ID: 1143284917

View in Genome Browser
Species Human (GRCh38)
Location 17:5781766-5781788
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 3, 1: 1, 2: 4, 3: 61, 4: 570}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901143156 1:7048634-7048656 GCTCAGGGACAGGTGGTGGTGGG - Intronic
901839416 1:11944706-11944728 GCTGCGGTGCTGGGGGAGGAGGG - Intronic
901871069 1:12139558-12139580 AGCCAGGTGGAGGTGGAGGAAGG - Intronic
902043745 1:13510642-13510664 GCACAAATGCAGGAGGAGGAGGG + Intronic
902044464 1:13514260-13514282 GTTCAAGTGCAGGTGGGGGAGGG - Intergenic
902116404 1:14125229-14125251 GGACAGGGGCAGGGGGAGGATGG - Intergenic
903301297 1:22380438-22380460 GCTGTGGTGGGGGTGGAGGAAGG - Intergenic
903319848 1:22536165-22536187 GCTGTGGGGCAGGTGGAGCACGG + Intergenic
903377726 1:22876976-22876998 ACTCAGCTGCTGGTGGAGGCAGG - Intronic
903655899 1:24948587-24948609 GCAGGGGTGCATGTGGAGGAGGG + Intronic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904392144 1:30193020-30193042 CCTCAGGTGCAGCTGGGAGAAGG - Intergenic
904454408 1:30638751-30638773 GCCCAGGCACAGGTGGAGGGAGG - Intergenic
906312954 1:44766963-44766985 GATGGGGTGCAGGTGGACGATGG + Intronic
906561138 1:46757851-46757873 GCACAGGTGCAGGTCGGGGCAGG - Intronic
906564006 1:46783676-46783698 GTTCTGGTGGAGGTGGTGGAGGG + Intronic
906607203 1:47180891-47180913 GCTCAGGTGGAGGAGGAGAAAGG + Intergenic
906807554 1:48793977-48793999 GGTTAGGTGCTGTTGGAGGAGGG + Intronic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
911055183 1:93702536-93702558 GCTCAGGCCCAGGTGGGGGTGGG + Intronic
911090489 1:94013414-94013436 GCCCAGAGGCAGGTGGAGGTGGG + Intronic
912415835 1:109507906-109507928 CAGCAGGTGCAGGTCGAGGACGG - Exonic
912450253 1:109763881-109763903 GGTCCGGTGCTGGTGGTGGAAGG + Exonic
912953759 1:114138094-114138116 GCTCAGGGGAAGGGGGATGAAGG + Intronic
913231161 1:116741847-116741869 GCGCAGGTGCAGGCCGCGGAGGG - Intergenic
913291418 1:117275950-117275972 GCTAAGGGGCAGGTGCAGGAAGG - Intergenic
914247603 1:145897495-145897517 CCTCAGGTGCCTTTGGAGGAGGG - Exonic
917687407 1:177431398-177431420 TCTCAAGTGCACATGGAGGAAGG - Intergenic
917869734 1:179230068-179230090 GCTCAGGTGCAGGCACAGGTGGG + Intergenic
917900898 1:179542331-179542353 GCTGAGGGGCAGGTGGAGATAGG - Intronic
918399287 1:184147390-184147412 GCACAGGGCCAGGTGGAGGATGG + Intergenic
918702147 1:187618427-187618449 GATCAGGAGCATGGGGAGGAAGG - Intergenic
919839690 1:201599751-201599773 GCTCAGGGACAGGGGGAGGGAGG + Intergenic
920335415 1:205241923-205241945 GCACTGGTGCTGGTGCAGGATGG - Exonic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
921347670 1:214203615-214203637 TCTAAGGGGCATGTGGAGGAGGG - Intergenic
922145617 1:222940785-222940807 ACTGAGGTACAGGTGGAGGTTGG + Intronic
922174944 1:223189650-223189672 GGGCTGGTGCAGGTGGAGGCTGG + Intergenic
922674531 1:227542454-227542476 GCTCCGGCCCAGGAGGAGGAGGG - Intergenic
922796305 1:228341420-228341442 GCTCAGCTGTGGGTGGGGGAGGG - Exonic
922914929 1:229249455-229249477 GCTGAGGTGCAGATGCACGAAGG - Intergenic
922917063 1:229267333-229267355 GCACAGATGCTGGGGGAGGATGG + Intergenic
923181211 1:231521738-231521760 GCTGGGGTGGAGGTGGAGGGGGG - Intergenic
923648276 1:235846124-235846146 TTTCTGGTGCAGGTGGTGGAGGG - Intronic
924456143 1:244220125-244220147 GCTCATCTGCAGGTTCAGGAAGG + Intergenic
924686705 1:246299826-246299848 GCGCACTTGAAGGTGGAGGATGG + Intronic
924708931 1:246518757-246518779 GCTCAGGTGCAGGGAGAGGCAGG - Intergenic
1062807663 10:436528-436550 GCTCAGGTGTGGGTGGAGCATGG - Intronic
1062807697 10:436702-436724 TCTCAGGTGTGGGTGGAGCATGG - Intronic
1062807753 10:436998-437020 GCTCAGGTGTGGGTGGAGCATGG - Intronic
1062807822 10:437345-437367 GCTCAGGTGTGGGTGGAGCATGG - Intronic
1062807845 10:437460-437482 GCTCAGGTGTGAGTGGAGCATGG - Intronic
1062982526 10:1737185-1737207 AGGCAGGTGCAGGTGCAGGAGGG - Exonic
1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG + Intergenic
1063866044 10:10366831-10366853 AGTGAGGAGCAGGTGGAGGAAGG - Intergenic
1065506827 10:26438145-26438167 TCTCGGGTGGGGGTGGAGGAAGG - Intergenic
1065811615 10:29448443-29448465 GGCCAGGTGCGGGTAGAGGAGGG + Intergenic
1065960167 10:30727697-30727719 GGCCAGGTGTGGGTGGAGGAGGG - Intergenic
1067031661 10:42882192-42882214 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1067091372 10:43267153-43267175 GCAAAGGTGCAGGGGGAGGTAGG + Intergenic
1069541460 10:69297325-69297347 GCTGAGGAGGAGGTAGAGGAGGG + Intronic
1069772355 10:70907820-70907842 GCTTTGGGGGAGGTGGAGGAAGG + Intergenic
1070613355 10:77949655-77949677 CCTGAGGGGCTGGTGGAGGATGG + Intergenic
1070914130 10:80141958-80141980 ACTCAGGAGCAAGCGGAGGACGG - Intronic
1071594450 10:86909013-86909035 GCTCTGGGGCAGGGGGAAGAGGG + Intronic
1071718617 10:88120859-88120881 CTTCAGGTGAAGGAGGAGGAAGG - Intergenic
1071882163 10:89911201-89911223 GAGCAGGTGCTGGTGGAGGTAGG + Intergenic
1072442745 10:95471414-95471436 GCTGAGGTTAGGGTGGAGGAGGG + Intronic
1072739239 10:97899834-97899856 GCTCAGGACCAGGTGGGGAAAGG - Intronic
1073176369 10:101559964-101559986 GCTCAGAGGAAGGGGGAGGAAGG - Intergenic
1073206908 10:101774451-101774473 CCCCAGCTGCAGGTGGAGGCAGG - Intronic
1073603518 10:104870501-104870523 GCTGAGGTGCAAGGGGTGGATGG - Intronic
1073915138 10:108394206-108394228 GCACAGGGGCAGGAGGAGTATGG + Intergenic
