ID: 1143264693

View in Genome Browser
Species Human (GRCh38)
Location 17:5627550-5627572
Sequence CCAGCTTCAGCCACTGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143264688_1143264693 -1 Left 1143264688 17:5627528-5627550 CCAGCCGAGTTCCAGTTGATAGC No data
Right 1143264693 17:5627550-5627572 CCAGCTTCAGCCACTGGACATGG No data
1143264687_1143264693 0 Left 1143264687 17:5627527-5627549 CCCAGCCGAGTTCCAGTTGATAG No data
Right 1143264693 17:5627550-5627572 CCAGCTTCAGCCACTGGACATGG No data
1143264685_1143264693 26 Left 1143264685 17:5627501-5627523 CCACTTGTGAGTATTCTGGCCAG No data
Right 1143264693 17:5627550-5627572 CCAGCTTCAGCCACTGGACATGG No data
1143264689_1143264693 -5 Left 1143264689 17:5627532-5627554 CCGAGTTCCAGTTGATAGCCAGC No data
Right 1143264693 17:5627550-5627572 CCAGCTTCAGCCACTGGACATGG No data
1143264686_1143264693 7 Left 1143264686 17:5627520-5627542 CCAGCAGCCCAGCCGAGTTCCAG No data
Right 1143264693 17:5627550-5627572 CCAGCTTCAGCCACTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143264693 Original CRISPR CCAGCTTCAGCCACTGGACA TGG Intergenic
No off target data available for this crispr