Intergenic
1074079703 10:110157790-110157812 CTCTGTCCTCACATGGTGGAAGG + Intergenic
1074399904 10:113133411-113133433 CTCTATCCTCAAAAGGAGGATGG - Intronic
1075071210 10:119320962-119320984 CTGTATCCTGAGAGGGGGCAGGG - Intronic
1075698644 10:124453971-124453993 CTCTATGCACAGAGGGAAGGTGG - Intergenic
1075778920 10:125004713-125004735 GTCCAGCCTCAGAGGGAGGGAGG - Intronic
1076223491 10:128754416-128754438 CTCTCTCCTCAGTTGGTGGATGG - Intergenic
1076559601 10:131352857-131352879 CTCTATCCTCAGGGATGGGAGGG - Intergenic
1077391127 11:2301092-2301114 CTCCCTCCGCAGAGGGAGGGAGG + Intronic
1078884641 11:15488344-15488366 CCCTAGCTTCAGAGGGAGGCAGG - Intergenic
1079307358 11:19334857-19334879 TTACCTCCTCAGAGGGAGGAAGG + Intergenic
1079526634 11:21397869-21397891 CTCTAACCTCACATGGTGGAAGG - Intronic
1079542039 11:21588134-21588156 CTTAATCCTCAGAGGGAGACTGG - Intergenic
1080095759 11:28404465-28404487 CTGTATCCTCACATGGTGGAAGG + Intergenic
1081386177 11:42476231-42476253 CTCTACCCACAGTGGGAGGAGGG - Intergenic
1081775285 11:45671969-45671991 CTCCTCCCGCAGAGGGAGGAGGG - Intergenic
1082024957 11:47565286-47565308 CTCCCTCCTCCGAGGGAGGGGGG - Intronic
1085309014 11:75505302-75505324 CTGGATCCTGAGAGGGAGGCAGG - Intronic
1085724365 11:78941550-78941572 CTCTAGGCTCGGAGGCAGGAAGG + Intronic
1086921872 11:92596496-92596518 CTCTGTCATCAAAGGGAGAATGG - Intronic
1088119496 11:106351429-106351451 CTGTGTCCTCAGAGGTAGAAAGG + Intergenic
1088252922 11:107877225-107877247 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1088779945 11:113124206-113124228 CTCTAGACTGAGAAGGAGGAAGG + Intronic
1088894363 11:114066632-114066654 CTCTCTCCCCAGAGGAATGAGGG - Intronic
1089296136 11:117469494-117469516 CTCCACCCTCAGAGGTAGGGAGG + Intronic
1089868361 11:121651468-121651490 CTCTGTCCTCACATGGAGAAAGG + Intergenic
1090169267 11:124584465-124584487 CTCAATTCTCAGAGTGTGGAGGG - Intergenic
1090237787 11:125162190-125162212 CTTCATCCTCAGAGGGATGATGG + Intergenic
1091194193 11:133717938-133717960 CTGTGTCCTCAGAGGTAGAAGGG + Intergenic
1091242794 11:134065329-134065351 CTGTTTCCTTAGAGGGAGGTGGG + Intergenic
1091983674 12:4888519-4888541 CTGTATCCTCACATAGAGGAGGG - Intergenic
1092977082 12:13755890-13755912 CTCTGTCCTCACAGGGTGGAAGG - Intronic
1093250076 12:16792133-16792155 CTCTAAGCTCAGAGTTAGGATGG - Intergenic
1093865080 12:24216536-24216558 TTCTTTCCCCAGAGGTAGGAGGG - Intergenic
1094670718 12:32566202-32566224 CTATAACCTCACAGGGTGGAAGG + Intronic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1096182344 12:49557752-49557774 CCCCTTCCTCAGAAGGAGGAGGG - Exonic
1096887370 12:54731277-54731299 CTCCATCCTCAGGGAGAGGCAGG - Intergenic
1097214030 12:57395810-57395832 GTCTAACCTCTGGGGGAGGAGGG + Exonic
1099278586 12:80611560-80611582 ATCTTTCCTCACAGGTAGGAGGG - Intronic
1100134049 12:91533161-91533183 CTGTGTCCTCATAGGGTGGAAGG - Intergenic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1102550937 12:113691782-113691804 CCATGTCCTCACAGGGAGGAAGG - Intergenic
1102879496 12:116473519-116473541 CTGTATCCTCACATGGAAGAAGG - Intergenic
