ID: 1143284912

View in Genome Browser
Species Human (GRCh38)
Location 17:5781744-5781766
Sequence CTGCAGGTACAGGTGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 2, 2: 4, 3: 43, 4: 439}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143284912 Original CRISPR CTGCAGGTACAGGTGGAGGA TGG Intronic
900378667 1:2373062-2373084 CTGCAGGCCCCGGTGGAGCAGGG - Intronic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900421895 1:2559365-2559387 CTTCAGGTACTGGTGGAGGTGGG - Intronic
900506260 1:3031092-3031114 CTGAAAGTAAATGTGGAGGAGGG - Intergenic
900578617 1:3396533-3396555 CTGCTGGTGCACGTGAAGGAAGG + Exonic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901147753 1:7078358-7078380 CTGGGGGTAGAGGTGAAGGAGGG + Intronic
901324396 1:8358212-8358234 CTGCTGGTGGAGGTGGAGGTGGG + Exonic
901646008 1:10717072-10717094 CTGGAGGGACAGGAGCAGGAGGG + Intronic
902288740 1:15423162-15423184 CTCCAGCTCCAGGTGGAGGCTGG + Intronic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
902657880 1:17881983-17882005 CTGCAGGCAGAGGAGGAGGGTGG + Intergenic
902693784 1:18126839-18126861 CTGGTGGTAGGGGTGGAGGATGG - Intronic
902777288 1:18682919-18682941 GTGCAGGGACAGGTGGAGAAGGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903482240 1:23662168-23662190 TTTCAGGTACCTGTGGAGGATGG - Intergenic
903668707 1:25022915-25022937 CTGCAGAGAGAAGTGGAGGAGGG - Intergenic
904318436 1:29681162-29681184 CTGCACGCACAGCTGCAGGAAGG + Intergenic
904439050 1:30517820-30517842 CTGCACGCACAGCTGCAGGAAGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
905968292 1:42117645-42117667 CGGCAGGTACAGATGCTGGAAGG + Intergenic
907444359 1:54498584-54498606 CTGCTGGTCTAGGTGGGGGAGGG - Intergenic
907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG + Exonic
908797159 1:67841974-67841996 CTGCAGGTAGAGTTGGAGCCAGG - Intergenic
910199021 1:84678626-84678648 TGGCAGGTAGAGGTGGAGAAAGG + Intronic
910730056 1:90385319-90385341 CTGCAGCCACTGGTGGAGAATGG - Intergenic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912415835 1:109507906-109507928 CAGCAGGTGCAGGTCGAGGACGG - Exonic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
912944814 1:114076120-114076142 CTCCCGGTAGAGGTGGAGGAAGG - Intergenic
913591803 1:120336133-120336155 CTGCAGGCCCAGGTGGATTAGGG + Intergenic
913651553 1:120919013-120919035 CTGCAGGCCCAGGTGGATTAGGG - Intergenic
914506904 1:148297249-148297271 CTGCAGATACAGTAGGAAGATGG - Intergenic
914599002 1:149181814-149181836 CTGCAGGCCCAGGTGGATTAGGG - Intergenic
914641732 1:149613116-149613138 CTGCAGGCCCAGGTGGATTAGGG - Intergenic
914910750 1:151784142-151784164 ATTTAGGCACAGGTGGAGGAAGG - Intronic
915118705 1:153615560-153615582 CAGCAGCTACAGGTTGGGGAAGG + Intronic
915545650 1:156595913-156595935 CTGCAGGGAAAGTTGGTGGAGGG + Intronic
916306767 1:163344403-163344425 CTGGAAGTACAGGTGGAAGAGGG + Intronic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
916666581 1:166973211-166973233 CTCCAGGTGCAGGTGGCAGAAGG + Intronic
916714055 1:167435081-167435103 CTGGAGGTAGGGCTGGAGGAGGG - Intronic
917601389 1:176577748-176577770 CTGCACGTACATGTGTGGGACGG + Intronic
919676881 1:200392799-200392821 CTACTGGTAAAGGCGGAGGAGGG - Intergenic
920200572 1:204257527-204257549 CTGCAGGGACAGGCGGCGCAGGG + Exonic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
922215936 1:223520027-223520049 CTAAAGGTACACATGGAGGAAGG - Intergenic
922352802 1:224748098-224748120 TTCCAGGTACAGGAGGAGGAGGG - Intergenic
922377913 1:224988048-224988070 TTGGAGGTAGAGGTGGGGGAGGG - Intronic
922414045 1:225403928-225403950 CTGGAGGTACTGGTGGAGCCAGG - Intronic
922754935 1:228090436-228090458 CTGCAGGGAGAGGTGGGGGTAGG + Intronic
923006900 1:230057500-230057522 CTGCAGCTGAAGGTGGGGGACGG + Intergenic
923087016 1:230709804-230709826 CAGCAGGTCCAGGAGGTGGACGG + Intronic
923488066 1:234455327-234455349 CTGCAGGTACATCTGCAGAATGG - Intronic
923859838 1:237882538-237882560 CTACAGGAACACCTGGAGGATGG + Exonic
924064484 1:240208169-240208191 CTCCGGGTAGAGGGGGAGGAGGG - Exonic
924064551 1:240208334-240208356 CTCCAGGTAGAGGGGGCGGAGGG - Exonic