1074451549 10:113563713-113563735 GCCCAGGTGCAGGTCCTGGAGGG + Intronic
1074452033 10:113567290-113567312 GCACAGGTGGTGGTGGTGGAGGG + Intronic
1074536348 10:114330913-114330935 ACCCAGGTGCAGATGGGGGAGGG + Intronic
1075689439 10:124385704-124385726 TCTCAGGTGCAGGAGGCTGAGGG + Intergenic
1075852450 10:125600295-125600317 GCTCACGTGTAGGCTGAGGAGGG + Intronic
1076130797 10:128012398-128012420 GCTCAGGCTCATGGGGAGGATGG - Intronic
1076404646 10:130203792-130203814 GGACAGGGGCAGGTGGAGGCGGG - Intergenic
1076684405 10:132190804-132190826 GCTGATGTGCACGTGGAAGATGG + Exonic
1076880112 10:133235864-133235886 GTTCAGGTGGAGGTGGTGGCGGG + Intergenic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1077287202 11:1772956-1772978 GCCCAGGCACAGGTGGGGGAGGG + Intergenic
1077435123 11:2535250-2535272 GACCAGGGGCAGGTGGAGCAGGG + Intronic
1077539258 11:3138995-3139017 GCTCAGGTGCCCCTGGAGGGCGG - Intronic
1077550720 11:3199073-3199095 GCTCAGGGGGAGATGGAGGCTGG - Intergenic
1078094261 11:8286967-8286989 GCCAGGGGGCAGGTGGAGGAGGG - Intergenic
1078288647 11:9983681-9983703 GTTCCGGTGGAGGTGGCGGAGGG - Intronic
1078564922 11:12406152-12406174 GCTCAGGTGATTGTGGAGGCTGG + Intronic
1078696789 11:13642080-13642102 GTTCAGGGGCTGGGGGAGGAAGG - Intergenic
1079104270 11:17560462-17560484 GCTCGTGTGCAGGTTGGGGATGG + Intronic
1079114155 11:17630008-17630030 ACCGGGGTGCAGGTGGAGGATGG - Intronic
1079269578 11:18971784-18971806 CCTGAGGTGAAGGTGGAGGGCGG - Intergenic
1081640212 11:44747945-44747967 GCTCTGCTGCAGGTGAGGGAGGG - Intronic
1081677140 11:44976820-44976842 ACTCAGTGGCTGGTGGAGGAGGG + Intergenic
1084219470 11:67668286-67668308 GCACAGGTGCAGGTGGGGGTAGG + Intronic
1084323163 11:68384724-68384746 GGTCAGGAGCATGTGGAGGGTGG + Intronic
1084410431 11:69003400-69003422 GCTGAGGAGCAGGGGCAGGAGGG + Intergenic
1084422662 11:69068126-69068148 GCTCAGGTGCAGGTGTGGCCAGG + Intronic
1084800891 11:71543182-71543204 CAGCAGCTGCAGGTGGAGGAGGG + Intronic
1085024124 11:73226693-73226715 CCTGAGGTGCTGGTGGAGGGTGG + Intronic
1085122078 11:73973693-73973715 GGGCAGGGGCAGGTGGAGGGGGG + Intergenic
1085533847 11:77206604-77206626 CCTCAGGTGGAGAGGGAGGAAGG - Intronic
1085722914 11:78929053-78929075 GCCCAGCTGCAGGTGCAGGGAGG - Intronic
1087093981 11:94303021-94303043 GCGCATATGCAGGTGGAGGGAGG - Intergenic
1087237134 11:95732761-95732783 GCTAGGGTTGAGGTGGAGGATGG - Intergenic
1088049443 11:105493753-105493775 GCTCAAGAGCAGCTGGCGGATGG + Intergenic
1089405837 11:118196672-118196694 GCTCAGGTGGTGGTGGTGGTGGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090620185 11:128553695-128553717 GCTGAGGAGGAGGAGGAGGAGGG - Intronic
1090855582 11:130607322-130607344 GCTGAGGAGGAGGTGGAGGGAGG + Intergenic
1091314060 11:134598428-134598450 GCTCACGTTCCGGTGGGGGAAGG - Intergenic
1091741581 12:2963543-2963565 GCCCAGGTGGAGGTGGGGGCAGG + Intronic
1092132783 12:6124244-6124266 CCTCAGAGGCAAGTGGAGGAGGG + Intronic
1092153376 12:6266603-6266625 GCCCAAGAGCAGGTGGCGGAAGG + Intergenic
1092183657 12:6463036-6463058 GCCCAGGTGCAAGGGGAGGAGGG - Intronic
1092732220 12:11545645-11545667 GCTGAGTGGCAGGGGGAGGAAGG - Intergenic
1093172625 12:15876298-15876320 GTTCTGGTGGAGGTGGTGGAGGG - Intronic
1094474878 12:30833334-30833356 CTTCAGCTGGAGGTGGAGGATGG - Intergenic
1095719675 12:45386839-45386861 GATCAGGTGAAGGTGGTGGTGGG - Intronic
1095933695 12:47654552-47654574 GATCTGGTTTAGGTGGAGGAGGG - Intergenic
1096256099 12:50063273-50063295 GATAAGGTGCAGCTGGAGGATGG - Intronic
1096460200 12:51818180-51818202 GCTCTGGGGCAGGTAGGGGAAGG - Intergenic
1096709682 12:53446159-53446181 GCTCAGGTGGAGGTAGGGGGTGG - Exonic
1096838039 12:54363591-54363613 GCGCCAGTGCAGGTGGAGGTAGG + Exonic
1097151601 12:56983448-56983470 GAACAGGTGCAGGAGGATGAGGG + Intergenic
1097760595 12:63459780-63459802 GCTCTGGTGGAGGTGGTGGGGGG - Intergenic
1099764275 12:86961677-86961699 GCACAGCTGAAGATGGAGGAGGG + Intergenic
1101422669 12:104562395-104562417 ACTCAGGTGCAGGGGGAAGATGG - Intronic
1101699812 12:107162238-107162260 GGTCAGGTCCCTGTGGAGGAGGG - Intergenic
1102038026 12:109783224-109783246 GCTCAGGCGCAGGCTGAGGCTGG + Exonic
1102172473 12:110852746-110852768 GCCAAGGTGTGGGTGGAGGAAGG + Intronic
1102543898 12:113641205-113641227 GCTGGGGTGGAGGTGGAGGAAGG - Intergenic
1102866312 12:116377689-116377711 GCTCAGATATAGATGGAGGAGGG - Intergenic
1103587033 12:121963613-121963635 GCCCACGTGCATGTGCAGGATGG - Intronic
1105775918 13:23659964-23659986 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
1106131961 13:26948334-26948356 GCTCAGATCCAGGTGGCTGAGGG + Intergenic
1107133234 13:36919204-36919226 GGTCAAGGGCAGGAGGAGGAAGG + Intronic
1107804001 13:44137165-44137187 GCCCAGGAGAAGCTGGAGGAGGG + Intergenic
1108313624 13:49218476-49218498 ACTGAAGTGGAGGTGGAGGAAGG + Intergenic
1108431590 13:50359127-50359149 GCTGGGGTGCGGGTGGGGGATGG + Intronic
1108439813 13:50439391-50439413 GCTAAGGTGCAAGTGGTGAAGGG + Intronic
1108934780 13:55870681-55870703 GCTCAGCTGCAGGCTGAGTATGG - Intergenic
1109322001 13:60822367-60822389 GCAAAGTTGCAGGTGGAGGAGGG + Intergenic
1110881602 13:80578405-80578427 GTTCCGGTGGAGGTGGAGGGGGG - Intergenic
1112035308 13:95492054-95492076 GTTCCAGTGGAGGTGGAGGAGGG + Intronic
1112210784 13:97375082-97375104 GTGCAGGTGGATGTGGAGGACGG + Intronic
1112463705 13:99624955-99624977 TCTGAGGTGAAGGTGGGGGAAGG - Intronic
