ID: 1143258759

View in Genome Browser
Species Human (GRCh38)
Location 17:5583416-5583438
Sequence TGGCATTGTAGTTATGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 233}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143258759_1143258769 19 Left 1143258759 17:5583416-5583438 CCGTGCTCATAACTACAATGCCA 0: 1
1: 0
2: 5
3: 29
4: 233
Right 1143258769 17:5583458-5583480 CTTGAATAGAAGAGGGTGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 187
1143258759_1143258765 11 Left 1143258759 17:5583416-5583438 CCGTGCTCATAACTACAATGCCA 0: 1
1: 0
2: 5
3: 29
4: 233
Right 1143258765 17:5583450-5583472 GGAATGCACTTGAATAGAAGAGG 0: 1
1: 0
2: 1
3: 48
4: 404
1143258759_1143258762 -10 Left 1143258759 17:5583416-5583438 CCGTGCTCATAACTACAATGCCA 0: 1
1: 0
2: 5
3: 29
4: 233
Right 1143258762 17:5583429-5583451 TACAATGCCAGGCGAGTACCGGG 0: 1
1: 0
2: 1
3: 5
4: 54
1143258759_1143258766 12 Left 1143258759 17:5583416-5583438 CCGTGCTCATAACTACAATGCCA 0: 1
1: 0
2: 5
3: 29
4: 233
Right 1143258766 17:5583451-5583473 GAATGCACTTGAATAGAAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 205
1143258759_1143258768 18 Left 1143258759 17:5583416-5583438 CCGTGCTCATAACTACAATGCCA 0: 1
1: 0
2: 5
3: 29
4: 233
Right 1143258768 17:5583457-5583479 ACTTGAATAGAAGAGGGTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 172
1143258759_1143258767 17 Left 1143258759 17:5583416-5583438 CCGTGCTCATAACTACAATGCCA 0: 1
1: 0
2: 5
3: 29
4: 233
Right 1143258767 17:5583456-5583478 CACTTGAATAGAAGAGGGTGTGG 0: 1
1: 0
2: 0
3: 19
4: 502
1143258759_1143258770 27 Left 1143258759 17:5583416-5583438 CCGTGCTCATAACTACAATGCCA 0: 1
1: 0
2: 5
3: 29
4: 233
Right 1143258770 17:5583466-5583488 GAAGAGGGTGTGGGGCTCTGAGG 0: 1
1: 0
2: 3
3: 48
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143258759 Original CRISPR TGGCATTGTAGTTATGAGCA CGG (reversed) Intronic
901290609 1:8121331-8121353 TGCCTGTGTAGTTATGAGAAGGG + Intergenic
902648678 1:17822484-17822506 AGGCATTGTATTAGTGAGCATGG - Intronic
903636240 1:24819320-24819342 TGGCATTCTAATTATATGCATGG - Intronic
903994065 1:27294194-27294216 TGGCATGGTGGTCAAGAGCAAGG + Intronic
904533777 1:31185874-31185896 TGGCATTGCAGTGGTGAGCCAGG - Intronic
904550099 1:31309161-31309183 TAGCATAGTAGTTAAGAGAATGG + Intronic
905349953 1:37338634-37338656 GGGCACAGTAGTTAGGAGCATGG - Intergenic
906148354 1:43573213-43573235 TGGAAATGGAGTTGTGAGCAGGG + Intronic
907628833 1:56059965-56059987 TGGCATGATGGTTAAGAGCATGG - Intergenic
911391031 1:97243531-97243553 TAGCATTGTGGTTAAGAGCATGG - Intronic
911967460 1:104386148-104386170 TGGCAGTGTAAATAAGAGCAGGG - Intergenic
913117110 1:115707396-115707418 TTGCAATATGGTTATGAGCACGG - Intronic
914838999 1:151232266-151232288 AGTCATTGTAGTGATGAGCAGGG - Exonic
914880771 1:151545001-151545023 TAGCATTGTGGTCAAGAGCATGG + Intronic
915113310 1:153578622-153578644 TGGAATTGGAGAGATGAGCAGGG + Intergenic
916422474 1:164649869-164649891 TGGCAATGTTATTATGAGAAGGG - Intronic