924145918 1:241074487-241074509 CTTCAGGTACAGCTGGAGCCAGG + Intronic
924821157 1:247491889-247491911 CTTCAGGTACACGTAGATGATGG - Intergenic
1062852875 10:759242-759264 GTGCAGGGAAAGGTGAAGGAGGG + Intergenic
1062982526 10:1737185-1737207 AGGCAGGTGCAGGTGCAGGAGGG - Exonic
1063072704 10:2682130-2682152 CTGCAGGTGGAGGTGGCAGAAGG + Intergenic
1063481150 10:6377835-6377857 CTCCAGGAGAAGGTGGAGGATGG + Intergenic
1063579161 10:7290165-7290187 CTGCAATTTCAGGTGGAGGAAGG + Intronic
1064537647 10:16374209-16374231 CTGCAGGGAGAGGTGCAGGGAGG + Intergenic
1067298484 10:44989658-44989680 CTGCCTGTGCAGGTGGAAGATGG + Exonic
1068667790 10:59695835-59695857 CTTTAGGTACATATGGAGGAAGG + Intronic
1069950343 10:72014367-72014389 CTGCAGGAAGAGGCAGAGGAGGG + Intergenic
1071718617 10:88120859-88120881 CTTCAGGTGAAGGAGGAGGAAGG - Intergenic
1072740685 10:97907345-97907367 CTGCAGGTAGAGAAGGGGGAGGG + Intronic
1073568745 10:104558050-104558072 CTGCAGGTGCTGGTGAAGGATGG + Intergenic
1074053856 10:109904373-109904395 TTGCATGTAGAGGTGGATGAAGG - Intronic
1074375628 10:112938814-112938836 CTGAAGGGACAGGGAGAGGAGGG + Intergenic
1074643306 10:115414231-115414253 GTGCAGGGCAAGGTGGAGGAGGG - Intronic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1074867585 10:117553861-117553883 CTGCAGGTGGAGGTGGGGGCAGG - Intergenic
1075272252 10:121062456-121062478 CTGCAGGTCCCTTTGGAGGAAGG - Intergenic
1075943465 10:126411054-126411076 CTGCAGGTAGAAGTGGAAGCTGG - Intergenic
1075977127 10:126705663-126705685 CTGAACTTACAGGTGGAGGCTGG + Intergenic
1076702700 10:132282426-132282448 GTGCAGGTACAGGTGGGCGCAGG - Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077128334 11:955383-955405 CAGCAGGTACAGGAGGATGCTGG - Intronic
1077287250 11:1773083-1773105 GTCCAGGCACAGGTGGGGGAGGG + Intergenic
1077326566 11:1966606-1966628 CAGCAGGCACCGGGGGAGGAGGG - Intronic
1077919425 11:6631734-6631756 CTCCTGGTGCAGGTGCAGGATGG - Exonic
1078050300 11:7960095-7960117 CTGGAGGTAAAGGAGCAGGAAGG - Exonic
1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG + Intronic
1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG + Intergenic
1082009684 11:47441734-47441756 CTGCAGAGCCAGGTGGGGGATGG + Intronic
1082731024 11:56797879-56797901 GTGCAGTCACAGGTTGAGGAGGG - Intergenic
1082936118 11:58658628-58658650 CTGCAGGTGCAGGAGGAGAGAGG + Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083457731 11:62790183-62790205 CTGCAGGAAGAGGTGGAGGGGGG - Exonic
1083800141 11:65041752-65041774 CTGCAGGCCCAGGTGCAGGAGGG + Exonic
1084564385 11:69920935-69920957 CAGCAGCCACAGGTGCAGGAGGG + Intergenic
1084800891 11:71543182-71543204 CAGCAGCTGCAGGTGGAGGAGGG + Intronic
1086370691 11:86152647-86152669 CTAGAGTGACAGGTGGAGGAAGG - Intergenic
1087182602 11:95154646-95154668 CTGCAGGAGCATTTGGAGGAGGG - Intergenic
1087424517 11:97970515-97970537 CTGAAGGTGCAGTTGGAGGAAGG + Intergenic
1090437939 11:126702490-126702512 CGTCAGGGAGAGGTGGAGGAGGG + Intronic
1090472479 11:126992484-126992506 CTTCAGGAACTGGTGGAGGCTGG - Intronic
1090612108 11:128480452-128480474 CTGGAGGTAAAGGAGGAGGTAGG + Intronic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1090901727 11:131038025-131038047 CTGCAGGTGGAGTTGGGGGAGGG - Intergenic
1091006785 11:131960870-131960892 CTGAAGATTCAGGTGCAGGAGGG + Intronic
1202809547 11_KI270721v1_random:21785-21807 CAGCAGGCACCGGGGGAGGAGGG - Intergenic
1092040802 12:5382520-5382542 CTGCAGGGACAGGCAGAGAAGGG - Intergenic
1092252208 12:6905822-6905844 CTGCAGGTAGAAGTGGAGTAAGG - Intronic
1094026081 12:25960379-25960401 CTGCAGGGAGAGGTGCAGGGTGG + Intronic
1094136778 12:27136106-27136128 ATGAAGGAAGAGGTGGAGGATGG + Intergenic
1094186516 12:27648863-27648885 ATGAAGGGAGAGGTGGAGGATGG + Intronic
1094474878 12:30833334-30833356 CTTCAGCTGGAGGTGGAGGATGG - Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1096867402 12:54572963-54572985 TTGCAGGTTCGGATGGAGGAAGG + Intronic
1097861608 12:64523634-64523656 CTCCAGTTACAGGAGGAGGAAGG - Intergenic
1097945892 12:65366958-65366980 CTTAAGGGACAGGAGGAGGAGGG + Intronic