1112578977 13:100662239-100662261 GATCAGGGTGAGGTGGAGGAGGG + Intronic
1113764253 13:112870980-112871002 GCCCAGGTGGCCGTGGAGGAGGG - Intronic
1114173745 14:20300387-20300409 GATCAGGTTCAGGGGGAGAAAGG - Intronic
1116665124 14:47764850-47764872 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1117465185 14:55986226-55986248 GCTGAAGTGTATGTGGAGGAGGG - Intergenic
1118388987 14:65280691-65280713 GCTCTGGTTCAGATGGCGGACGG + Intergenic
1118982140 14:70725510-70725532 ACTCAGGTGCTGGTGTTGGAAGG - Intronic
1119055710 14:71417643-71417665 GCAGAGGTGGAGGAGGAGGAAGG + Intronic
1119087917 14:71754079-71754101 TCTCAGGTGTTGGTGGAGGGAGG - Intergenic
1119171859 14:72541665-72541687 GCTACTGTGCGGGTGGAGGATGG + Intronic
1119181843 14:72610704-72610726 GCTCAAGGGCAGGTGGGAGATGG + Intergenic
1121112509 14:91321950-91321972 GCTCAGGTGCAAATGGAGAAGGG + Intronic
1121559935 14:94866916-94866938 GGGCAGGTGCAGGAGGAAGAGGG + Intergenic
1121609856 14:95270439-95270461 GCTGAGGGGAAGGTGGAGAATGG - Intronic
1122056288 14:99100557-99100579 ACTCAGGTACAGGTGGTGCATGG - Intergenic
1122072367 14:99213017-99213039 GCTCAGGTGAAGGTGGAGACAGG - Intronic
1122309531 14:100785754-100785776 GCTCAGGAGGAGGTTGAGGAAGG - Intergenic
1122480083 14:102041589-102041611 GATCAGGAGCAGGCGGTGGATGG - Exonic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1123006031 14:105324325-105324347 GCTCAGGTGCAGGTGGGAAGGGG + Intronic
1123165800 14:106324109-106324131 GGTCAGGAGCAGGTGCAGGGAGG - Intergenic
1123168497 14:106349137-106349159 GGTCAGGAGCAGGTGCAGGGAGG - Intergenic
1123194755 14:106605971-106605993 GGTCAGGAGCAGGTGCAGGGAGG - Intergenic
1123197039 14:106627103-106627125 GGTCAGGAGCAGGTGCAGGGAGG - Intergenic
1123198380 14:106638973-106638995 GGTCAGGAGCAGGTGCAGGGAGG - Intergenic
1123222814 14:106872684-106872706 GGTCAGGAGCAGGTGCAGGGAGG - Intergenic
1123956649 15:25342807-25342829 GTTGAGGGGCAGGTGGTGGAGGG - Intronic
1124180102 15:27465136-27465158 TCTCAGCTGCTGGTGGAGGGGGG + Intronic
1124594774 15:31083433-31083455 GCACAGCTGCAGGTGGCGGCGGG + Intronic
1125503409 15:40253032-40253054 GCTCAGGTGCAAGAGGCGGCAGG - Intronic
1125721869 15:41849142-41849164 GGTTAGGTGAAAGTGGAGGAGGG - Intronic
1126293729 15:47112770-47112792 GCACATGTGCATGGGGAGGAGGG + Intergenic
1126849257 15:52787610-52787632 GCTGAGATGGAGGTGGAGGTGGG + Intronic
1127262655 15:57337392-57337414 GCTCAGGAGCAGGGAGAGGGCGG + Intergenic
1128514945 15:68336146-68336168 GCTCATGAGCAGGTGAAGGAGGG - Intronic
1128565409 15:68697796-68697818 GCACAGGAGCTGGTGGAGGCTGG + Intronic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1129236366 15:74225987-74226009 TGTCAGGTCCAGGTGGAGGAAGG - Intergenic
1129450497 15:75648547-75648569 GCCCAGGAGCAAGAGGAGGAAGG + Exonic
1129672838 15:77616617-77616639 TTGCAGGTGCAGGGGGAGGAGGG - Intronic
1129758161 15:78111192-78111214 GCTCATGGGCACGTGGACGATGG + Exonic
1129854591 15:78814181-78814203 GCTCAGGAGAATGTGGAGGGAGG + Intronic
1130829445 15:87584489-87584511 GCTCACATGCAGGTGAGGGAAGG - Intergenic
1130953464 15:88610618-88610640 GCTCAGGAGCAGGAGGAGTGGGG - Intergenic
1131382537 15:91975709-91975731 GGTCAGGTGGAGGCGTAGGAAGG - Intronic
1131596004 15:93798889-93798911 TCTCAGGAGCAGCTGTAGGAAGG + Intergenic
1132342481 15:101087173-101087195 GATCAAGTGCAGCTGGAGAAGGG + Intergenic
1132410831 15:101577205-101577227 GCTCTGGTGGAGGTTGGGGATGG - Intergenic
1132529393 16:438107-438129 TCTCAGGAGGAGGTGGGGGAAGG - Intronic
1132584091 16:698586-698608 GCTCCTGTGCATGTGGAGGGTGG - Intronic
1133220373 16:4316910-4316932 GGTCTGGAGCGGGTGGAGGAGGG + Intronic
1133653992 16:7841926-7841948 ACTAAGGTTCAGGTGGAAGAAGG - Intergenic
1135183127 16:20292181-20292203 GGTCAAGTGCAGGGAGAGGAGGG - Intergenic
1135867137 16:26114141-26114163 GCTCAGATGCAGGTGGTGTGGGG + Intronic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1136265037 16:29111260-29111282 GCTTTGGTGGAGGTGGAGGCAGG + Intergenic
1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG + Intronic
1137253439 16:46756972-46756994 GGTGAGGGGCAGGAGGAGGAAGG + Intronic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1138269808 16:55687457-55687479 AGTCAGGTGCAGGTAGAGGTGGG + Intronic
1139484538 16:67248459-67248481 GCTCAGGTCCGGGTGGGGGCCGG + Intronic
1139790848 16:69433529-69433551 GCTGTGGTGAAGGAGGAGGAGGG - Intronic
1140455492 16:75102980-75103002 GTTCTGGAGAAGGTGGAGGATGG - Intronic
1140534189 16:75694048-75694070 GCTCAGGTTCAGGCTGAGAATGG + Intronic
1140641276 16:76976392-76976414 GCTCAGCTGCATGTGTAGGTAGG - Intergenic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141556502 16:84839886-84839908 ACTGAGGTGGAGGTGGAGGTGGG + Intronic
1142053833 16:87979235-87979257 GCTTTGGTGGAGGTGGAGGCAGG + Intronic
1142327581 16:89426330-89426352 ACACAGGAGAAGGTGGAGGAAGG + Intronic
1142352249 16:89585820-89585842 GGTCAGGTGGGGGTGGAGGGGGG + Intronic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1143184765 17:5003564-5003586 GATAAGGTGCGGGTGGGGGACGG - Intronic
1143185606 17:5008219-5008241 GGTCAGGCTCAGGTGGAGGCAGG + Intronic
1143204302 17:5131861-5131883 GCTCAGATGCAGGGAGAGGCAGG + Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284923 17:5781800-5781822 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284929 17:5781834-5781856 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284946 17:5781924-5781946 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143554628 17:7652374-7652396 GCACAGGTGCAGGTGAGGGGTGG + Intronic
