ID: 1143272613

View in Genome Browser
Species Human (GRCh38)
Location 17:5686971-5686993
Sequence GTGCAGATGCTCAGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143272609_1143272613 18 Left 1143272609 17:5686930-5686952 CCCAGGTACAGGAAAGGGACAGC No data
Right 1143272613 17:5686971-5686993 GTGCAGATGCTCAGAGAGGAAGG No data
1143272610_1143272613 17 Left 1143272610 17:5686931-5686953 CCAGGTACAGGAAAGGGACAGCA No data
Right 1143272613 17:5686971-5686993 GTGCAGATGCTCAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143272613 Original CRISPR GTGCAGATGCTCAGAGAGGA AGG Intergenic
No off target data available for this crispr