1098245203 12:68509922-68509944 CTGCAGGTGCAGGAGAAGAAGGG + Intergenic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1100606221 12:96154188-96154210 CTGCAGGTCCAGGTGAGAGATGG - Intergenic
1102339382 12:112109553-112109575 GTCCAGGAACAGGTGGTGGAGGG - Intergenic
1103598811 12:122041145-122041167 CGGCAGGTTGAGGTAGAGGAGGG + Intronic
1104391010 12:128390567-128390589 GTGCGGCTACAGGTGGAGGCAGG - Intronic
1104595076 12:130115345-130115367 CTGCAGGTCTAGCTGGAGGCAGG + Intergenic
1105278073 13:18947758-18947780 CTGCAGGTCCATGTGCAGGTGGG - Intergenic
1106415269 13:29541048-29541070 CTGCAGCCACAGGTGGGAGAAGG + Intronic
1112158607 13:96845576-96845598 GTGCAGGTACAGATGGTTGAGGG - Intergenic
1112210784 13:97375082-97375104 GTGCAGGTGGATGTGGAGGACGG + Intronic
1113749632 13:112768244-112768266 CTGCTGGTAGAGGTGGAGGCGGG - Intronic
1113788562 13:113015604-113015626 CTGTAGGTGCAGGTGCGGGATGG - Intronic
1113824792 13:113243341-113243363 CTGCATGCATGGGTGGAGGAGGG + Intronic
1114083583 14:19220853-19220875 TGGCAGATACAGGAGGAGGATGG + Intergenic
1114519517 14:23324413-23324435 CTGCCTGTGCAGGTTGAGGAAGG + Intronic
1114574864 14:23703025-23703047 CAGCAAGGACAGTTGGAGGAAGG + Intergenic
1115348568 14:32368563-32368585 CTAGAGGTAGAGGTGGGGGAAGG + Intronic
1117690111 14:58298001-58298023 CTGGAGGAAACGGTGGAGGACGG + Intronic
1120655859 14:87189155-87189177 CTGTAGGTCAAGGTTGAGGATGG - Intergenic
1121223281 14:92302413-92302435 CTGGAGGCTGAGGTGGAGGATGG + Intergenic
1121339170 14:93094741-93094763 CTGCAGGCACAGGGAGAGGCAGG + Intronic
1121610041 14:95272303-95272325 CTCCAGGAAGAGGAGGAGGAGGG + Intronic
1121679085 14:95777553-95777575 CTCCAGGCCCAGGGGGAGGAAGG - Intergenic
1122540615 14:102495893-102495915 CGGGAGGTGCAGGTGGAGGGAGG + Intronic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1202895194 14_GL000194v1_random:2622-2644 TGGCAGATACAGGAGGAGGATGG + Intergenic
1127311868 15:57759535-57759557 ATGCAGCTGCAGGTGGAGAAGGG - Intronic
1128810665 15:70569587-70569609 CTGGGGTTAAAGGTGGAGGAAGG + Intergenic
1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG + Intergenic
1129236366 15:74225987-74226009 TGTCAGGTCCAGGTGGAGGAAGG - Intergenic
1129388359 15:75208019-75208041 CTGCAGGCAAAGGTGCCGGACGG - Exonic
1129672838 15:77616617-77616639 TTGCAGGTGCAGGGGGAGGAGGG - Intronic
1129946807 15:79545644-79545666 CTACTGGGACAGGTGAAGGAGGG - Intergenic
1130276063 15:82476929-82476951 CTGCAGGTTCACCTGGAGGAAGG + Intergenic
1130468423 15:84204320-84204342 CTGCAGGTTCACCTGGAGGAAGG + Intergenic
1130485323 15:84395430-84395452 CTGCAGGTTCACCTGGAGGAAGG - Intergenic
1130495843 15:84469222-84469244 CTGCAGGTTCACCTGGAGGAAGG - Intergenic
1130527705 15:84721524-84721546 CTGCAGGGACAGCTGTAAGAGGG + Intergenic
1130990835 15:88874772-88874794 GTGCAGGGACAGGGGGAGAAGGG + Exonic
1131340848 15:91599241-91599263 CTGCAAGTGCAGGTGGGAGATGG + Intergenic
1132786414 16:1659234-1659256 CTGCAGGAAGAGGTGCCGGATGG - Intronic
1133492898 16:6288713-6288735 CTGCTGGTACAGCTGAAGCAAGG + Intronic
1133994739 16:10739911-10739933 TTGCAGGACCAGGAGGAGGAGGG + Intergenic
1134672823 16:16068297-16068319 GTGCAGGTACAGGGGGAAGCTGG + Exonic
1135222623 16:20625740-20625762 CTGCCTGTACTGATGGAGGACGG + Intronic
1136013346 16:27379143-27379165 CTGCACACACAGGCGGAGGATGG - Intergenic
1136377241 16:29872744-29872766 CTGCAGGGAGAGGAGGGGGAGGG + Intronic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1137587251 16:49671055-49671077 CTGCAGCTGCATGTGAAGGAAGG - Intronic
1137660822 16:50204526-50204548 CTGCAAGTATAGGAGGAGGCTGG + Intronic
1137979258 16:53055665-53055687 CTGGAGGAATAGGAGGAGGAGGG - Intronic
1138543884 16:57705165-57705187 CTGCAGGGCCAGGTAGAGGTTGG - Intronic
1139558541 16:67727734-67727756 CTGCAGGTACAGGATGAGCCGGG - Exonic
1139578454 16:67857342-67857364 CTGCAGGCAGAAGAGGAGGAAGG + Intronic
1139659562 16:68411482-68411504 CTGCAGGCATGGGTGGAGGCTGG + Intronic
1140110103 16:71996880-71996902 CTACAGGTACAGGTGCTGGTAGG + Intronic
1140479228 16:75253519-75253541 ATGCAGCTACTGGGGGAGGAGGG - Intronic
1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG + Intronic