1143780596 17:9226833-9226855 GCTCAGATACAGGCGGAGCAAGG + Intronic
1144396863 17:14852820-14852842 GAGCAGGAGCAAGTGGAGGAGGG + Intergenic
1144875370 17:18394551-18394573 GCTCAGATGCAGGGAGAGGCAGG + Intergenic
1145156855 17:20549870-20549892 GCTCAGATGCAGGGAGAGGCAGG - Intergenic
1146160040 17:30554849-30554871 GCTCAGGTGCAGGGAGAGGCAGG + Intergenic
1146380185 17:32322318-32322340 GCTCAGGGGCAGGTGTGGAAGGG - Exonic
1146512359 17:33461118-33461140 GCTGAGGAGCAGGTGGAAGTGGG - Intronic
1146523712 17:33547744-33547766 TCTCAGATGCAGGTGTAGCATGG - Intronic
1146844376 17:36173962-36173984 GCTCGGGTGCAGGGAGAGGCAGG - Intronic
1146856681 17:36261897-36261919 GCTCGGGTGCAGGGAGAGGCAGG - Intronic
1146863936 17:36326478-36326500 GCTCGGGTGCAGGGAGAGGCAGG + Intronic
1146872590 17:36385808-36385830 GCTCGGGTGCAGGGAGAGGCAGG - Intronic
1146879949 17:36436893-36436915 GCTCGGGTGCAGGGAGAGGCAGG - Intronic
1146883871 17:36458044-36458066 GCTCTGGTGCAGGGAGAGGCAGG - Intergenic
1147066796 17:37927066-37927088 GCTCGGGTGCAGGGAGAGGCAGG + Intronic
1147075475 17:37986432-37986454 GCTCGGGTGCAGGGAGAGGCAGG - Intronic
1147078328 17:38006627-38006649 GCTCGGGTGCAGGGAGAGGCAGG + Intronic
1147087000 17:38065978-38066000 GCTCGGGTGCAGGGAGAGGCAGG - Intronic
1147094266 17:38130562-38130584 GCTCGGGTGCAGGGAGAGGCAGG + Intergenic
1147102945 17:38189941-38189963 GCTCGGGTGCAGGGAGAGGCAGG - Intergenic
1147145867 17:38484184-38484206 TCTCAGGGGAAGGGGGAGGATGG + Intronic
1147571136 17:41571861-41571883 CCTCAGGGGGCGGTGGAGGAGGG - Exonic
1147995822 17:44359878-44359900 GTGCAGGGGCAGGTGGAGGGGGG - Intronic
1148201359 17:45752097-45752119 GCCCAGATGGAGGTGGAGGATGG - Intergenic
1148328367 17:46797385-46797407 GTTCAGGGCCAAGTGGAGGAGGG + Intronic
1148332882 17:46822456-46822478 GCGCAGGTGCACGCGGAGGTCGG + Intronic
1149554201 17:57561503-57561525 GGTCAGGTGGGGGTGGAGGTGGG - Intronic
1149847517 17:60016408-60016430 GCTCGGGTGCAGGGAGAGGCAGG - Intergenic
1150264823 17:63825490-63825512 GATCAGGTGATGGTGGAGGTGGG - Intronic
1151214271 17:72567202-72567224 GGTCAGGGGCAGGAGGAAGATGG - Intergenic
1151230261 17:72679678-72679700 GCTGGGTGGCAGGTGGAGGATGG + Intronic
1151566983 17:74904228-74904250 ACTGAGGTTCAGGTGGGGGATGG - Intergenic
1151823962 17:76513185-76513207 GCTCAAGAGGAGGAGGAGGAAGG + Intergenic
1151917568 17:77129670-77129692 GCAGAGCTGAAGGTGGAGGAGGG + Intronic
1152071158 17:78134388-78134410 GGGCAGGTGGAGCTGGAGGAGGG + Exonic
1152237058 17:79144165-79144187 GCTCAGAGGCAGGGGGAGGCAGG - Intronic
1152262588 17:79274996-79275018 GCTCTGGGGCTGGTGGATGATGG - Intronic
1152317357 17:79588914-79588936 GCCCAGGTCCAAGTGCAGGACGG - Intergenic
1152375296 17:79915724-79915746 GTCGAGGGGCAGGTGGAGGAGGG + Intergenic
1152589550 17:81204687-81204709 GGTCCGGTGCAGGTGCAGGCTGG - Intronic
1152589557 17:81204719-81204741 GGTCCGGTGCAGGTGCAGGCTGG - Intronic
1153631026 18:7069802-7069824 TCTCTGGGGCAGCTGGAGGAGGG - Intronic
1153927134 18:9843962-9843984 GCTCTGGGGCAGGTGGAGGAAGG + Intronic
1155068224 18:22287320-22287342 GTTCAGGGGCAGGGAGAGGAAGG - Intergenic
1156372582 18:36484823-36484845 GCTCTGGTGTGTGTGGAGGAAGG + Intronic
1156625582 18:38903663-38903685 GCTGAGGAGCAGGCAGAGGATGG - Intergenic
1157288669 18:46394495-46394517 GCTGGGGGGAAGGTGGAGGATGG - Intronic
1157470541 18:47984721-47984743 GCTCAGGAGCAAGGGGAGCAGGG - Intergenic
1158521773 18:58177101-58177123 GCTCAGGGAGAGGTGCAGGAAGG - Intronic
1159972086 18:74667158-74667180 GCACAGACGCAGGTGGAGAAGGG - Intronic
1160158818 18:76455441-76455463 GCTCAGGGACAGATGGAGGCTGG + Intronic
1160169332 18:76539958-76539980 GCTCACGTGACTGTGGAGGAGGG - Intergenic
1160178583 18:76615506-76615528 GCCCAGCCCCAGGTGGAGGAGGG - Intergenic
1160752376 19:740506-740528 GCTCTGGCCCAGGTGGAGGGAGG - Intronic
1161000649 19:1909182-1909204 GGGCAGATGCAGGTGGGGGAAGG + Intronic
1161021058 19:2011750-2011772 GCTGAGGAGCAGGAGCAGGAGGG - Intronic
1161393307 19:4032297-4032319 GCTGAGGGCCAGGTGGTGGATGG + Intronic
1161535755 19:4817709-4817731 GCTGCGGTGCAGGCTGAGGAAGG + Exonic
1161575163 19:5051013-5051035 CCACAGGTGCAGGTTGGGGAGGG - Intronic
1161576715 19:5058453-5058475 GCTCAGGAGCAGGGGCGGGAAGG + Intronic
1161778940 19:6279078-6279100 GCTCAGGTCCAGGTAGGGGATGG + Intronic
1161877712 19:6924790-6924812 GCAGAGGTGCAGGTGGAGGTAGG - Exonic
1162029186 19:7910029-7910051 GAGCAGGTGCCGGTGGAGGTGGG - Intronic
1162135426 19:8552200-8552222 CCTGGGGTGCAGGTGGGGGAAGG + Intronic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1163510882 19:17734256-17734278 GGTCACCTGCAGGTGGAGGGGGG - Exonic
1164574821 19:29399734-29399756 TCTCTGGGGCAGGTGGAGGATGG - Intergenic
1164712624 19:30368260-30368282 GCTAAGGAGAAGCTGGAGGATGG - Intronic
1164913008 19:32027464-32027486 GAACAGGTGCAGGTGGAGATCGG - Intergenic
1166011039 19:39943113-39943135 GCTCAGGTGGAGGTAGGGGGTGG + Intergenic
1166226905 19:41401635-41401657 GCTCAGGGAAAGGAGGAGGAAGG + Intronic
1166683792 19:44782976-44782998 GCTGAGGTGCAGGGGTAGGACGG + Intronic
1166686655 19:44800497-44800519 GGTCACCTCCAGGTGGAGGAGGG - Intronic
1167566774 19:50261739-50261761 GCTGAGGAGCAGGTGGATGGAGG + Intronic