1103301150 12:119927426-119927448 CTGCATCCTCAGACGGTGGAAGG - Intergenic
1103783019 12:123412119-123412141 ATCTATCCCCACAGGGAGGCAGG + Exonic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104613750 12:130251695-130251717 CTCTTCCCCCAGAGGGAGAACGG - Intergenic
1106401821 13:29438506-29438528 CTGTATCCTCACACGGAGGAAGG + Intronic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1109997650 13:70150308-70150330 CTCTATTCTAAGAGGAAGTATGG + Intergenic
1111382566 13:87478173-87478195 CTCTGTCCTCACAGGGTGAAAGG - Intergenic
1112431301 13:99352736-99352758 CTCTAAGCTCAGGGAGAGGAGGG - Intronic
1112799110 13:103091244-103091266 CTCTATCCTCACACAGTGGAAGG - Intergenic
1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG + Intergenic
1116114271 14:40628502-40628524 CTCTAACCTCACATGGTGGAAGG - Intergenic
1116124130 14:40759361-40759383 CCCTAGCCTCAGAGGAAAGAAGG + Intergenic
1116930345 14:50684398-50684420 CCCTATCCTAAGATGGAGGGGGG - Intergenic
1118250154 14:64151900-64151922 CACTCTACTCAGAGGAAGGACGG - Intronic
1118389231 14:65282244-65282266 CTGTAATCTCAGAGAGAGGATGG - Intergenic
1118456375 14:65948668-65948690 CTCTATCCGCAGAGGGCAGAGGG + Intergenic
1118729584 14:68656883-68656905 GTCTATCCTCAAAGAGAGGGTGG - Intronic
1118994148 14:70821943-70821965 TTCTCTCCCCAGGGGGAGGAGGG + Intergenic
1120967803 14:90183003-90183025 CACTCTCATCAGAGGGATGAGGG - Intronic
1121507795 14:94489885-94489907 CTCCATCCACAGAATGAGGAGGG + Intronic
1121862247 14:97329447-97329469 CTGTGTCCTCACAGGGTGGAGGG + Intergenic
1122039978 14:98980284-98980306 CTGTATCTTCACAGGGTGGAAGG - Intergenic
1122138120 14:99646112-99646134 CTCCACCCTCAGAGGGAAGATGG - Intronic
1122243917 14:100387764-100387786 CCTTATTCTCAGAGGCAGGAGGG - Intronic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1124347667 15:28933333-28933355 CTCTGTCCTCACATGGTGGAGGG - Intronic
1124863218 15:33463241-33463263 CTCTAACCTCAGAGGTAGCAAGG - Intronic
1124922913 15:34043889-34043911 CTCTATACTAACAGGAAGGAAGG - Intronic
1125130411 15:36278470-36278492 CTCTTCCCACAGAGGGAGCAGGG - Intergenic
1125240427 15:37568454-37568476 CTTTGTCCTCATAGGGTGGAAGG - Intergenic
1125678850 15:41517972-41517994 CTCCATCTTCAGAGGAAGGAAGG - Intronic
1125987397 15:44067580-44067602 CTGCATCCTCAGAGGGTGGAGGG + Intronic
1127048625 15:55055714-55055736 TTGTATCCTCACAGGGTGGAAGG - Intergenic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG + Intergenic
1130668567 15:85890478-85890500 CTCCATCCTGAGAGGGAGCTGGG + Intergenic
1130865558 15:87930487-87930509 CTCACTCCTCAGAAGGAGGAAGG + Intronic
1131774373 15:95778418-95778440 CTGTATCCTCACTTGGAGGAAGG + Intergenic
1131997630 15:98147426-98147448 CTCTATCCTCTGAGGTCTGAAGG + Intergenic
1132119408 15:99163766-99163788 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1135909396 16:26545546-26545568 ATCTATTCTGTGAGGGAGGAAGG - Intergenic
1138773222 16:59689074-59689096 CTCTTGTCTCAGAGGGAGGGAGG + Intergenic