1140830370 16:78745301-78745323 TTGAAGGCAGAGGTGGAGGAAGG - Intronic
1141036470 16:80630632-80630654 CTTCTGTTACAGGCGGAGGATGG + Intronic
1141440540 16:84026867-84026889 CTGCGGGCAGAGGTGGAGAATGG + Intronic
1142889347 17:2932941-2932963 CTCCAGGCACAGGTCGAGGCTGG + Intronic
1143139570 17:4733721-4733743 CTGCGGGTACAGGAGGATGCAGG + Exonic
1143140632 17:4740045-4740067 CTGCAGGTACCGGAGGAGTGGGG + Exonic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284923 17:5781800-5781822 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284929 17:5781834-5781856 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284946 17:5781924-5781946 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143301180 17:5911725-5911747 TTGCAGGTCCAGGGGAAGGAGGG + Intronic
1144807167 17:17975771-17975793 CGGAAGGCACAGGTGGAGAAGGG + Intronic
1144878013 17:18412353-18412375 CTGCGGGGAGAGGGGGAGGAGGG + Intergenic
1144968622 17:19093395-19093417 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1144979293 17:19158668-19158690 TTGCAGGAAGAGGAGGAGGAGGG - Exonic
1144988929 17:19219564-19219586 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1145154217 17:20532072-20532094 CTGCGGGGAGAGGGGGAGGAGGG - Intergenic
1146271935 17:31490285-31490307 CTACGGGTACAGATGAAGGAGGG - Intronic
1146437489 17:32864215-32864237 TTACAGGTAGAGGTGGAGTAGGG - Intronic
1146932069 17:36784593-36784615 CTGCAAGTTCAGGAGCAGGATGG - Intergenic
1147426203 17:40346993-40347015 CTGCAGGTAAGGGGGGAGGGTGG + Intronic
1147862269 17:43530475-43530497 CTGCGAGTTCAGGGGGAGGAGGG + Intronic
1147976954 17:44253308-44253330 CAGCAGGTCCAGGTGGAAGCCGG + Exonic
1147995822 17:44359878-44359900 GTGCAGGGGCAGGTGGAGGGGGG - Intronic
1148038697 17:44689338-44689360 CTGCAGGTACACAGAGAGGAAGG - Intronic
1148131906 17:45267199-45267221 CTGCAGGGAAAAGTGGAAGATGG + Intronic
1148686533 17:49504046-49504068 ATGCAGCTGGAGGTGGAGGAGGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150932796 17:69603554-69603576 ATGCTGGTAGATGTGGAGGATGG + Intergenic
1151403492 17:73871659-73871681 CTGCAGGCTCAGGTGCAGCAGGG - Intergenic
1151475883 17:74344200-74344222 CTGACGGGACAGGTGGGGGAGGG - Intronic
1151602337 17:75113934-75113956 CTCCAGGTGCAGGGGAAGGACGG + Intronic
1152335464 17:79698018-79698040 CTGCAGGAGCAGGTGGGGGTGGG + Intergenic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG + Intergenic
1154500262 18:14992515-14992537 TGGCAGATACAGGAGGAGGATGG + Intergenic
1155320509 18:24614184-24614206 CTGCAGGGCCAGCTGTAGGAGGG + Intergenic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1156789148 18:40950831-40950853 CTTGGGTTACAGGTGGAGGATGG - Intergenic
1157165842 18:45357668-45357690 CTGCAGCTTCAGGCAGAGGAGGG + Intronic
1158497595 18:57970444-57970466 CACCAGATCCAGGTGGAGGAGGG + Intergenic
1159884248 18:73889136-73889158 GTGCATGTCCAAGTGGAGGATGG - Intergenic
1160607148 18:80059681-80059703 CTGCAGGAAGAGGGGGCGGAGGG + Intronic
1160984589 19:1832452-1832474 CTGCAGGGACAGCGGGAGGCCGG + Intronic
1161082369 19:2317680-2317702 CTGCAGGTTCCGAAGGAGGACGG - Intronic
1161316595 19:3620273-3620295 CTGCAGGCACAGGAGGCTGAGGG + Intronic
1161431218 19:4233441-4233463 CTCCACGTACTGGTAGAGGAGGG - Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161468493 19:4445048-4445070 CTGCAGGTCTATGTGCAGGAAGG + Exonic
1161595768 19:5150352-5150374 CTGCAGGTGGAGTTTGAGGACGG + Exonic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161682726 19:5687985-5688007 CTCCAGGGACAGTTGGAGGGAGG - Exonic
1161793923 19:6375799-6375821 CTGCAGGGACAGGAGCAGCAGGG + Exonic
1161845830 19:6711458-6711480 CTGCCTTTAAAGGTGGAGGAAGG + Intronic
1161879475 19:6937668-6937690 CTGCAGGTGCTGGTCGAGGGAGG + Intronic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1162387474 19:10368521-10368543 CTGAAGCTGCAGGTGGGGGAGGG - Intronic
1162527045 19:11212152-11212174 CTGCAGGGACAGGGGCGGGAGGG + Intronic
1165467369 19:35982891-35982913 CAGCAGGTACAGGAGGAGGAAGG - Intergenic
1166079448 19:40434389-40434411 CTGCAGGGAAAGGGGGAGGGCGG + Intergenic
1166794969 19:45420486-45420508 GTGCAAGAAGAGGTGGAGGAGGG - Intronic