1168336675 19:55600857-55600879 GCACAGGTGCAGCTGGAAGCAGG - Intronic
1168414610 19:56160302-56160324 GCGCAGGTGGAGGAGGACGATGG - Exonic
924998289 2:384098-384120 GCCCAGTTGCAGGTGCAGGTGGG + Intergenic
925157935 2:1661533-1661555 GCAGGGATGCAGGTGGAGGATGG + Intronic
925239321 2:2309202-2309224 ACTGAAGTGCAGGTGGAGTATGG - Intronic
925277824 2:2662805-2662827 GCTCAGGACCAAGGGGAGGATGG - Intergenic
925292290 2:2755906-2755928 GCTCTGGTGAAGGAGGAAGAGGG - Intergenic
925579408 2:5395358-5395380 TCAAAGGTGGAGGTGGAGGAAGG + Intergenic
925769158 2:7265516-7265538 GCTCAGTGTCAGGAGGAGGAGGG + Intergenic
925994390 2:9280126-9280148 GCTCAGGTGCAGATAGAGTTTGG + Intronic
926065797 2:9838825-9838847 GCGCAGGTGCATGAGGTGGAAGG - Intergenic
927209039 2:20627492-20627514 GACCAGGTGCAGGCGTAGGAAGG - Intronic
927210101 2:20633993-20634015 GCACAGGTGCAGGGTGAGGTCGG + Intronic
927590357 2:24351101-24351123 GATCAAGTGGAGGTGGAGGTGGG - Intronic
928311837 2:30217716-30217738 GCCCAGCAGGAGGTGGAGGAGGG + Intergenic
929443608 2:41985711-41985733 GCCCAGGTGCAGGTGGACATTGG + Intergenic
929548446 2:42873490-42873512 GCTCATGTGATTGTGGAGGATGG + Intergenic
930109066 2:47662781-47662803 GCTCAGAAGAAGGTGGGGGAGGG + Intergenic
931269285 2:60687639-60687661 GCTCAGGTGCAGGCAGGGAATGG + Intergenic
931775034 2:65533130-65533152 GCTCAGGTTCAGGTTCAGGCAGG - Intergenic
932144706 2:69307111-69307133 GCACAGGTGGAGGTGGTGGCAGG + Intergenic
934690375 2:96354065-96354087 GCTCAGGGGAAGGAGGAGGCTGG + Intronic
935007061 2:99089424-99089446 GCTCAAGTGCAGATGCAGGCAGG + Intronic
935307011 2:101746988-101747010 GCTCAGATGCAGGTTGAGGTTGG + Intronic
935534984 2:104283569-104283591 GCTCAGGAGCAGAGGGAGGGGGG + Intergenic
936451362 2:112636149-112636171 GAGCAGGTGCAGGGGAAGGAAGG + Intergenic
936964131 2:118110435-118110457 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
937373433 2:121318719-121318741 GCTCAGGAGGAGGAAGAGGAGGG + Intergenic
937643162 2:124236354-124236376 GCTCCTGGGCAGGTGCAGGAAGG - Intronic
938082738 2:128378866-128378888 GCTCACTTCCAGGAGGAGGAAGG + Intergenic
938408630 2:131046272-131046294 GCTCACTTGCAGGCAGAGGAAGG - Exonic
938547979 2:132352672-132352694 GCGCAGGCGCAGGGGCAGGAAGG + Intergenic
940618637 2:156083520-156083542 GCTCCAGTGGAGGTGGTGGAGGG + Intergenic
942132946 2:172898604-172898626 GCTCACTTGCACCTGGAGGAGGG + Intronic
942309607 2:174643066-174643088 GCTTAGATGGAGGTGGGGGAAGG + Intronic
944671330 2:201996576-201996598 GCTGAGGTGCAGGGAAAGGAGGG + Intergenic
944707441 2:202305351-202305373 GCTCAGGTGGTGGTAGATGAGGG + Intergenic
944763373 2:202840280-202840302 GCTCTGGGGCAGCTGCAGGAGGG + Intronic
945188438 2:207163405-207163427 GCAGAGGAGCAGGGGGAGGAGGG + Intronic
945225946 2:207530642-207530664 GCCTAGGTGCCGGTGGGGGATGG + Intronic
945826365 2:214724855-214724877 CCTCAAGTGGAGGTGGCGGAAGG + Intergenic
945864583 2:215161962-215161984 GTTCTGGTGAAGGTGGTGGAGGG - Intergenic
946692555 2:222320103-222320125 GCGGCGGTGCAGGGGGAGGAAGG - Intergenic
947161751 2:227222231-227222253 GCTCAGGGGCAGGGGGCTGAAGG - Intronic
947859416 2:233348245-233348267 GGTGAACTGCAGGTGGAGGAGGG + Intergenic
947938465 2:234027316-234027338 GTTCTGGTCCAGGTGGATGAAGG - Intergenic
947966799 2:234288997-234289019 ACTCAGGTGATGGTGGAGAAGGG - Intergenic
948111531 2:235460127-235460149 GCTCAGGTGCTGTGAGAGGAAGG - Intergenic
948387829 2:237592631-237592653 GCTCAGGAGCTGGTGCAGGCAGG + Intronic
948424893 2:237880983-237881005 GGGCAGGGGCAGGAGGAGGAGGG - Intronic
948505564 2:238425127-238425149 GTGGAGGTGCAGGTGCAGGAGGG + Intergenic
948595483 2:239076841-239076863 GTTCAGGTGGGGGTGGATGAGGG - Intronic
948677815 2:239609378-239609400 GCTGAGGGACAGGTGGATGAGGG + Intergenic
1168891744 20:1299528-1299550 AGTCAGGTGCCAGTGGAGGAGGG - Intronic
1169276201 20:4235249-4235271 GCTGAGGGGCAGGTGAAGGGAGG + Intronic
1169336143 20:4759213-4759235 GTTCCGGTGGAGGTGGCGGAGGG + Intergenic
1169532078 20:6496159-6496181 TTTCAGGTGCAGGTGGACAAGGG - Intergenic
1170157037 20:13278443-13278465 CCACAGGTGCAGGTGGGGGCTGG - Intronic
1170595169 20:17799887-17799909 GCTAGTGTGAAGGTGGAGGAAGG + Intergenic
1171165644 20:22967797-22967819 GTTCTGGTGGAGGTGGTGGAGGG - Intergenic
1171424824 20:25042822-25042844 GGTCAGGGCCAGGTGAAGGAAGG - Intronic
1172477917 20:35252780-35252802 GCTCAGGTGGGGGTGGGGCAAGG + Intronic
1172867973 20:38114191-38114213 GCTTAGGTTCAGCTGTAGGAAGG + Intronic
1173360698 20:42341969-42341991 GCTGAGTTGTTGGTGGAGGAAGG + Intronic
1173488556 20:43458860-43458882 GCTCGGGTGGAGGTGGGGTAGGG + Intronic
1173708247 20:45130541-45130563 GCTCAGTGGAAGGTGGAGAAGGG - Intergenic
1174458788 20:50668329-50668351 CATCAGGGGCAGGAGGAGGAAGG - Intronic
1175851813 20:62097766-62097788 GGGCAGGTGCAGGTGGGAGAGGG + Intergenic
1175944669 20:62553169-62553191 GATCAGGGGCTGGTGGAGGCTGG + Intronic
1176270333 20:64232942-64232964 GCTCTGGAGCAGGTGTTGGAGGG - Intronic
1179358625 21:40684510-40684532 GGGCTGGAGCAGGTGGAGGAAGG - Intronic
1179487016 21:41716947-41716969 GTTCAGGTGTAGGTGGGGGCGGG - Intergenic
1180063652 21:45402265-45402287 TGGCAGGTGCAGGTGGAGGCAGG + Intergenic
1180075424 21:45459279-45459301 GGTGAGGGGCAGGAGGAGGAGGG + Intronic
1180160473 21:45996868-45996890 CCTCAGGTGCAGGTGGGGGCAGG + Intronic
1180717859 22:17884209-17884231 GCTCAGGAGGAGGGGTAGGAAGG + Intronic