1139670777 16:68491387-68491409 CCCCATCCTCAGGGGCAGGAGGG + Intergenic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1142824091 17:2496844-2496866 CTGCATCCTCACAGGGTGGAAGG - Intronic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1143175072 17:4950668-4950690 CTCTGTCCTCAGTGGGGGAAAGG - Intronic
1143250915 17:5522396-5522418 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1143254850 17:5548390-5548412 CTCTATCCTCAGAGGGAGGAGGG - Intronic
1143861586 17:9895161-9895183 CTCTATCCTCAGTTCAAGGATGG + Intergenic
1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1146376520 17:32298356-32298378 CTCCAGCCTCATAGGGAGGTGGG - Intronic
1147210244 17:38869117-38869139 CTTTGTGCTCAGCGGGAGGAGGG - Intergenic
1147331757 17:39703396-39703418 CTCTCTTCCCAGGGGGAGGATGG - Intronic
1149223741 17:54444392-54444414 CTGTATTCTAAGAGTGAGGATGG - Intergenic
1149538768 17:57452908-57452930 CTCTAACCTCAGACTGGGGAAGG + Intronic
1149707466 17:58707880-58707902 CTGTGTCCTCATGGGGAGGAAGG + Intronic
1149849978 17:60028483-60028505 CTCTGTCCACAGAAGGGGGAGGG - Intergenic
1149860189 17:60118041-60118063 CTCTGTCCACAGAAGGGGGAGGG + Intergenic
1150194538 17:63281931-63281953 CTTGAGCCTCAGAGGGAGCATGG + Intronic
1152096942 17:78278110-78278132 ATCCATACTCAGAGGGAGGTGGG + Intergenic
1152332531 17:79681371-79681393 GTCTGTCCTGAGAGGGAGGTGGG + Intergenic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1153347096 18:4038736-4038758 GTCCAACCTCAGAGGCAGGATGG - Intronic
1153666227 18:7369722-7369744 CGCTACCCTCAAAGTGAGGAGGG + Intergenic
1156612979 18:38749612-38749634 CTGTATCCTCACATGGTGGAAGG + Intergenic
1157557825 18:48624245-48624267 CTCTATCCTTGGGAGGAGGAGGG + Intronic
1157663579 18:49466781-49466803 CTATGTCCTCACATGGAGGAAGG - Intergenic
1158703171 18:59767304-59767326 CTCTGTCCTCACATGGTGGAAGG - Intergenic
1159028997 18:63211948-63211970 CTTTCTTCTCTGAGGGAGGATGG + Intronic
1159434174 18:68394666-68394688 CTAGATCCTCGGAGGGAGCATGG - Intergenic
1159794214 18:72822228-72822250 CTCAAGTCTCAGAGGGTGGAGGG + Intronic
1160212504 18:76894267-76894289 CTCCATCCTGAGAGGGGTGAGGG + Intronic
1160257582 18:77260254-77260276 CTGTATCCTCACAGAGTGGAAGG + Intronic
1161222872 19:3126080-3126102 TTTTACCCTCAGAGGGAGGTGGG + Intergenic
1161308435 19:3579821-3579843 GTCAATCCACAGAGGCAGGAAGG - Intergenic
1161378489 19:3951942-3951964 CTCCATCCTCAGAGGGGGCTGGG + Intergenic
1161601734 19:5188331-5188353 CTTTGTCCTCACAGGGTGGAAGG - Intronic
1164596303 19:29532675-29532697 CTCTGACCTCAGAGGGAGCTTGG + Intronic
1164686372 19:30169120-30169142 CTTCCTGCTCAGAGGGAGGAGGG + Intergenic
1168132954 19:54332479-54332501 CTCTGGGCTCAGAGGGAGGGTGG - Intergenic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
1168476259 19:56677569-56677591 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
924980815 2:219454-219476 CTGTGTCCTCACAAGGAGGAAGG - Intronic
925617428 2:5757107-5757129 CTCTATCCTTTGGAGGAGGAAGG - Intergenic
928844130 2:35648713-35648735 CTGTATTCTCACAGGGAGGAAGG + Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
932784741 2:74590268-74590290 CTGTATCCTCATATGGTGGAGGG + Intronic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
935240773 2:101176006-101176028 CTCTGTCCTCACAGCGTGGAAGG - Intronic
