ID: 1143264685

View in Genome Browser
Species Human (GRCh38)
Location 17:5627501-5627523
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143264685_1143264693 26 Left 1143264685 17:5627501-5627523 CCACTTGTGAGTATTCTGGCCAG No data
Right 1143264693 17:5627550-5627572 CCAGCTTCAGCCACTGGACATGG No data
1143264685_1143264694 27 Left 1143264685 17:5627501-5627523 CCACTTGTGAGTATTCTGGCCAG No data
Right 1143264694 17:5627551-5627573 CAGCTTCAGCCACTGGACATGGG No data
1143264685_1143264691 20 Left 1143264685 17:5627501-5627523 CCACTTGTGAGTATTCTGGCCAG No data
Right 1143264691 17:5627544-5627566 TGATAGCCAGCTTCAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143264685 Original CRISPR CTGGCCAGAATACTCACAAG TGG (reversed) Intergenic
No off target data available for this crispr