ID: 1143276009

View in Genome Browser
Species Human (GRCh38)
Location 17:5711395-5711417
Sequence GTGTCTTTCCAGAGGTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143276009_1143276017 7 Left 1143276009 17:5711395-5711417 CCCACCTACCTCTGGAAAGACAC No data
Right 1143276017 17:5711425-5711447 TTGGAGCGGCTGCTGGCTCCTGG No data
1143276009_1143276015 -7 Left 1143276009 17:5711395-5711417 CCCACCTACCTCTGGAAAGACAC No data
Right 1143276015 17:5711411-5711433 AAGACACTGGAGTCTTGGAGCGG No data
1143276009_1143276019 15 Left 1143276009 17:5711395-5711417 CCCACCTACCTCTGGAAAGACAC No data
Right 1143276019 17:5711433-5711455 GCTGCTGGCTCCTGGGCAGCTGG No data
1143276009_1143276018 8 Left 1143276009 17:5711395-5711417 CCCACCTACCTCTGGAAAGACAC No data
Right 1143276018 17:5711426-5711448 TGGAGCGGCTGCTGGCTCCTGGG No data
1143276009_1143276016 0 Left 1143276009 17:5711395-5711417 CCCACCTACCTCTGGAAAGACAC No data
Right 1143276016 17:5711418-5711440 TGGAGTCTTGGAGCGGCTGCTGG No data
1143276009_1143276021 27 Left 1143276009 17:5711395-5711417 CCCACCTACCTCTGGAAAGACAC No data
Right 1143276021 17:5711445-5711467 TGGGCAGCTGGTGCTAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143276009 Original CRISPR GTGTCTTTCCAGAGGTAGGT GGG (reversed) Intergenic
No off target data available for this crispr