917423308 1:174887636-174887658 TGGCAGTGTAGTTAAGTCCATGG + Intronic
917442032 1:175076751-175076773 TGGCATTGTGGGGATGAGCATGG + Intronic
917786710 1:178466748-178466770 AGGCATAGAGGTTATGAGCATGG - Intronic
917810795 1:178656789-178656811 TGGCATTGTGGTTGGGAGCATGG + Intergenic
918277092 1:182963661-182963683 TAGCATAGTGGTTAAGAGCAGGG - Intergenic
923160103 1:231308026-231308048 TAGCCATGTAGTTATGGGCAGGG - Intergenic
924373335 1:243379861-243379883 TGACAATGTAATTCTGAGCACGG + Intronic
1064614490 10:17138606-17138628 AGTCATTGTAATAATGAGCATGG - Intergenic
1065421381 10:25548252-25548274 TTGCATTGTAGTTATCTGTATGG - Intronic
1067486766 10:46657915-46657937 TGGGATTGTAATTAAAAGCAAGG + Intergenic
1067607984 10:47683750-47683772 TGGGATTGTAATTAAAAGCAAGG - Intergenic
1068580494 10:58733826-58733848 TAGGATAGTAGTTAGGAGCATGG + Intronic
1069997083 10:72349001-72349023 TAGCAGCGTAGTTAAGAGCATGG - Intronic
1070318331 10:75335085-75335107 TTGCATTGTGATCATGAGCAAGG + Intergenic
1071623588 10:87145460-87145482 TGGGATTGTAATTAAAAGCAAGG - Intronic
1071787772 10:88921757-88921779 TTGTAGAGTAGTTATGAGCATGG + Intronic
1072182535 10:93000570-93000592 TGGCACTGTAGATATGAAAAGGG + Intronic
1072290569 10:93961147-93961169 AGGCATTGTAGTGATGAGCAGGG + Intergenic
1073219491 10:101858256-101858278 TGGCATAGTGGTTAAGAGCACGG + Intronic
1074955720 10:118386999-118387021 TGGGGATGTAGTTATGTGCATGG - Intergenic
1077785840 11:5382684-5382706 TTAAATTGTAGTTATGAGGAAGG - Intronic
1078394096 11:10963854-10963876 TGGCGTTGTAGCTCTGAGAATGG + Intergenic
1079779532 11:24583415-24583437 TAGCATTTTGGTTAAGAGCAGGG + Intronic
1081153357 11:39659457-39659479 TGCCATTGTCATTATAAGCAGGG - Intergenic
1081878827 11:46430308-46430330 TGCCATTGTGGTTTTGTGCATGG - Intronic
1081960507 11:47133144-47133166 TAGCATTGTGGTTAATAGCATGG - Intronic
1082215918 11:49569308-49569330 TGGCAGAGTTGTTAAGAGCATGG - Intergenic
1083705893 11:64515029-64515051 TGGCACTCTAGATATGAGCCTGG + Intergenic
1083783292 11:64929313-64929335 TGGCCTTGTAGTTGAGACCATGG + Intronic
1083980159 11:66160909-66160931 TTGCATTGTGGTTAAGAACATGG + Intronic
1085153422 11:74270788-74270810 TAGCATGATGGTTATGAGCAGGG - Intronic
1085795274 11:79533552-79533574 TAGCATAGCAGTTAAGAGCAAGG + Intergenic
1087621228 11:100545026-100545048 TAGCATAATAGTTAAGAGCATGG - Intergenic
1088063221 11:105682596-105682618 TGGAATTGTAAGTAGGAGCAGGG - Intronic
1091383709 12:78627-78649 CGGCATAATAGTTCTGAGCAGGG + Intronic
1091403742 12:196416-196438 TGGAGTTGTAGTTAAGGGCAGGG - Intronic
1092086912 12:5770113-5770135 TGGCCTAGTAGTTAAGAGCAGGG - Intronic
1093812434 12:23506792-23506814 TGGCAGTGTAAATAAGAGCAGGG + Intergenic
1094145869 12:27227781-27227803 TAGCACAGTAGTTAGGAGCATGG - Intergenic
1094771658 12:33669778-33669800 TGGCATAGTAGTTAAGAGAATGG - Intergenic
1096425393 12:51497356-51497378 TCACATTGTAGGTATGAGCCTGG - Intronic
1097034921 12:56117689-56117711 GGGCATTTTGTTTATGAGCAAGG - Exonic