935745229 2:106184599-106184621 CTGTATCCTCACATGGTGGAAGG + Intronic
936450949 2:112633704-112633726 CTGTGTCCTCAGATGAAGGAAGG - Intergenic
937433884 2:121864154-121864176 CTGTATCCTCACATGGTGGAAGG - Intergenic
937934360 2:127230739-127230761 CTGTGTCCTCACAGGGCGGAAGG - Intergenic
938786246 2:134632621-134632643 CTGTGTCCTCAAAGGGTGGAAGG + Intronic
938985697 2:136573225-136573247 CTATACCTTCAGAGGGAGCATGG + Intergenic
939077177 2:137617821-137617843 CTACATCCTCAGAGGATGGAAGG + Intronic
941349858 2:164418768-164418790 CTGTATCCTCACATGGTGGAAGG + Intergenic
941653293 2:168116715-168116737 TTCTATCATCTGTGGGAGGAAGG - Intronic
942718243 2:178919082-178919104 CTGTATCCTCACATGGTGGAAGG - Intronic
943308566 2:186298254-186298276 CACTTTCCTCACAAGGAGGAAGG - Intergenic
944132021 2:196357218-196357240 CTCTGTCTGCACAGGGAGGATGG - Intronic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946771044 2:223089395-223089417 TTCTATTCTCAGAGTGAGGGTGG + Intronic
947282715 2:228473404-228473426 CTCTATCCTGTGAGAGAGGGGGG + Intergenic
1169090634 20:2859575-2859597 CTCTACCCCCAGAGGGAGGGAGG - Intronic
1169144043 20:3240890-3240912 CTCTTTCCTCAGTGGGCTGAGGG - Intergenic
1169358027 20:4924288-4924310 CTCTGACTCCAGAGGGAGGACGG - Intronic
1169606274 20:7323128-7323150 CTGTATCCTCACATGGTGGAGGG + Intergenic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1170201401 20:13748383-13748405 ATATATCCTTTGAGGGAGGAAGG - Intronic
1170766000 20:19290499-19290521 CTCTAGCCTCACAAGGTGGAAGG - Intronic
1170766381 20:19292896-19292918 CTCTGTCCTCACACTGAGGAAGG + Intronic
1171099696 20:22371470-22371492 CTCCACCCTCACCGGGAGGAGGG + Intergenic
1172598741 20:36168891-36168913 CACCATCCTGAGAGGGAGGGAGG + Intronic
1173026871 20:39315748-39315770 CTCCATCCTGAGAGGGTGCAGGG - Intergenic
1173197845 20:40930728-40930750 TTCTAACCTCACAGGAAGGATGG - Intergenic
1173262706 20:41451073-41451095 CCCAGTCCCCAGAGGGAGGAAGG - Exonic
1173428131 20:42960349-42960371 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1174064165 20:47852746-47852768 CCCTGTCTACAGAGGGAGGAGGG + Intergenic
1175934106 20:62507288-62507310 GTCCAACCCCAGAGGGAGGAGGG - Intergenic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1178460258 21:32796227-32796249 CTCCATCCTCACATGCAGGACGG - Intronic
1178830663 21:36053965-36053987 CTCTAGCCTCAGAGGTTGGCTGG - Intronic
1179140810 21:38723272-38723294 CTCTATCCTTCATGGGAGGATGG - Intergenic
1179642457 21:42756587-42756609 CTCTATCCTCCGAGGGCCCAGGG + Intronic
1179642471 21:42756634-42756656 CTCTATCCTCCGAGGGCCCAGGG + Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1182133634 22:27879478-27879500 CACTCTCCTCAGGGGGAGGTGGG + Intronic
1182244221 22:28942648-28942670 CTCTAACCTCAGACGTAGCACGG - Intronic
1182345868 22:29664314-29664336 GTTTAGCCTGAGAGGGAGGAAGG - Intronic
1182879597 22:33722219-33722241 CTCTAGCCTGGGAGGGAGAAAGG + Intronic
1183007562 22:34916188-34916210 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
1183545643 22:38453807-38453829 CTCCATTCTCACTGGGAGGAGGG - Intronic