1166806128 19:45488477-45488499 CTGCCGGTACAGCAGGGGGATGG + Exonic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167580125 19:50336545-50336567 CTGGATGTACTGGTGGAGCAGGG - Intronic
1167608005 19:50492136-50492158 CTGAAGGTGCAGGGAGAGGAAGG + Intergenic
925123606 2:1438156-1438178 GTGCAGGTACATGTTGAGGGTGG + Intronic
927633791 2:24796799-24796821 CTGCAGGTGAAGGTGGATAAGGG + Intronic
927851953 2:26504859-26504881 CTGTAGGTCCAGGTGGAGCCAGG + Intronic
928131267 2:28652877-28652899 CTGCACATACAGTTGGAAGATGG - Intergenic
931311347 2:61084026-61084048 CTGAAGGTACAGGTTGTGGCTGG - Intronic
932056015 2:68445100-68445122 CTGCTGGTACAGGAGGACAATGG + Intergenic
933817713 2:86081462-86081484 CTCCAGGTGCAGGTGGTGGGAGG - Intronic
933985124 2:87584424-87584446 CTGCAGGGATAGGCGGAGGGAGG - Intergenic
934628862 2:95892927-95892949 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934629269 2:95898536-95898558 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934629684 2:95904152-95904174 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934630095 2:95909764-95909786 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934803825 2:97197375-97197397 CTGCAGGAACTGCTGGAAGAAGG + Intronic
934804243 2:97202980-97203002 CTGCAGGAACTGCTGGAAGAAGG + Intronic
934832816 2:97548798-97548820 CTGCAGGAACTGCTGGAAGAAGG - Intronic
936308717 2:111366387-111366409 CTGCAGGCATAGGCGGAGGGAGG + Intergenic
938201476 2:129376405-129376427 CTCCAGGTGCAGGTGTTGGAAGG - Intergenic
938343796 2:130552358-130552380 CAGGAGGCCCAGGTGGAGGAGGG - Intergenic
938346037 2:130568364-130568386 CAGGAGGCCCAGGTGGAGGAGGG + Intergenic
938451281 2:131423812-131423834 CTTCAGGTTCAACTGGAGGATGG + Intergenic
938493005 2:131775780-131775802 TGGCAGATACAGGAGGAGGATGG - Intergenic
942312979 2:174672730-174672752 CTGCAGGAACAGGGAGAAGATGG - Intronic
943195815 2:184747712-184747734 CAGGAGGTACATGTGTAGGATGG + Intronic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
944423770 2:199557948-199557970 TTGCTTGTACAGGTGGTGGAGGG + Intergenic
944921741 2:204421298-204421320 CTGGAGGTGGAGGTGGAGGCTGG - Intergenic
946211405 2:218150196-218150218 ATGCAGGAAAGGGTGGAGGAAGG - Intergenic
946380994 2:219348894-219348916 CTGCAAGCACAAGTGAAGGAAGG + Intergenic
947591595 2:231388964-231388986 GTGGTGGGACAGGTGGAGGAGGG + Intergenic
947927474 2:233934241-233934263 GTGCAGGGAGAGGTGGAGGCAGG - Intronic
948329884 2:237156459-237156481 CTGCAGGTAGGGGAGGAGGCTGG + Intergenic
948505564 2:238425127-238425149 GTGGAGGTGCAGGTGCAGGAGGG + Intergenic
1168799387 20:634575-634597 CTGCAGCTTGAGGAGGAGGAAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1172408669 20:34706931-34706953 CTTCAGGTACTGGGGGAGTATGG + Intronic
1172461986 20:35126120-35126142 TTGGAGGGACAGGTTGAGGATGG - Intronic
1175441015 20:58991325-58991347 CTGCATGAACAGGTCCAGGAAGG - Exonic
1175705121 20:61171084-61171106 CTGGAGTTACAGCTAGAGGAAGG - Intergenic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1176614896 21:9018609-9018631 TGGCAGATACAGGAGGAGGATGG + Intergenic
1176710314 21:10145262-10145284 TGGCAGATACAGGAGGAGGATGG - Intergenic
1178408725 21:32346993-32347015 CTGGAGGTACACATGGATGAGGG + Exonic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179479929 21:41670532-41670554 CTGCAGCAACAGGAGGTGGAGGG + Intergenic
1180063652 21:45402265-45402287 TGGCAGGTGCAGGTGGAGGCAGG + Intergenic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180294393 22:10872414-10872436 TGGCAGATACAGGAGGAGGATGG - Intergenic
1180497199 22:15901828-15901850 TGGCAGATACAGGAGGAGGATGG - Intergenic
1182031865 22:27165462-27165484 TTTCAGGTAGAGTTGGAGGAGGG + Intergenic
1182526404 22:30923087-30923109 CTGCAGTTACTGGAGCAGGAAGG + Intergenic
1182736286 22:32533879-32533901 CTGCAGGTACAGGCTGTGGGTGG - Exonic
1183066785 22:35368877-35368899 CTTCAGTTACAGGAGGAGGTGGG - Intergenic
1183264878 22:36818984-36819006 CAGCAGGGAGAGATGGAGGAAGG - Intronic
1183377289 22:37472590-37472612 ATCCTGGCACAGGTGGAGGAGGG + Intronic
1184498878 22:44860051-44860073 CAGCAGGTACAGGAGCAGGCAGG - Intronic