1098349510 12:69543483-69543505 TGGCATTGGAGTGAAGAGCTAGG + Intronic
1100277384 12:93083411-93083433 GGGCATTTTGTTTATGAGCAAGG + Intergenic
1101573237 12:105974446-105974468 TGGCATTGTCATTATGAGCTGGG - Intergenic
1101756089 12:107621612-107621634 TGGCATCGTAGTTATGAGCTGGG - Intronic
1102191781 12:110994246-110994268 AGGCACAGTAGTTATGAACAGGG - Intergenic
1105741211 13:23324928-23324950 GGGCATTTTAGTACTGAGCAAGG - Exonic
1106636838 13:31537988-31538010 TTGCATGCTGGTTATGAGCATGG + Intergenic
1107767147 13:43748288-43748310 GGGCATTATAGTTTGGAGCAGGG - Intronic
1107915240 13:45143334-45143356 TGGCATACTGGTTATGAGTATGG + Intronic
1109552770 13:63926062-63926084 TGTCATTCTAGTTACTAGCATGG - Intergenic
1110124114 13:71920692-71920714 TGGCATAGTGATTAAGAGCAAGG + Intergenic
1110163378 13:72406907-72406929 AGGCATTGTGGTTAAGAGCATGG - Intergenic
1113017282 13:105841464-105841486 TGGCTTTGTGGTGATGAGAATGG + Intergenic
1114594765 14:23902096-23902118 TGGCTTAGAAGTTAAGAGCATGG + Intergenic
1114927906 14:27427712-27427734 TGGTATTGTAGTTAAGCTCATGG + Intergenic
1115713067 14:36071889-36071911 CAGCCTCGTAGTTATGAGCATGG - Intergenic
1117670230 14:58099025-58099047 TCACATTGTACTTATCAGCAGGG - Intronic
1117998112 14:61497165-61497187 TGGCATTGTGGATAAGAGCTGGG + Intronic
1121154483 14:91670273-91670295 TGGCATGATAGTCATAAGCATGG - Intronic
1124274660 15:28315935-28315957 GGGCATTTTGTTTATGAGCAAGG - Intronic
1125450887 15:39805936-39805958 TGCCATTGTGGTTAAGAGAATGG - Intronic
1126043409 15:44615454-44615476 TGGTCTTGTAGTTTTGAACAGGG + Exonic
1128851681 15:70964239-70964261 TAGCATAGTGGTTAAGAGCATGG + Intronic
1131176030 15:90210357-90210379 CGTCATTGAAGTGATGAGCATGG + Intronic
1132073732 15:98801677-98801699 AGGCATTGTAGCTATGTGTATGG + Intronic
1133126091 16:3646907-3646929 TGGCACTATAGACATGAGCAGGG + Intronic
1134800589 16:17080913-17080935 TGAGATTGTAGATATGGGCAGGG - Intergenic
1135148509 16:19984747-19984769 TGGCACTGTAGTAATGCCCAAGG - Intergenic
1135789523 16:25380719-25380741 TGGCATAGTAGCTAAGAACATGG + Intergenic
1138301957 16:55937868-55937890 TGGCATGGTTGTCAAGAGCATGG - Intronic
1139906982 16:70372852-70372874 TGGAATGGAAGTTATGACCAAGG + Exonic
1143258759 17:5583416-5583438 TGGCATTGTAGTTATGAGCACGG - Intronic
1144754693 17:17672005-17672027 TGGAATTGTGATTATCAGCAGGG + Intergenic
1145749566 17:27345517-27345539 TGGTTTTGTAGTTAAAAGCACGG + Intergenic
1146222233 17:31034391-31034413 GGGCATTTTGTTTATGAGCAAGG + Intergenic
1146365874 17:32227255-32227277 TGGGATTATAGGTATGAGCTGGG + Intronic
1147800436 17:43082239-43082261 TGGTATATTAGTTGTGAGCAGGG + Intronic
1148486782 17:47995860-47995882 TGGCACAGTAGTTAGGAGTAAGG - Intergenic
1149263310 17:54901448-54901470 TGGCATTGGAGTGAAGAGGAGGG + Intronic
1149297289 17:55272463-55272485 TGTCTTTCTAGTTCTGAGCACGG + Intronic
1150013525 17:61529574-61529596 TTGCATTGTACTTATCATCATGG + Intergenic