1180945326 22:19689285-19689307 GCACAGTTGCAGGTGGGGCATGG + Intergenic
1181688387 22:24544392-24544414 GCTGGGGTGCAGTAGGAGGATGG - Intronic
1182070211 22:27458245-27458267 GCTCAGGTCCAGTGGGATGATGG - Intergenic
1183220982 22:36512987-36513009 GCTCAAGTGCAGGTGTAGCCAGG + Intronic
1183354887 22:37352893-37352915 GCACAGGTCGGGGTGGAGGATGG + Intergenic
1183790814 22:40067687-40067709 GTTCAAGAGCAGGAGGAGGAGGG + Intronic
1183872810 22:40753355-40753377 GCTCAGCTGCAGGCTGAGCACGG - Intergenic
1184034316 22:41911248-41911270 GTCCAGGTGCAGATGGGGGACGG - Exonic
1184109911 22:42388619-42388641 GCTCAGAGGCAGGAGGAGGGCGG + Intronic
1184114268 22:42413106-42413128 GCTCAGCTGCTGGAGAAGGAGGG - Intronic
1184426792 22:44413731-44413753 CCTCAGGAGGAGGAGGAGGAGGG + Intergenic
1184537793 22:45099511-45099533 CCTCAGGGGCAGGTGGCAGAGGG - Intergenic
1184629615 22:45765540-45765562 GCCAAGGTGCAGGTGGAGGAGGG - Intronic
1184722315 22:46322180-46322202 GCTTGGGTGCAGGCGCAGGAGGG + Intronic
1185011823 22:48318844-48318866 GCTCTGGTGCAGTGGGAGGAGGG - Intergenic
1185210691 22:49569056-49569078 GCTGAGGTGCAGGAGGAGCCGGG - Intronic
1185318921 22:50191283-50191305 GCTCAGGGGCTGGGGGAGCAGGG - Intronic
1185417129 22:50716379-50716401 GCTGAGGAGCCGGTGGGGGACGG - Intergenic
949774549 3:7617883-7617905 GCTCAGGACAATGTGGAGGAAGG + Intronic
949876239 3:8627876-8627898 GCTAAGGCCCAGGGGGAGGAAGG - Intronic
950453259 3:13077678-13077700 CCTCACGTGCAGGTGGCTGACGG + Intergenic
951619953 3:24590145-24590167 GCTCAGCTTCAGGAGGAGGGGGG + Intergenic
951705659 3:25541830-25541852 GCTCAGGAGTCTGTGGAGGAAGG - Intronic
952287569 3:31982858-31982880 CCTAAGGTCCATGTGGAGGAAGG - Intronic
952387247 3:32850924-32850946 CCTGAGGTGCAGGTTGGGGAGGG + Intronic
952646437 3:35664665-35664687 GCTCCGGAGCAGGTGGCGGCGGG + Intronic
953129479 3:40124528-40124550 GCACAGGTGCATGGGGAGGCAGG - Intronic
953679799 3:45030625-45030647 GCACAGGAGCAAGTGAAGGATGG + Intronic
954575872 3:51675941-51675963 GCTGAAGGGCAGGTGGAGGAGGG + Intronic
954992929 3:54856463-54856485 GGACAGGAGCAGGTGGGGGAGGG - Intronic
955351950 3:58200180-58200202 ACTCAGTTTGAGGTGGAGGAGGG - Intronic
956146744 3:66198494-66198516 GGTCAGGTGCAGGGTCAGGATGG - Intronic
957723273 3:84031934-84031956 GGTCAGATGCTGGTGGAGGTGGG - Intergenic
958905349 3:99935955-99935977 GCTGAGGGGCTGCTGGAGGAAGG - Intronic
959513654 3:107241446-107241468 GCAGAGGTGCAGGTGCAGGGAGG - Intergenic
960018825 3:112925647-112925669 ACTCTGGTGCAGGTGTAGGTGGG + Intronic
960444509 3:117731210-117731232 GCAAATGTGGAGGTGGAGGAGGG + Intergenic
961156103 3:124681030-124681052 TGTCAGCTGCAAGTGGAGGAAGG + Intronic
961460161 3:127045122-127045144 GCTCAGGTGCAGGTGGAGGGTGG + Intergenic
961532036 3:127545896-127545918 ACTCAGGTGCTGGGGGAGCAGGG - Intergenic
961543857 3:127618548-127618570 GTGCAGGTGCAGGTGAGGGAAGG - Intronic
961656939 3:128448038-128448060 GCTCTGGTGCAGGTAGAAGAAGG - Intergenic
961695052 3:128698608-128698630 GCTGAGGTCCTGGGGGAGGAGGG - Intergenic
961785405 3:129344158-129344180 GCTCTGCTGCAGGTGGGGGTGGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962314579 3:134351109-134351131 GAGCAGGTGGAGGTGGAGGTAGG - Intergenic
962456000 3:135566327-135566349 GCTTTGGTGGAGATGGAGGAAGG + Intergenic
963235679 3:142953497-142953519 GCTCCGGAGCATGTGGAGGAGGG - Intronic
963312215 3:143721487-143721509 GCGCAGGTGCAGGTGTAGGTAGG + Intronic
963785613 3:149531550-149531572 GCGCAGGTGCAGGAGGTGGGAGG - Intronic
963904508 3:150762818-150762840 GCGCTGGGGCCGGTGGAGGACGG + Exonic
964452707 3:156826795-156826817 GGTCAGGGGCAGGTGAAGGCGGG - Exonic
967963295 3:194941974-194941996 GCCCAGGGGCGGGTGGAGAAGGG - Intergenic
968524599 4:1049574-1049596 ACACAGGTGCAGGGGGAGGCAGG - Intergenic
968662222 4:1803402-1803424 GGGCGGGTGCAGGTGGAGGATGG - Intronic
969363768 4:6681969-6681991 GCCTTGGTGCAGGTGGAGGGAGG + Intergenic
969491794 4:7503634-7503656 GCACAGGTGCAGATGGAGGTGGG + Intronic
969867909 4:10087276-10087298 GCTGAGGTCCAGGGGCAGGAGGG - Intronic
970410291 4:15799868-15799890 GCTCAGGCACAGAGGGAGGAGGG + Intronic
970424848 4:15936565-15936587 GCTCAGGTGCTCCTGGTGGAGGG - Exonic
973907569 4:55546689-55546711 GCTCCTGGGCTGGTGGAGGAGGG - Intronic
974020359 4:56687569-56687591 GGGCAGGTGAATGTGGAGGAGGG + Intergenic
974875827 4:67701303-67701325 GCTGTGGTGCAGGTGGCCGAAGG + Intergenic
975863819 4:78705245-78705267 GCTCAGGTGAAGCAGAAGGATGG - Intergenic
976239742 4:82942644-82942666 TCCCAGGAGCAGGTGGTGGAGGG - Intronic
976789277 4:88859441-88859463 GCCCAGAGGCAGGTGGTGGAGGG + Intronic
977033882 4:91924826-91924848 GCTGAGGGGCAGGTGGAGGGTGG + Intergenic
981073344 4:140568159-140568181 GCTCACGCGCAGATGGAGGGAGG + Intronic
984638833 4:182142567-182142589 GTACAGGTACAGGTGGAGGTCGG + Intergenic
985223390 4:187732042-187732064 GCTGAGGGGGAGGAGGAGGACGG - Intergenic
986165579 5:5269232-5269254 GCTCAGGTGCTGGTGAGGGGAGG - Intronic
986768295 5:10948249-10948271 ACTCAAATGCAGGTGGAAGAAGG + Intergenic
987352232 5:17032433-17032455 GCGCAGGTGGAGGTGGTTGATGG + Intergenic
988143019 5:27267279-27267301 GACCAGGTGCAGGCGGAGCAGGG + Intergenic
988466257 5:31495575-31495597 CCTCAGGTGCTGGTGAAGCAAGG + Intronic
990449140 5:55918936-55918958 ACTCAAGTCCAGGTGTAGGAAGG + Intronic
991586318 5:68205773-68205795 GCTCTGGGGCAGCTGCAGGAAGG - Intergenic
