ID: 1143264691

View in Genome Browser
Species Human (GRCh38)
Location 17:5627544-5627566
Sequence TGATAGCCAGCTTCAGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143264687_1143264691 -6 Left 1143264687 17:5627527-5627549 CCCAGCCGAGTTCCAGTTGATAG No data
Right 1143264691 17:5627544-5627566 TGATAGCCAGCTTCAGCCACTGG No data
1143264688_1143264691 -7 Left 1143264688 17:5627528-5627550 CCAGCCGAGTTCCAGTTGATAGC No data
Right 1143264691 17:5627544-5627566 TGATAGCCAGCTTCAGCCACTGG No data
1143264686_1143264691 1 Left 1143264686 17:5627520-5627542 CCAGCAGCCCAGCCGAGTTCCAG No data
Right 1143264691 17:5627544-5627566 TGATAGCCAGCTTCAGCCACTGG No data
1143264685_1143264691 20 Left 1143264685 17:5627501-5627523 CCACTTGTGAGTATTCTGGCCAG No data
Right 1143264691 17:5627544-5627566 TGATAGCCAGCTTCAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143264691 Original CRISPR TGATAGCCAGCTTCAGCCAC TGG Intergenic
No off target data available for this crispr