1155422883 18:25674688-25674710 TAGCATTGTGGTTAAGAACACGG - Intergenic
1155433286 18:25784524-25784546 TGGCACTCTAGTTAAGAACAAGG - Intergenic
1156383971 18:36589499-36589521 CGGCATTGTAGATGAGAGCAAGG - Intronic
1156870080 18:41935577-41935599 TGGCATTAAATTTATGAGCTAGG - Intergenic
1161863484 19:6816980-6817002 TGACAGTGTGGTTATGAGAATGG + Intronic
1165374414 19:35431628-35431650 TGACATTGTAGTTGTGGGGAGGG - Intergenic
1168662398 19:58177883-58177905 TGGGATTATAGGTATGAGCCTGG + Intergenic
926371035 2:12178913-12178935 TAGTATTGTAGTTATGAGCTTGG - Intergenic
926765912 2:16322625-16322647 GGGCACTGTGGTTATGGGCACGG - Intergenic
929460497 2:42099446-42099468 TGGCATTGAAGTTAGTATCAAGG + Intergenic
929694766 2:44104890-44104912 TGGTATTGTGGTTACTAGCATGG - Intergenic
929831048 2:45346569-45346591 TGGCATTGTGGTTAAGAGCTTGG + Intergenic
931626051 2:64256692-64256714 TGGCAGTGTAGACAAGAGCAGGG - Intergenic
932770099 2:74496255-74496277 AGGCATTGTACTTTAGAGCATGG - Intergenic
933133839 2:78706653-78706675 TAGCATAGTGGTTGTGAGCATGG - Intergenic
935613085 2:105046502-105046524 TGGCTTTGTGGGTGTGAGCATGG - Intronic
935663177 2:105487554-105487576 TGGCCTTGTAGTGGTGAGGATGG - Intergenic
939686396 2:145205934-145205956 TGGCATAGTAGTTAAAAGCATGG + Intergenic
940003436 2:148989619-148989641 TGGCATGGAAGTGATGAACAGGG - Intronic
941333540 2:164210690-164210712 TGGCATAGTGGCAATGAGCAGGG - Intergenic
942479292 2:176366053-176366075 TGGCATTGAAGTTCTCAGAACGG + Intergenic
944560561 2:200932718-200932740 TGGCAATCTAGTTTTGAGCCTGG + Intronic
945163998 2:206922852-206922874 TGGCCTTGCATTTAAGAGCAGGG - Intergenic
945250398 2:207761174-207761196 AGGCAGAGTGGTTATGAGCATGG - Intronic
945271665 2:207946831-207946853 TGGAAATGGAGTTCTGAGCAGGG - Intronic
946598582 2:221333898-221333920 TGGCATTATAGTTACAAGAAGGG + Intergenic
948458238 2:238117157-238117179 TGGCATTGGAGCCAGGAGCAAGG + Intronic
1169015618 20:2290411-2290433 AGGCATAGTAGTTAAGACCAGGG + Intergenic
1171040164 20:21755512-21755534 GGGCATTTTGTTTATGAGCAAGG - Intergenic
1171076188 20:22126670-22126692 TGGCATTGTAGTCATCTGAAAGG - Intergenic
1172262868 20:33583817-33583839 TGGCATGGTTGGTATGAGAAGGG - Intronic
1172834906 20:37867013-37867035 TGGCATTGTAAGCAAGAGCAAGG + Intronic
1172869888 20:38129477-38129499 TGGCCTCGTGGTTATTAGCAAGG - Exonic
1173892512 20:46523905-46523927 TTGCATAATAGTTATGAGCTTGG - Intergenic
1173902250 20:46599483-46599505 TGGCAGTGTAGTTAAGATCATGG - Intronic
1174573723 20:51523009-51523031 TGGTTTTCTGGTTATGAGCATGG - Intronic
1175413462 20:58786323-58786345 TGGCACTGCAGCTAAGAGCACGG + Intergenic
1175618518 20:60423694-60423716 TGGCCTTGTACTTATGAACCAGG + Intergenic
1178198574 21:30377096-30377118 TAGCATGGTAGTTACGATCAAGG + Intronic
1182696430 22:32202112-32202134 TGGCTTTGTAGTTAGAAGAAAGG - Intronic
1182802023 22:33039268-33039290 TGGCATAGTAGCTTTGAGCATGG - Intronic
1183131190 22:35838393-35838415 GGGCATTTTGTTTATGAGCAAGG + Intronic