1183625536 22:38999257-38999279 CTCTCTCCTGAGAGGGAGGGAGG - Intergenic
1184039217 22:41933388-41933410 CTGTGTCCTCACAGGGAGGCTGG + Intergenic
1184231811 22:43162486-43162508 CTCTAAGCTCAGAGAGGGGAAGG + Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184553116 22:45216078-45216100 CTCTCTCTTCAGAGGGAGGAAGG + Intronic
1185019731 22:48367140-48367162 CACTGTCCTCACATGGAGGAAGG + Intergenic
1185187918 22:49413939-49413961 CTCTCTCCTCAGCTGGTGGACGG + Intergenic
952101435 3:30017644-30017666 CTAGAACCTCAGAGGGAGCATGG + Intergenic
952586012 3:34893132-34893154 CTCTATCCTTATAGGCAGAAAGG - Intergenic
952713686 3:36456706-36456728 CTCTCTCCTCTGAGGGCAGATGG + Intronic
954437185 3:50502631-50502653 CTCTCTCCTCAGGTGGAGGGGGG + Intronic
954581265 3:51704094-51704116 CTCCTTCCTCTGGGGGAGGAGGG + Exonic
955375698 3:58394802-58394824 CTCCTTCTTCAGATGGAGGAAGG - Intronic
955855136 3:63264793-63264815 CACTTTCCTCACAGGGTGGAAGG + Intronic
957121121 3:76094293-76094315 CTTAATCCTCAGAAGCAGGAAGG + Intronic
959385525 3:105701028-105701050 CTCCATCAGCAGAGGGAAGATGG + Intronic
960260503 3:115562846-115562868 CTCTCTACTCAGAAAGAGGATGG + Intergenic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960461588 3:117942525-117942547 CTGTATCCTCACATGGTGGATGG - Intergenic
960721244 3:120626405-120626427 CTCTTTCTTCAGAGGAAGGAAGG - Intergenic
961108971 3:124267663-124267685 CCCTCTCCTAAGAGGAAGGAAGG - Intronic
961452086 3:127006808-127006830 CCCCAGCCTCAGAGGAAGGATGG + Intronic
961467447 3:127090356-127090378 CAGTCTCCTGAGAGGGAGGAGGG - Intergenic
961478007 3:127160645-127160667 GTCCATCCTCAAAGGGGGGAAGG - Intergenic
961791864 3:129382086-129382108 CTAGAACCTCAGATGGAGGAAGG + Intergenic
961805887 3:129489045-129489067 CTAGAACCTCAGATGGAGGAAGG + Intronic
962128487 3:132647907-132647929 CTCTTTCCTCACATGGTGGAAGG + Intronic
962148712 3:132869949-132869971 CCCATACCTCAGAGGGAGGATGG - Intergenic
962577858 3:136771102-136771124 CTGTGTCCTCATATGGAGGAAGG - Intergenic
962814902 3:138988832-138988854 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
962921654 3:139955772-139955794 CTCTATGCTCTGAGAGAGAAAGG + Intronic
965837098 3:172864781-172864803 TTCTCTCCTCAAAGGGAGGTTGG - Intergenic
966008462 3:175047023-175047045 CTGTGTCCTCAGATGGTGGAAGG + Intronic
967890442 3:194360789-194360811 CTCAATCCTCAGGGCGATGAGGG + Exonic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
969299007 4:6286359-6286381 CTGTGTCCTCACAGGGTGGAAGG - Intronic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
971324641 4:25633985-25634007 CTGTATCCTCACATGGTGGAAGG + Intergenic
971451691 4:26806916-26806938 CTAGAGCCTCAGAGGGAGGCTGG + Intergenic
972624029 4:40778527-40778549 CTGTATCCTCAGATGGTGAAAGG - Intronic
972733004 4:41813694-41813716 CTCCATCCTCATGTGGAGGAAGG + Intergenic
972981909 4:44714428-44714450 CCCTTTCCTCTGAGGGAAGAGGG - Intronic
973864829 4:55101975-55101997 CACTATCCGCAGAGTGAGGAAGG - Exonic
974904982 4:68044493-68044515 CTGTATCCTCACATGGTGGATGG - Intergenic
975533890 4:75428557-75428579 CTGTGTCCTCAGGGGCAGGAAGG - Intergenic