1185099037 22:48827895-48827917 ATGCAGCTTCAGGTGGAGGCGGG + Intronic
1185247446 22:49780658-49780680 CTGGTGGTCCAGGTGGAGGCTGG - Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949295542 3:2518009-2518031 CTGCAGGGAGAGGTAGGGGAGGG - Intronic
949579842 3:5376935-5376957 CTGCAGCTTGACGTGGAGGAGGG + Intergenic
949894623 3:8760042-8760064 CTGCAGGTCCAGTTGGCGCATGG - Intronic
950102573 3:10367045-10367067 CCCCAGGCACGGGTGGAGGAGGG - Intronic
950105166 3:10384045-10384067 TTTCAGGCACAGGAGGAGGAAGG - Intronic
952960805 3:38588032-38588054 CAGCAGGTAGATGAGGAGGAAGG - Intronic
953202764 3:40792211-40792233 CTCCAGGTTCATGTGGAGGCAGG - Intergenic
953476757 3:43211875-43211897 CAGAAGGTACAGGTGGAAGGCGG + Intergenic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954191147 3:48962412-48962434 CTGCTGGTAGAGGTGGTGGGTGG - Intronic
954962705 3:54580363-54580385 CCGCAGGGACAGGTCGAAGAGGG - Intronic
955348901 3:58179977-58179999 GGGCAGGGAGAGGTGGAGGAGGG - Intergenic
956103396 3:65791597-65791619 AGGCAGGAAGAGGTGGAGGATGG + Intronic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
956683529 3:71803634-71803656 CTGCAGGATCAGGTGGAGTCTGG + Intergenic
958255599 3:91321304-91321326 CTGTAGGAACATGTTGAGGAGGG - Intergenic
959664135 3:108902688-108902710 CAGCTGGTCCAGGAGGAGGACGG - Intergenic
959731676 3:109610935-109610957 CAGCAGCTAGAGGAGGAGGATGG + Intergenic
960639550 3:119812803-119812825 CTGCAGCTGCGGGGGGAGGATGG + Exonic
960747810 3:120908789-120908811 CTGCGGGCAGAGGTGGAGGGAGG + Intronic
961543857 3:127618548-127618570 GTGCAGGTGCAGGTGAGGGAAGG - Intronic
961562400 3:127739832-127739854 CTGCATGCACACTTGGAGGATGG - Intronic
961735847 3:129001786-129001808 CTGCAGGTACTGGTCCAGGCCGG - Exonic
967247070 3:187498859-187498881 CTTCAGGTACAGGCCCAGGAAGG - Intergenic
967715221 3:192754694-192754716 CTGCAGGTTCTGGTATAGGATGG - Intronic
968518115 4:1023360-1023382 CTGCAGGCCCCGGGGGAGGAGGG - Intronic
968646162 4:1741629-1741651 CTGCAGGTGCAGCTGGAAGAGGG + Intronic
968662222 4:1803402-1803424 GGGCGGGTGCAGGTGGAGGATGG - Intronic
968900088 4:3426809-3426831 CTGCAGGTGCAGGTGCCGTAGGG + Intronic
969220231 4:5754332-5754354 CTGCAAGTCCAGGAGAAGGAAGG + Intronic
969304872 4:6319869-6319891 CTTCAGGTTCAGCAGGAGGAAGG - Intergenic
969719144 4:8883466-8883488 CTACGGGTACAGGTGGACTAAGG - Intergenic
970967853 4:21948794-21948816 CTGCAGGTGCGGGCGGAGGCCGG + Exonic
971451509 4:26805641-26805663 CTGTAGGTAAGGGTGGAGGTGGG - Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
971725808 4:30310319-30310341 CTGCATTTCCAGGTGGAGTATGG - Intergenic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
973267344 4:48224124-48224146 CTGAATGTACAGGTGGAGTTGGG + Intronic
976278734 4:83305677-83305699 CACCAGATACAGTTGGAGGAAGG + Intronic
977362688 4:96026199-96026221 GTGAAGGTACAGGTGTAGGATGG - Intergenic
979579085 4:122334523-122334545 CTGCAGGAATAGGTGGGGGCTGG - Exonic
980190175 4:129514984-129515006 CTGCAGCTAAAGATGGAAGATGG + Intergenic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
982116465 4:152102596-152102618 CTTCAGCTACAGCTGGAGCAGGG - Intergenic
983423763 4:167555855-167555877 CTGGAGGTGCAGGTGGGGCAAGG + Intergenic
984631912 4:182070135-182070157 GTGGAGGCACAGGTGGGGGAAGG + Intergenic
984638833 4:182142567-182142589 GTACAGGTACAGGTGGAGGTCGG + Intergenic
985229333 4:187798522-187798544 CTGCAGCTGCTGCTGGAGGATGG - Intergenic
985337389 4:188911432-188911454 ATGCAGGTGCAGATGGAGGTTGG - Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
987061159 5:14245439-14245461 CTTCATCTACAAGTGGAGGAGGG - Intronic
988503034 5:31799286-31799308 CTGCAGCCACTGGTAGAGGAGGG - Exonic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
991126583 5:63076526-63076548 ATGCAGGTAGAGTTGAAGGAAGG - Intergenic
992620692 5:78589608-78589630 ATGCGGGTGCAGGTTGAGGAGGG - Intronic
993007139 5:82440926-82440948 AAGCAGGTAGAGGAGGAGGATGG - Intergenic
993064024 5:83076700-83076722 CTGGAGGTAAAAGAGGAGGAAGG + Intronic
995525552 5:113047939-113047961 CTGCCGGCAGAGGAGGAGGAAGG - Intronic
997214647 5:132100761-132100783 ATGCAGGTGCAGCTGGAGGAAGG - Intergenic