950129712 3:10533819-10533841 TGGCATTTGAATTAGGAGCATGG - Intronic
952021164 3:29022584-29022606 GAGCATAGTAGTTAAGAGCAAGG + Intergenic
952234532 3:31464987-31465009 TGGTATTGCAGTTAAGAGCATGG + Intergenic
955494288 3:59515372-59515394 TGGCATCGTGGTTAACAGCAGGG + Intergenic
956562430 3:70594905-70594927 TGGCATTTTTGTTATGAAAATGG + Intergenic
960517903 3:118622637-118622659 TGGCATTGTGGTTAAGAGCATGG - Intergenic
960746141 3:120891108-120891130 TTGCATTGTAGTGGTGAGAATGG + Intergenic
960776935 3:121266989-121267011 TAGCATTGAATCTATGAGCACGG - Intronic
962192584 3:133327150-133327172 TGGCATTTTTCTTCTGAGCAGGG - Intronic
962308231 3:134307560-134307582 TGGAATCCTAGTCATGAGCAGGG + Intergenic
962353022 3:134669449-134669471 TGGCAGTGCAGTAATGAGGAGGG + Intronic
962637631 3:137347108-137347130 TGGCATTGTGGTTAAGACCTGGG + Intergenic
962885102 3:139617356-139617378 TGGCATGGTGGTTATGTGCATGG + Intronic
962901444 3:139765441-139765463 TGGGGTAGTCGTTATGAGCACGG - Intergenic
964538632 3:157754947-157754969 TTGCATTATAATTATGAGCTGGG + Intergenic
964869121 3:161293580-161293602 TAGCATGGTGGTTAGGAGCACGG + Intergenic
966022646 3:175234738-175234760 TGGCATTGTGGTTAAGTGCAAGG + Intronic
968625293 4:1624160-1624182 TGGCATTGTGGGCATGGGCATGG + Intronic
970434351 4:16018973-16018995 TAGCACAGTAGTTAAGAGCACGG + Intronic
970676139 4:18452516-18452538 TGGCAGGGTGGTAATGAGCAAGG + Intergenic
974874346 4:67685012-67685034 TGGCATAATAGTTAAGAGTATGG - Intronic
976417940 4:84800975-84800997 TAGTTTTGTCGTTATGAGCAGGG - Intronic
977478915 4:97548474-97548496 TGGGAATGTAGTTGTGAACAAGG - Intronic
979318086 4:119290405-119290427 TGGCATCATGGTTAAGAGCACGG + Intronic
979562802 4:122119401-122119423 TGGCATGGTGGCTGTGAGCAGGG - Intergenic
981059108 4:140401020-140401042 TGGCATAGTGGTTAACAGCATGG + Intronic
981244155 4:142514562-142514584 TAGCGCTGTAGTTAAGAGCATGG + Intronic
981753314 4:148114646-148114668 TGGCATTGTGGTTAAGAGGCAGG - Intronic
983005522 4:162479830-162479852 TCATATTGTAGTTGTGAGCAGGG - Intergenic
983283456 4:165709897-165709919 TGGCACTATAGTTATCTGCAGGG - Intergenic
985387569 4:189463394-189463416 TGGCATTGTGTTTGTGAGCGTGG - Intergenic
987058258 5:14216939-14216961 TGGCATAGCAGTTAAGAGCCTGG - Intronic
987558328 5:19484373-19484395 TGACATTGTGGTGTTGAGCAGGG - Intronic
988435184 5:31165837-31165859 TAGCACTGTAGGTAGGAGCATGG - Intergenic
989112977 5:37925424-37925446 TGGAACTGTAGCTTTGAGCACGG + Intergenic
989165489 5:38429971-38429993 GGGCCTTGTGGTTAAGAGCAGGG + Intronic
989345254 5:40422693-40422715 TGGCATTTGAGTTTTGAGAATGG - Intergenic
991039828 5:62163525-62163547 TGGTATTGTAGTTATGAAAGAGG + Intergenic
993478225 5:88390787-88390809 TGGCATAGACGTTAAGAGCAAGG - Intergenic
993551196 5:89276022-89276044 TGGCATAGTAGTTAAGAACATGG - Intergenic
993921534 5:93810779-93810801 TAGCATGGTGGTTATGAGCATGG + Intronic
996626927 5:125581066-125581088 TAGAAGAGTAGTTATGAGCATGG + Intergenic
998976275 5:147652394-147652416 TTGCGTAGCAGTTATGAGCATGG + Intronic