975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG + Intronic
975810096 4:78159136-78159158 TTCTTTCTTCAGAGGGTGGAGGG - Intronic
975983382 4:80183532-80183554 CTCCATCCCCGGAGGGAGAATGG + Intergenic
978411845 4:108434483-108434505 TTCAAGCCTCAGAGGAAGGATGG + Intergenic
979021224 4:115501050-115501072 CTGTATCCTCACATGGTGGAAGG - Intergenic
980014999 4:127639391-127639413 GTCTATACTCAAGGGGAGGAGGG + Intronic
980429211 4:132668305-132668327 CTGTATCCTCACATGGTGGAAGG + Intergenic
980452420 4:132991815-132991837 CTGTATCCTCACATGGTGGAAGG - Intergenic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
981330134 4:143498747-143498769 GTCTATCCTCAGGTGAAGGAAGG + Intergenic
981959884 4:150523742-150523764 GACTATCCTCAGAGGGAGGTGGG + Intronic
982304472 4:153915789-153915811 CTGTATCCTCACATGGGGGATGG - Intergenic
982727995 4:158925932-158925954 CTGTGTCCTCACAGGGTGGAAGG + Intronic
984313184 4:178090820-178090842 CTCTGTCCTCTGGGGGAGGGCGG + Intergenic
984808473 4:183772923-183772945 CTCTGTCCTCACATGGTGGAAGG + Intergenic
986005142 5:3661145-3661167 ATTTATCCTCAGAGGATGGATGG - Intergenic
986945692 5:13016492-13016514 CTGTATCCTCACATGGTGGAAGG + Intergenic
987266610 5:16262575-16262597 CTCTTCCCTCAGAGGCATGATGG + Intergenic
987417144 5:17674247-17674269 CTCTGTCCTCATGTGGAGGAAGG + Intergenic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
989961753 5:50424429-50424451 CTCCATTCTTAGAGAGAGGAAGG + Intronic
990695227 5:58408935-58408957 TACTATCCTCAGAAAGAGGATGG - Intergenic
991403463 5:66278015-66278037 CACTATTCTCAGAGGGTAGAAGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992982002 5:82185181-82185203 CTCTCTCCTCAGAGCTGGGAAGG - Intronic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993307767 5:86291985-86292007 CCCTGTCCTCAGGGGGAGGGAGG + Intergenic
993419688 5:87685320-87685342 CTCTAACCTCACATGGTGGAAGG + Intergenic
994327336 5:98463674-98463696 CTCCATCCTCACATGGTGGAAGG - Intergenic
994344540 5:98669012-98669034 CTCCATCCACTGAGGAAGGATGG - Intergenic
994999310 5:107106805-107106827 CTATGTCCTCACATGGAGGAAGG - Intergenic
996050911 5:118932232-118932254 CTCTAATCCCAGAGGCAGGAGGG + Intronic
996832920 5:127759430-127759452 CTCTGTCCTCACATGGTGGAAGG - Intergenic
998720541 5:144942735-144942757 TACTATCCTGAGAGGGAGGGAGG - Intergenic
999223751 5:150002609-150002631 CTCAATCCTTGGAGGGAGAAAGG - Intronic
999887249 5:155936972-155936994 CTCTAATCTCAGAGTGAGGGCGG - Intronic
1000289547 5:159857898-159857920 GTCCATGGTCAGAGGGAGGAAGG - Intergenic
1000294467 5:159901243-159901265 CTTTATCCTCTGAGGAAGGCAGG - Intergenic
1002059449 5:176617807-176617829 CTCTGTCCTTAGATGGAGGAGGG - Intergenic
1004294717 6:14400218-14400240 CTGTATCCTGGGAGGGAGGATGG - Intergenic
1005214523 6:23509612-23509634 CCCTGTCCTCACATGGAGGAAGG - Intergenic
1006309673 6:33248982-33249004 CTCCAGCCTCAGCGCGAGGACGG - Intergenic
1006425390 6:33960009-33960031 CTCCATGCTGGGAGGGAGGAGGG - Intergenic
1007310997 6:40945995-40946017 CTCCTTCCTGAGGGGGAGGAGGG - Intergenic
1007628149 6:43258123-43258145 CTCTATGCTCAGATTGAGGGTGG - Intronic