992612125 5:78516934-78516956 CCTCAGGTGTAGGTGAAGAAAGG - Intronic
992769718 5:80035560-80035582 GACCAGGTGCAGCAGGAGGACGG - Exonic
993367978 5:87056155-87056177 GCGGAGGTGGAGGTGGAGGCGGG + Intergenic
994355673 5:98791791-98791813 TCTCTGGTACAGGTGGTGGAGGG - Intronic
994589198 5:101752894-101752916 GCTCAGGTGCTGGTCTTGGAGGG - Intergenic
997200327 5:132006133-132006155 GCTTAGGTGCAGGGAGAGGAAGG + Intronic
997214647 5:132100761-132100783 ATGCAGGTGCAGCTGGAGGAAGG - Intergenic
997227078 5:132217186-132217208 ACTCAGCTGCAGGTGAGGGACGG - Exonic
997387393 5:133484058-133484080 GCAGAGGTGTATGTGGAGGAAGG - Intronic
997716707 5:136048010-136048032 GCTCAGGAGGAAGTGGAGGCAGG + Intronic
998215923 5:140238737-140238759 GCTCAGATGCAGAGGTAGGAAGG - Intronic
999153456 5:149441939-149441961 GCTCCTGTGCAGCTGGAGGAAGG + Intergenic
999231959 5:150066878-150066900 GCAGAGGTGCAGGTGAGGGAAGG - Intronic
999253289 5:150195273-150195295 GCTCAGGAGGAGGTGGAGGAAGG - Intronic
999257968 5:150220342-150220364 AATCAGGGGCAGGTGGGGGAGGG + Intronic
999458427 5:151737173-151737195 GCTGCTGTGCAGGTGAAGGAAGG + Intergenic
999722973 5:154412510-154412532 ACTCAGGTGCAGGTGGTCCAGGG - Intronic
1001848010 5:174938584-174938606 GCACAGCTGCACATGGAGGAAGG - Intergenic
1002399721 5:178984863-178984885 TCTCAGGGCCAGGTGGAGGGTGG - Intronic
1002604780 5:180376154-180376176 GTGCACATGCAGGTGGAGGATGG - Intergenic
1002649246 5:180679681-180679703 GCTCGGGTACAGGGGGAGGTGGG + Intergenic
1002675700 5:180910785-180910807 GCTCAGGAGGAGGTGTAGGGAGG - Intronic
1003015199 6:2462462-2462484 GCTCAAGTGCATGTGGGGGCTGG - Intergenic
1003142424 6:3482567-3482589 GAAAAGGTGCAGGTGGAGAAGGG - Intergenic
1003507269 6:6750311-6750333 GCAGAGGTGCAGGGGGAGGGGGG + Intergenic
1003872770 6:10415083-10415105 GCGCAGGAGGAGGAGGAGGAGGG + Exonic
1003960357 6:11203486-11203508 GCTCAGGTTTAGTTGGAAGAAGG + Intronic
1004036114 6:11925836-11925858 GCCCAGGGGCAGGTGAAGGGTGG - Intergenic
1004753299 6:18585362-18585384 AGTCAGGAGCAGGTGGGGGAGGG - Intergenic
1005091506 6:22061692-22061714 GGGCAGGAGCAGATGGAGGAAGG - Intergenic
1005504615 6:26458677-26458699 GCTGAGGAGGAGGAGGAGGAGGG - Exonic
1005923255 6:30418697-30418719 GCTGAGCTGCAGGTGGAGCGGGG + Intergenic
1006078140 6:31547551-31547573 GCAGAGACGCAGGTGGAGGACGG - Intronic
1007497271 6:42268848-42268870 GCTCAGGTGCCAGTGCAGGGAGG - Exonic
1007797344 6:44360583-44360605 GCACAGAAGCATGTGGAGGAGGG - Intronic
1007892702 6:45310531-45310553 GTTCTGGTGGAGGTGGTGGAGGG - Intronic
1008534375 6:52496081-52496103 TGTCAGGTTCAGGTGGTGGAAGG + Intergenic
1008936670 6:56999644-56999666 GCTTAGCTGCAGGGGAAGGAGGG - Intronic
1009398726 6:63230204-63230226 GCACAGGTGCAGGAGCAGCAGGG + Intergenic
1012016099 6:93853935-93853957 GCTAAGGGGCAGGTGGGGGCGGG - Intergenic
1012309055 6:97698175-97698197 GCAAAGGTGCACATGGAGGAAGG + Intergenic
1012922725 6:105235724-105235746 GTTCCGGTGGAGGTGGTGGAGGG - Intergenic
1013508071 6:110819003-110819025 GTTCAGGTTCAATTGGAGGAAGG + Intronic
1014344121 6:120245914-120245936 GTTCAGTTGCAGATGAAGGATGG - Intergenic
1015823788 6:137291047-137291069 GCCCAGGTAGAGGTGGAGGCTGG + Intergenic
1015877921 6:137842757-137842779 GTTCTGGTGGAGGTGGTGGAGGG + Intergenic
1016062578 6:139645918-139645940 GCAAAAGTGCAGCTGGAGGATGG + Intergenic
1016528136 6:145026705-145026727 CCTAAGGTGCAGGTAAAGGAAGG + Intergenic
1016556960 6:145349688-145349710 GTTGAGGTGGAGGTGGAGGAGGG - Intergenic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1017689372 6:156948026-156948048 GCTCAGGAGCAGGTGCCTGAAGG - Intronic
1018021770 6:159767794-159767816 GCTGAGGTTCAGGAGGAGGCAGG + Intronic
1018044305 6:159952365-159952387 GCACTGGTACAGGAGGAGGATGG - Intergenic
1018114899 6:160573812-160573834 GTTCTGGTGGAGGTGGAGGAGGG + Intronic
1018376683 6:163219627-163219649 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018376691 6:163219662-163219684 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018441804 6:163820571-163820593 GGTCAGGTGCATGGGGATGAGGG - Intergenic
1018492252 6:164305767-164305789 GCTCAGGTGAAGGAGGAAGAGGG + Intergenic
1018927265 6:168215095-168215117 GGTCAGGTGCAGGGAGAGGGAGG - Intergenic
1019079903 6:169423387-169423409 GCACAGCTGCAGTTAGAGGAAGG + Intergenic
1019171748 6:170136790-170136812 GTTGAGTAGCAGGTGGAGGACGG - Intergenic
1019303514 7:321651-321673 GGCCTGGGGCAGGTGGAGGAGGG - Intergenic
1019449724 7:1091161-1091183 GCTCAGCTGCAGCTGGAGGCTGG - Intronic
1019476791 7:1248263-1248285 GCCCAGGGGCAGGCGGAGGAAGG - Intergenic
1022442932 7:30448569-30448591 GCTCATGGGCTGGTGCAGGATGG - Intronic
1022471425 7:30683827-30683849 GCTTAGGTTTATGTGGAGGATGG - Intronic
1022514182 7:30964960-30964982 ACTCAGGAGCAGGTGCAGCAAGG - Intronic
1022894817 7:34739794-34739816 GCTCTGGTGCAGGTGGCAGGGGG + Intronic
1023680794 7:42685166-42685188 GCTCTGGTGGTGGTGGATGAGGG + Intergenic
1023919788 7:44619130-44619152 GCACAGGTCAAGGTGTAGGATGG - Intronic
1023962490 7:44938490-44938512 GAGCAGGTGGAGGTTGAGGAAGG + Intergenic
1024121227 7:46243426-46243448 GGTGAGGTGCAGGTGAGGGATGG + Intergenic
1024353909 7:48395229-48395251 CTCCAGTTGCAGGTGGAGGATGG + Intronic
1024353974 7:48395606-48395628 GCTGAGGAGGAGGAGGAGGAAGG - Intronic
1024476819 7:49820838-49820860 GCCCAGGTGCAGGCTGAGGAAGG + Intronic
1024476828 7:49820879-49820901 GCCCAGGTACAGGCTGAGGAAGG + Intronic