999103801 5:149050879-149050901 GAGCATTGTAGTTTTGAACAAGG + Intronic
999136768 5:149325618-149325640 TGACATTCCTGTTATGAGCAGGG - Intronic
1000201638 5:159016638-159016660 TGGCATTGCAGTCATAGGCATGG - Intronic
1000383361 5:160648814-160648836 TTGCATTGTAGGTAAGAACAGGG - Intronic
1001574417 5:172752773-172752795 TGGCAGAGTGGTTAAGAGCAAGG - Intergenic
1003023492 6:2532000-2532022 ATGCATTGTGGTTAAGAGCATGG + Intergenic
1003653790 6:7986884-7986906 AGGCATTGTAGTGATGAGCAGGG - Intronic
1004231345 6:13836357-13836379 TCACATCCTAGTTATGAGCATGG - Intergenic
1004352607 6:14903363-14903385 TGGTATTATGGTTAGGAGCATGG + Intergenic
1004561133 6:16752050-16752072 TGGCATCTTAGATAAGAGCATGG - Intronic
1005160362 6:22853388-22853410 TGGCATAGTGGTTAAGAGCTTGG - Intergenic
1005809196 6:29503326-29503348 TGGCTTTGCAGTTATGAGCATGG + Intergenic
1006270211 6:32959324-32959346 TGGCATTATAGTTATGTTAAGGG - Intronic
1006734093 6:36260021-36260043 TGGGATTATAGGTATGAGCCTGG - Intronic
1007252777 6:40507539-40507561 TGGCACTGAGGTTAAGAGCAGGG - Intronic
1009524231 6:64723173-64723195 TGGCAAAGTTGTTAAGAGCATGG - Intronic
1010489566 6:76459199-76459221 TGGCATTGGAGGTGTGAGTACGG - Intergenic
1013199694 6:107881388-107881410 AGGCATTGTAAGGATGAGCAGGG - Intronic
1013489479 6:110631557-110631579 TGCCATTACAGTTATGAGAATGG - Intronic
1015467620 6:133564856-133564878 TGGAATTTTAGTTATAAGCCTGG - Intergenic
1015733451 6:136372197-136372219 TGGCATTGTACTTATGTGTATGG + Intronic
1016888428 6:148981378-148981400 TGGCATAGTGGTTAAGAACAAGG - Intronic
1017297840 6:152819321-152819343 TGGCATTGTAGTTAAAAATATGG + Intergenic
1017605461 6:156128081-156128103 TGGCATTGGTGGTATGAGAAAGG + Intergenic
1017749587 6:157479089-157479111 TGGCATTGTGATTAGGAGCATGG + Intronic
1018054338 6:160038887-160038909 TTGCCTTGTGGTTATGAGCACGG + Intronic
1018347968 6:162922249-162922271 AGGCATGCTAGATATGAGCAAGG - Intronic
1018642806 6:165920226-165920248 TGGCATTGTAGTTTTGATTAGGG - Intronic
1020781672 7:12524112-12524134 TAGAATAGTAGTTAAGAGCATGG + Intergenic
1022178675 7:27897303-27897325 TTGCATTTTAGTTAAGAGCATGG + Intronic
1022262373 7:28718833-28718855 TGGCATTGTAGGGTTGGGCAGGG - Exonic
1022392208 7:29952989-29953011 TGGCATTGTGATAATTAGCAAGG - Intronic
1022475942 7:30709647-30709669 TAGCACAGTAGTTAAGAGCATGG - Intronic
1022921448 7:35019887-35019909 TGGGATTATAGTCATGAGCCTGG - Intronic
1023480220 7:40626083-40626105 TGGTATGGTAGTTAAGAACAAGG - Intronic
1024328287 7:48131076-48131098 TGGCATTGCTCTTATGAGAAGGG - Intergenic
1024365587 7:48516829-48516851 GGGCATAATGGTTATGAGCATGG - Exonic
1024485423 7:49912105-49912127 TGCCACTGTACTTATGAGGAAGG + Exonic
1025620535 7:63166199-63166221 TTGCATAGTAGTTATGCGCTTGG + Intergenic
1026368513 7:69674335-69674357 TGGCATAGTGGTTAAGACCAGGG + Intronic
1031393291 7:121242239-121242261 TAGCATTATAGTTAAGAGCATGG + Intronic
1031686207 7:124733820-124733842 TGGCAATGTAAATAAGAGCAGGG - Intergenic
