ID: 1143264689

View in Genome Browser
Species Human (GRCh38)
Location 17:5627532-5627554
Sequence GCTGGCTATCAACTGGAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143264689_1143264693 -5 Left 1143264689 17:5627532-5627554 CCGAGTTCCAGTTGATAGCCAGC No data
Right 1143264693 17:5627550-5627572 CCAGCTTCAGCCACTGGACATGG No data
1143264689_1143264694 -4 Left 1143264689 17:5627532-5627554 CCGAGTTCCAGTTGATAGCCAGC No data
Right 1143264694 17:5627551-5627573 CAGCTTCAGCCACTGGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143264689 Original CRISPR GCTGGCTATCAACTGGAACT CGG (reversed) Intergenic
No off target data available for this crispr