1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG + Intronic
1009947416 6:70355914-70355936 CTGTATCCTCACATGGTGGAAGG - Intergenic
1010972268 6:82275561-82275583 CTCTGTCCAGAGTGGGAGGAGGG - Intergenic
1015167123 6:130210757-130210779 CTCAATTCTAAAAGGGAGGAGGG - Intronic
1015256814 6:131186705-131186727 CTGTATCCTCACATGGTGGAGGG + Intronic
1016294678 6:142562278-142562300 CTCTATTCTCACAGGGAAGAGGG + Intergenic
1016371575 6:143380025-143380047 CTCTACCCTCAGAGGGCAGTGGG + Intergenic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1016540382 6:145157872-145157894 CTGTATCCTCACAAGGTGGAAGG - Intergenic
1016599424 6:145841275-145841297 CTAAATCCTCACACGGAGGAAGG + Intergenic
1017807644 6:157959938-157959960 CTGCATCCTCACATGGAGGAAGG - Intergenic
1018782194 6:167078298-167078320 CTGCATCCTCACAGGGAGAAGGG + Intergenic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1019590023 7:1826280-1826302 CTCCCTCCTCAGAGCGCGGACGG - Intronic
1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1021083506 7:16391388-16391410 GACTAATCTCAGAGGGAGGATGG - Intronic
1021952221 7:25786098-25786120 CTCTAACCCCAGAGGGTGGAAGG - Intergenic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1022501237 7:30883493-30883515 CTCTGGCCTCAGAGGCAGGTGGG + Intronic
1022644380 7:32216912-32216934 CTCTAGCCCCAGTGGGAGGAGGG + Intronic
1022942480 7:35253982-35254004 CCCCAGCCCCAGAGGGAGGAAGG - Exonic
1022955967 7:35380652-35380674 CTCCATCTTCAGAAGGTGGAGGG - Intergenic
1023574589 7:41612874-41612896 CTCTAAATTCAGAGTGAGGAAGG - Intergenic
1024427539 7:49244700-49244722 TTCTTTCCTCTGGGGGAGGAAGG - Intergenic
1026437590 7:70413311-70413333 CTCTATCCTAAAACAGAGGAGGG + Intronic
1028491309 7:91415017-91415039 CTCAATGCTCATAAGGAGGAAGG + Intergenic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1029847103 7:103423622-103423644 CTGTATCCTCACATGGCGGAAGG - Intronic
1029972459 7:104802549-104802571 CTCTGTCCTCACATGGTGGAAGG - Intronic
1030427194 7:109393488-109393510 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
1030988711 7:116273729-116273751 CTCTAGCCTCACAGGGTGGAAGG - Intergenic
1031440512 7:121788946-121788968 CTCTATCATCAGAGCCAGTAAGG + Intergenic
1032162293 7:129520158-129520180 CTATGTCCTCATATGGAGGAAGG + Intergenic
1032615360 7:133463300-133463322 ACCTCTCCTCAAAGGGAGGAAGG - Intronic
1033814994 7:145060553-145060575 CTATATCCTGAGAGGGGGTAGGG + Intergenic
1033848432 7:145463517-145463539 CTCCATCCTCACATGGTGGAAGG - Intergenic
1034564271 7:151900829-151900851 CTCTACTCTCAGGGAGAGGAAGG + Intergenic
1036288485 8:7465621-7465643 ATCCATCCTGAGGGGGAGGATGG + Intergenic
1036332990 8:7845907-7845929 ATCCATCCTGAGGGGGAGGATGG - Intergenic
1036712591 8:11091035-11091057 CTCTCACCTAAGAGAGAGGATGG - Intronic
1037203898 8:16291181-16291203 CTCTATCCTCAGAGGGGTCCTGG - Intronic
1037248199 8:16861518-16861540 CTCAACCATAAGAGGGAGGACGG - Intergenic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1043378494 8:79677037-79677059 CTCTAACCAAAGAGGGAGGGAGG + Intergenic
1044548145 8:93482337-93482359 CTGTATCCTCACATGGTGGAAGG - Intergenic
