ID: 1143258798

View in Genome Browser
Species Human (GRCh38)
Location 17:5583575-5583597
Sequence TGCTCAGAGGAAGGCCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 9, 3: 35, 4: 357}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143258790_1143258798 6 Left 1143258790 17:5583546-5583568 CCCCCTTTGAGAGGGCAGTTCCA 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1143258798 17:5583575-5583597 TGCTCAGAGGAAGGCCTGGCAGG 0: 1
1: 0
2: 9
3: 35
4: 357
1143258791_1143258798 5 Left 1143258791 17:5583547-5583569 CCCCTTTGAGAGGGCAGTTCCAT 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1143258798 17:5583575-5583597 TGCTCAGAGGAAGGCCTGGCAGG 0: 1
1: 0
2: 9
3: 35
4: 357
1143258789_1143258798 13 Left 1143258789 17:5583539-5583561 CCTGGATCCCCCTTTGAGAGGGC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1143258798 17:5583575-5583597 TGCTCAGAGGAAGGCCTGGCAGG 0: 1
1: 0
2: 9
3: 35
4: 357
1143258792_1143258798 4 Left 1143258792 17:5583548-5583570 CCCTTTGAGAGGGCAGTTCCATG 0: 1
1: 0
2: 1
3: 12
4: 151
Right 1143258798 17:5583575-5583597 TGCTCAGAGGAAGGCCTGGCAGG 0: 1
1: 0
2: 9
3: 35
4: 357
1143258786_1143258798 29 Left 1143258786 17:5583523-5583545 CCAGCATAGTCTGGGGCCTGGAT 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1143258798 17:5583575-5583597 TGCTCAGAGGAAGGCCTGGCAGG 0: 1
1: 0
2: 9
3: 35
4: 357
1143258793_1143258798 3 Left 1143258793 17:5583549-5583571 CCTTTGAGAGGGCAGTTCCATGT 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1143258798 17:5583575-5583597 TGCTCAGAGGAAGGCCTGGCAGG 0: 1
1: 0
2: 9
3: 35
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143258798 Original CRISPR TGCTCAGAGGAAGGCCTGGC AGG Intronic