998512969 5:142729002-142729024 CTACAGGCACAGCTGAAGGATGG - Intergenic
999295858 5:150459061-150459083 GGGCAGGTACACGTGGAGGGTGG + Intergenic
1000844175 5:166258314-166258336 CTGCAGTTAAAGGAGGAGGAAGG + Intergenic
1002170048 5:177369868-177369890 CTGCAGGAGCAGGTGGAGTGTGG - Intronic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1002604780 5:180376154-180376176 GTGCACATGCAGGTGGAGGATGG - Intergenic
1002636465 5:180611298-180611320 CTGCAGGTCCAGGAGTAGGGTGG - Intronic
1003395747 6:5750578-5750600 TTGCAGGTGCAGGAGGAAGAAGG + Intronic
1003684980 6:8293800-8293822 GTGCAGGTTAATGTGGAGGAAGG + Intergenic
1003810941 6:9779898-9779920 CTGCAGGTACAGGCAGATGGGGG + Intronic
1004165192 6:13250717-13250739 CTGCAGGAAAAGGTGGGGGCTGG + Intronic
1005881648 6:30067037-30067059 CTGCGGGTGTGGGTGGAGGAGGG - Intronic
1006436489 6:34028355-34028377 CTGGATGTACAGCTGGCGGAGGG + Exonic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1007385584 6:41518216-41518238 CTGCATGTAAACATGGAGGAAGG + Intergenic
1007509846 6:42366515-42366537 ATGCAGGTGCAGGAAGAGGAGGG - Intronic
1007821364 6:44562800-44562822 CTGCAAGTCCAGGTGGAGAATGG - Intergenic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1015393832 6:132713522-132713544 TTTCTGGTACAGATGGAGGATGG - Intronic
1016035175 6:139376514-139376536 CTACAGGTAAAGGTGGTGGGAGG - Intergenic
1016834301 6:148461982-148462004 GTGCATGTACAGGGGGAGGCAGG - Intronic
1016868496 6:148793444-148793466 CTGCAGTTAGAGGCGGTGGAGGG - Intronic
1017646221 6:156542116-156542138 CTGCAGATAGATGGGGAGGATGG + Intergenic
1018572305 6:165224470-165224492 CTGCAGATATAGCTGGAGAAGGG - Intergenic
1021510835 7:21430117-21430139 GTGCAGGTAGTGGAGGAGGAGGG - Exonic
1021704087 7:23349884-23349906 CTGCAGGTAACGGTGGATCAAGG + Intronic
1022455934 7:30558542-30558564 CTCCTGGTACAGGGGAAGGAAGG + Intergenic
1022857750 7:34332227-34332249 CTGAAGTTGCAGGTGCAGGAAGG - Intergenic
1023320669 7:38994374-38994396 CTGCAGGTCCCAGAGGAGGAAGG + Intronic
1023838831 7:44084179-44084201 CTGCTGGCACAAGGGGAGGATGG - Intergenic
1023911562 7:44560251-44560273 CTGCAGGTTCTGATGGAAGAGGG + Intergenic
1024353909 7:48395229-48395251 CTCCAGTTGCAGGTGGAGGATGG + Intronic
1024485446 7:49912538-49912560 ATGCAGGTACACGGTGAGGACGG - Exonic
1024678102 7:51656114-51656136 ATCGAGGTCCAGGTGGAGGAAGG + Intergenic
1028311066 7:89336605-89336627 CTGCAGGAACGTGTGGTGGATGG - Exonic
1029154762 7:98508247-98508269 CTGGGGGTAGAGGTGGTGGAGGG + Intergenic
1029223984 7:99011864-99011886 CTGCTGCTCCAAGTGGAGGAAGG + Intronic
1031905627 7:127457422-127457444 CTGCAGCTTGAGGTGGAGAAGGG - Intergenic
1032506212 7:132436486-132436508 GTGAAGGTGCAGGTGGAGGAAGG - Intronic
1032544148 7:132727927-132727949 CTAGTGGTGCAGGTGGAGGAAGG - Exonic
1033337134 7:140463444-140463466 TTGCAGGTATAGCTAGAGGAAGG - Intronic
1034119602 7:148615581-148615603 CTGCAGGTACACGTGGAACTTGG - Exonic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034438550 7:151075296-151075318 CAGCAGGTCCAGGTGGAAGCCGG - Exonic
1034835911 7:154351529-154351551 CTCCAGGTGCAGGTGCAGGTGGG - Intronic
1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG + Intergenic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1037577975 8:20225772-20225794 CTTCTGGTGGAGGTGGAGGAGGG - Intronic
1037644230 8:20775762-20775784 CTGAAGGAACAGGTGGTGGCTGG + Intergenic
1038271871 8:26081924-26081946 CTGAAGGCACCTGTGGAGGAAGG - Intergenic
1040521549 8:48180593-48180615 CTGCAGGCTCAGGTAGAGGAAGG - Intergenic
1041780167 8:61569103-61569125 ATACAGGCACAGGTAGAGGATGG + Intronic
1043280634 8:78461295-78461317 CTGCAGGAACTTGTGGAGAATGG + Intergenic
1043527085 8:81109004-81109026 CTGCAGCTACACGTGCAGGCAGG + Intronic
1044413369 8:91909746-91909768 CTGCTGGAAGAGGAGGAGGAAGG + Intergenic
1045510253 8:102807597-102807619 CCCCCGGGACAGGTGGAGGAGGG + Intergenic
1045646286 8:104302812-104302834 CTGCAGGTACAGGTGCTTGCAGG + Intergenic
1047012799 8:120690770-120690792 CTCCAGGTACAGGCTGAGCAGGG - Intronic
1047728956 8:127709995-127710017 CTTCAGGTACAGTTGGATCAAGG - Intergenic
