ID: 1143273360

View in Genome Browser
Species Human (GRCh38)
Location 17:5692110-5692132
Sequence CCATCAGAGGTTCCTACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143273360_1143273368 1 Left 1143273360 17:5692110-5692132 CCCACTGTAGGAACCTCTGATGG No data
Right 1143273368 17:5692134-5692156 GTGGGCACAGTCTATCTCAGTGG No data
1143273360_1143273369 2 Left 1143273360 17:5692110-5692132 CCCACTGTAGGAACCTCTGATGG No data
Right 1143273369 17:5692135-5692157 TGGGCACAGTCTATCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143273360 Original CRISPR CCATCAGAGGTTCCTACAGT GGG (reversed) Intergenic
No off target data available for this crispr