1046664089 8:116980072-116980094 CTCAAGCCTCAGAAGGAGCAGGG - Intronic
1046852016 8:118985113-118985135 CTGTACCCTCAGAGAGAGCATGG + Intergenic
1047175659 8:122538092-122538114 CTTGAACCTCAGAGGGAGAAGGG + Intergenic
1047313381 8:123710992-123711014 CTGTATCCTTGGAGGTAGGACGG - Intronic
1048553122 8:135452432-135452454 CTCCATCCTAGGAAGGAGGATGG - Intergenic
1048834893 8:138509833-138509855 CTGTAACCTCATACGGAGGAGGG + Intergenic
1048841687 8:138572348-138572370 CTGTAACCTCATATGGAGGAGGG + Intergenic
1048934493 8:139343782-139343804 TTCTAACTTCACAGGGAGGAGGG + Intergenic
1050005805 9:1128995-1129017 CTCTCTCCTCACATGGAGGAAGG - Intergenic
1050508160 9:6368814-6368836 TTCTCTCCTCAAATGGAGGAAGG - Intergenic
1050766741 9:9143742-9143764 ATCCATCCTCAGAGAGAGGAAGG + Intronic
1051837997 9:21362482-21362504 CTGTCTCCTCAGTGGGACGAGGG + Intergenic
1051845729 9:21449310-21449332 CTGTCTCCTCAGTGGGACGAGGG - Intergenic
1056803740 9:89712444-89712466 CTCTGGCCGCGGAGGGAGGAGGG - Intergenic
1057056284 9:91963700-91963722 CTGTATCCTCACATGGTGGAGGG - Intergenic
1057468754 9:95339084-95339106 CTCTAACCTCACATGGTGGAAGG + Intergenic
1058560844 9:106227269-106227291 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1059284027 9:113157497-113157519 CTCTATTCTCATATGGAGCATGG + Intronic
1059362147 9:113753269-113753291 TTTTATCCCCAGAGAGAGGATGG - Intergenic
1059613384 9:115923194-115923216 CTGTATCCTCACATGGTGGAAGG + Intergenic
1060903064 9:127278761-127278783 CACGGCCCTCAGAGGGAGGATGG - Intronic
1061266678 9:129509829-129509851 CTGTATCCTCACATGGTGGAAGG + Intergenic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1061536228 9:131252010-131252032 CGCTTTCCTCACAGGGAGGAGGG - Intergenic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1185997867 X:4973117-4973139 CTGTATCCTCACACGGTGGAAGG - Intergenic
1186395583 X:9205696-9205718 CTCTGTCCTCACAGGGTGGAAGG + Intergenic
1187412173 X:19061082-19061104 CTCCTTCCTCATATGGAGGAGGG + Intronic
1189163788 X:38838711-38838733 CACTACCCTCAGAGAGGGGAAGG + Intergenic
1189560234 X:42184763-42184785 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1191247589 X:58240173-58240195 CTCTATCCTTGGAAGGAGTAGGG - Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1191885635 X:65885031-65885053 CTGCATCCTCAGATGGTGGAAGG - Intergenic
1192119178 X:68438811-68438833 CTCTGTCCTCACATGGTGGAAGG - Intergenic
1193042227 X:77016105-77016127 CCAAATCCTCAAAGGGAGGAAGG + Intergenic
1194496100 X:94619110-94619132 ATCTATGCTCAGAGGAGGGAAGG + Intergenic
1194785850 X:98083605-98083627 CTCTGTCCTCACAAGGTGGAAGG - Intergenic
1195163963 X:102198912-102198934 CTCTAACCTCACATGGAGGAAGG - Intergenic
1195194898 X:102488183-102488205 CTCTAACCTCACATGGAGGAAGG + Intergenic
1196260922 X:113580357-113580379 CTCTATCTTGAGAGGTGGGAGGG + Intergenic
1196941014 X:120775843-120775865 CTCTTTCCTCATATGGTGGAAGG - Intergenic
1197712639 X:129682824-129682846 CTGTATCCTCACAAGGTGGAAGG + Intergenic
1200073962 X:153542194-153542216 CTCGTTCCCCAGAAGGAGGAGGG + Intronic
1201924098 Y:19266115-19266137 CTCCATCCTCAGAGGATGTATGG - Intergenic