1048006328 8:130422217-130422239 CAACAGCTGCAGGTGGAGGAAGG + Intronic
1048734119 8:137479337-137479359 GTGCTGGTACAGGTGGAAAATGG + Intergenic
1048765827 8:137843416-137843438 CTGGAGGCAGAGGTCGAGGAGGG - Intergenic
1049363387 8:142224956-142224978 CTGCAGGCTCAGGTGGGGAAGGG - Intronic
1049540946 8:143208537-143208559 CTGCAGGAACAGGAGAAGGCAGG - Intergenic
1049641954 8:143719844-143719866 CTGAGGGAAGAGGTGGAGGAAGG + Intronic
1049674810 8:143884718-143884740 CTGCAGGAACAGGAGGTGCAGGG - Intergenic
1049688961 8:143950446-143950468 GTGCAGGTACTGGCGGAGGTGGG + Exonic
1049799939 8:144513029-144513051 GTGCAGGTGCAGGTGCAGGCTGG + Exonic
1052812721 9:33075820-33075842 TGGCAAGGACAGGTGGAGGATGG + Intronic
1053647289 9:40130960-40130982 TGGCAGATACAGGAGGAGGATGG - Intergenic
1053758437 9:41332883-41332905 TGGCAGATACAGGAGGAGGATGG + Intergenic
1054328289 9:63728916-63728938 TGGCAGATACAGGAGGAGGATGG - Intergenic
1054537290 9:66245210-66245232 TGGCAGATACAGGAGGAGGATGG + Intergenic
1055582439 9:77721341-77721363 CTTCAGGTTCAACTGGAGGATGG + Exonic
1056208829 9:84345663-84345685 TGGCAGGTACAGTTGGAGAATGG - Intergenic
1056367768 9:85922865-85922887 CTGGAGGTTCAGGTGGAGCCAGG + Intergenic
1056832935 9:89931244-89931266 CAGCAGGAAGAGGTGCAGGAAGG + Intergenic
1056946853 9:91005026-91005048 CTGCAGGGATAGGTGGAGCTCGG - Intergenic
1057210178 9:93196882-93196904 CTGCAGGCCCAGGCAGAGGAGGG - Intronic
1057227959 9:93302378-93302400 CTGCAAGTAGAGGAGGAGCAGGG + Intronic
1057398447 9:94701255-94701277 ATACAGGGCCAGGTGGAGGATGG - Intergenic
1057563314 9:96146077-96146099 ATGGGGGTACTGGTGGAGGAAGG + Intergenic
1058804650 9:108579040-108579062 GGACAGGTACAGCTGGAGGAGGG + Intergenic
1059338965 9:113586676-113586698 CTGAAGCTACTGGTGGAAGAGGG - Intronic
1060268501 9:122125993-122126015 CTGCAGGTACAGCAGCAGGCAGG - Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060750471 9:126165279-126165301 CTGCAGGAACAGGAGGAAGTGGG - Intergenic
1060785884 9:126451386-126451408 CTGCACCTCCAGGTGGAGGAGGG + Intronic
1060948650 9:127586566-127586588 CTGCAGGTCCAGGGAGCGGATGG - Intergenic
1061746343 9:132743002-132743024 CTGAAGGAACAAGGGGAGGAGGG + Intronic
1062076693 9:134593580-134593602 CTCCAGGCGCAGGTGGAGGATGG - Intergenic
1062301853 9:135878065-135878087 CACCAGGGAAAGGTGGAGGAAGG + Intronic
1062391282 9:136334921-136334943 CAGCAGTTACAGTTTGAGGAGGG + Intronic
1062396217 9:136353892-136353914 CTGCAGGTCCAGGCAGAGGGTGG - Intronic
1062400727 9:136371532-136371554 GGGCAGGGACAGGTGGAGGCTGG + Intronic
1062722645 9:138052461-138052483 CTGCCGGGACAGGTGCAGGGTGG + Intronic
1202795078 9_KI270719v1_random:114257-114279 TGGCAGATACAGGAGGAGGATGG - Intergenic
1203489574 Un_GL000224v1:90656-90678 CTGCAGATGCAGGTGGGTGAGGG - Intergenic
1203502196 Un_KI270741v1:32544-32566 CTGCAGATGCAGGTGGGTGAGGG - Intergenic
1186810977 X:13188119-13188141 CTGTAGGTACAGGATGAGTACGG + Intergenic
1187181507 X:16947141-16947163 CCGCAGGGACAGGAGGCGGAGGG - Intronic
1187474960 X:19602396-19602418 CTGTAAGTACAGCTGGAGAAGGG + Intronic
1188137224 X:26504941-26504963 CTTCAGGTAGAGGGGGTGGAAGG - Intergenic
1188137266 X:26505082-26505104 CTTCAGGTAGAGGGGGTGGAGGG - Intergenic
1189302109 X:39959662-39959684 CAGCAGGGAAAGATGGAGGAGGG + Intergenic
1189424101 X:40882610-40882632 CTTCAGGTACAGATGGGGAAAGG + Intergenic
1189898617 X:45682607-45682629 CTGAGGATAGAGGTGGAGGATGG - Intergenic
1190311469 X:49119815-49119837 CTACAGGTTCAGGTAGAGGAAGG + Intronic
1192175990 X:68885858-68885880 CTCCAGGCAAAGGTGGTGGAAGG + Intergenic
1192829952 X:74741174-74741196 CGGCAGGTCCAAATGGAGGATGG - Exonic
1193508671 X:82372862-82372884 CTGCAATCACAGGTGGAGGGAGG + Intergenic
1193640217 X:84003226-84003248 GTGCAAGTATAGGTGGAGGAGGG - Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195844991 X:109217142-109217164 CTGCAGGTATAGGGAGAGGTTGG + Intergenic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1202088496 Y:21163704-21163726 GAGCAGGTGCAGATGGAGGAAGG + Intergenic
1202372803 Y:24209866-24209888 CAGCAGGTTCACCTGGAGGAAGG + Intergenic
1202497979 Y:25460254-25460276 CAGCAGGTTCACCTGGAGGAAGG - Intergenic