1032408303 7:131673894-131673916 TGGCACTGTGGTTAGGAGCATGG - Intergenic
1034622489 7:152466877-152466899 TGGGATTATAGTCATGAGCCCGG + Intergenic
1035003826 7:155640567-155640589 TGGCATGTTGGTTATGAACAGGG - Intronic
1036070521 8:5437348-5437370 TGGCAGTGTAATCAAGAGCAGGG + Intergenic
1038373978 8:27019497-27019519 TGGCAGTGTATTTATGAGACTGG - Intergenic
1040885575 8:52259783-52259805 TTGCCTTGTGGTTAAGAGCATGG - Intronic
1041442137 8:57908447-57908469 TGGCATGGTAGTAAGGAGTAGGG - Intergenic
1042707738 8:71679708-71679730 TGGCAGTGTAAATAAGAGCAGGG - Intergenic
1042837032 8:73088411-73088433 TGGGATTGTAGGTGTGAGCCAGG - Intronic
1042892169 8:73624662-73624684 TGGTATAGCAGTTATGAGCATGG - Intronic
1043465259 8:80499826-80499848 TGCCATTGAAGTTATGACCGTGG + Exonic
1043583247 8:81737580-81737602 TGGTGTTGTAGTTAAGAGCCTGG + Intronic
1044596985 8:93969315-93969337 TGGCATTTGAGTTCTGAGAATGG - Intergenic
1044925526 8:97205716-97205738 TGGCAGTGTAATCAAGAGCAGGG - Intergenic
1047351362 8:124077910-124077932 AGGCACTGAAGTTATGAGGAAGG - Intronic
1048169418 8:132091297-132091319 TTGCATAGAAGCTATGAGCATGG + Intronic
1050145864 9:2566771-2566793 TGGCATAGTGGTTAAGAGCAAGG - Intergenic
1051045812 9:12872244-12872266 TGACATGGTAGTTACGAACATGG + Intergenic
1054828271 9:69595393-69595415 TGGAATTGTAGTTAATAGAATGG + Intronic
1056544737 9:87604250-87604272 TGGCATTGTGGTCAGGAGAATGG + Intronic
1059963480 9:119590165-119590187 TGGCATTGTAGTGATGCCTATGG + Intergenic
1061416428 9:130449593-130449615 TGGTCTTGTACCTATGAGCAGGG + Intronic
1061480173 9:130893922-130893944 TGGCAGCGTAGATGTGAGCAGGG + Intergenic
1061655472 9:132086732-132086754 TGGCATGGTGGTTATGATCAGGG - Intergenic
1186249976 X:7655526-7655548 TTGCATTCTAGTTACCAGCAGGG + Intergenic
1187535618 X:20139321-20139343 TTGCATAGTGGTTAAGAGCATGG - Intronic
1189626175 X:42899378-42899400 TGGCATTTTAGTGCTTAGCAGGG + Intergenic
1191879629 X:65832138-65832160 TGGTATAGTGGTTAAGAGCATGG + Intergenic
1191959164 X:66680589-66680611 CAGCATTGTGGTTATAAGCATGG - Intergenic
1192349038 X:70340057-70340079 CAGCATGGTAGTTAAGAGCATGG + Intronic
1193531330 X:82658093-82658115 TGGCTATGTGGTTATGAGCTTGG - Intergenic
1195062570 X:101210578-101210600 TAGCATAGTAGTTACCAGCATGG - Intergenic
1196966995 X:121066987-121067009 TGTGATTGTAGAAATGAGCATGG - Intergenic
1197274340 X:124460794-124460816 TGGCATAGTGGTTAAGAGAATGG - Intronic
1197471372 X:126868077-126868099 TGGCAGTGTAATCAAGAGCAGGG - Intergenic
1197778225 X:130134589-130134611 TTGCTCTGTAGTTGTGAGCAAGG - Intronic
1198638405 X:138726285-138726307 TGGCAGAGTGGTTAAGAGCATGG + Intronic
1198734827 X:139773778-139773800 TAGCATAGTTGTTATAAGCATGG + Intronic
1199399651 X:147382882-147382904 TGGCATAGTAGTTTAGAGAATGG - Intergenic
1200003896 X:153075185-153075207 TGGCGTGGTAGTCTTGAGCAGGG + Intergenic
1200769950 Y:7115128-7115150 TGTCATTGTAGTCATGAGTTAGG + Intergenic
1201528206 Y:14960199-14960221 AGGCAATGAAGTTATGAGTATGG + Intergenic