1025143450 7:56484303-56484325 ACCCAGGTGCAGGTGGGAGAGGG - Intergenic
1025155528 7:56602747-56602769 GCTGGGATGCAGGTGAAGGAAGG - Intergenic
1025609766 7:63068022-63068044 CCCCGGGTGCAGGTGGAAGAGGG + Intergenic
1025627430 7:63234032-63234054 TCTCACGTCCAGGTGGAGCACGG - Intergenic
1025732792 7:64121344-64121366 TCTCACGTGCAGATGGATGAGGG + Intronic
1025829662 7:65038311-65038333 GCTGAGGTGGAGGCGGAGGGAGG + Intergenic
1025916920 7:65873327-65873349 GCTGAGGTGGAGGCGGAGGGAGG + Intronic
1026846610 7:73702342-73702364 GCTGAGGTGAAGGTCCAGGAAGG - Intronic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1031026695 7:116686872-116686894 GCTCAGGTGCAGCTGAGGTAGGG - Intronic
1032404379 7:131645143-131645165 GCTCAGGTGCACTTGGTGGTTGG - Intergenic
1032441087 7:131943616-131943638 TCAGAGCTGCAGGTGGAGGACGG + Intergenic
1032506212 7:132436486-132436508 GTGAAGGTGCAGGTGGAGGAAGG - Intronic
1033041689 7:137925093-137925115 CCTGGGGTTCAGGTGGAGGATGG + Intronic
1033608500 7:142944375-142944397 GCTCAACTGCAGGTGGAGATGGG - Exonic
1033705941 7:143885103-143885125 GCTGAGGTGCGGGTGGGAGAAGG - Intronic
1033825058 7:145179176-145179198 GTTCAGATGGAGGTGGAAGATGG - Intergenic
1034198251 7:149264371-149264393 GCTGATGTGAAGTTGGAGGAGGG + Intronic
1034840357 7:154390154-154390176 GCTCAGATGCAAGTGGGGGAAGG + Intronic
1035057623 7:156046492-156046514 GCCCAGGTGCAGGCAGAGGAGGG - Intergenic
1035675869 8:1455234-1455256 AGTCAGGTGCAGGTGCAGGTGGG + Intergenic
1035753063 8:2009138-2009160 GGCCAGGTGAGGGTGGAGGAGGG - Intergenic
1035917522 8:3641290-3641312 CCTCCTGTGCAGGTGGAGAACGG + Intronic
1036213709 8:6862902-6862924 GCTCTGGCTCAGGTGGAGGCAGG + Intergenic
1037577975 8:20225772-20225794 CTTCTGGTGGAGGTGGAGGAGGG - Intronic
1038014224 8:23499609-23499631 AGTCAGGGGCAGGTGGAGGTGGG + Intergenic
1038547702 8:28438480-28438502 GCTGAGAGACAGGTGGAGGAGGG - Intronic
1038604061 8:28980656-28980678 GCTTAGGTGGGGGTGGAGAATGG - Intronic
1039250975 8:35663559-35663581 GCTCTGGTGCTGGTGGTGGCGGG + Intronic
1040336561 8:46418995-46419017 ACTCAGGTTCAGGTTGAGGTGGG + Intergenic
1040557962 8:48497795-48497817 GCTGAGGTGTTGGTGAAGGATGG + Intergenic
1040705597 8:50122625-50122647 GCTCAGGAGCAGTGGGAAGATGG + Intronic
1040900232 8:52410710-52410732 GCGCAGGTGGGGTTGGAGGACGG + Intronic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1041829073 8:62132424-62132446 GCTGAGCTGCAGTTAGAGGATGG + Intergenic
1042832927 8:73051377-73051399 GCTGTGGTCCAGGTGTAGGAAGG - Intergenic
1043379527 8:79687700-79687722 GCAGAGGTGGAGGTGGAGGGTGG + Intergenic
1043623512 8:82227440-82227462 GCTCAGGCTCAGGTGGAGGATGG - Intergenic
1044384706 8:91573770-91573792 GCTCATGTACAAGTGGAGGAGGG + Intergenic
1044420620 8:91991735-91991757 GCTGAGGTGGAGGTGGGGTAGGG + Exonic
1045397527 8:101775678-101775700 GCTCAGATCCAGATGGAGGTTGG + Intronic
1045664013 8:104466832-104466854 GCCGACGTGCTGGTGGAGGACGG - Exonic
1046799310 8:118407770-118407792 GCAAAGGTGCAATTGGAGGAAGG - Intronic
1047624343 8:126640794-126640816 GGGCAGGGGCAGGTAGAGGAAGG - Intergenic
1047625627 8:126653163-126653185 GCCCAGCTGCACCTGGAGGATGG - Intergenic
1048006328 8:130422217-130422239 CAACAGCTGCAGGTGGAGGAAGG + Intronic
1049150808 8:141034423-141034445 GCTTAGGTGGAGGCGGAGGCTGG + Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049508099 8:143014524-143014546 GCTCTGGTGTGGGAGGAGGAGGG + Intergenic
1049603123 8:143517286-143517308 CCTCAGGTGCAGGGGAAGGGAGG + Intronic
1049764204 8:144345896-144345918 GCTCAAGTGATGGTGGAGTAGGG + Intergenic
1049799939 8:144513029-144513051 GTGCAGGTGCAGGTGCAGGCTGG + Exonic
1050217719 9:3346697-3346719 GCTCAGGTGCAGTATGTGGAAGG - Exonic
1052834790 9:33242248-33242270 GCTCAGGTGCATAGGGAGGCGGG + Intronic
1053546883 9:39032542-39032564 TCTCAGGTGGAATTGGAGGAGGG + Intergenic
1053667528 9:40326489-40326511 GCTCTGCTCCAGGTGGAGAAGGG + Intronic
1053811202 9:41854195-41854217 TCTCAGGTGGAATTGGAGGAGGG + Intergenic
1053917109 9:42951592-42951614 GCTCTGCTCCAGGTGGAGAAGGG + Intergenic
1054378670 9:64466516-64466538 GCTCTGCTCCAGGTGGAGAAGGG + Intergenic
1054517083 9:66049796-66049818 GCTCTGCTCCAGGTGGAGAAGGG - Intergenic
1054619392 9:67333244-67333266 TCTCAGGTGGAATTGGAGGAGGG - Intergenic
1056322678 9:85451785-85451807 GATCTGGTGGAGGTGGTGGAGGG + Intergenic
1056943833 9:90977195-90977217 ATTCAGGGGCAGGGGGAGGAAGG + Intergenic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058429399 9:104904824-104904846 GTTCAGGTGCAGGTGGAACAAGG - Intronic
1058804650 9:108579040-108579062 GGACAGGTACAGCTGGAGGAGGG + Intergenic
1059719108 9:116942250-116942272 GGTTAGCTGCAGTTGGAGGAGGG - Intronic
1060046031 9:120341819-120341841 GCTCAGAAGAAGGAGGAGGAGGG + Intergenic
1060104862 9:120867218-120867240 GCTCACAGGCAAGTGGAGGATGG + Intronic
1060452395 9:123755493-123755515 GCTGAGGTGGAAGAGGAGGAAGG - Intronic
1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG + Intronic
1060892098 9:127195451-127195473 GCTCAGCAGCTGATGGAGGAAGG + Intronic
1061256094 9:129454635-129454657 GCGGAGGTGGAGGTGGTGGATGG + Intergenic
1061884842 9:133586266-133586288 GCTCAGCTGCGGGGGGAAGAGGG + Intergenic
1062076693 9:134593580-134593602 CTCCAGGCGCAGGTGGAGGATGG - Intergenic
1062150230 9:135014373-135014395 TTTGAGGTGCAGGTGGAGGCAGG - Intergenic
1062159299 9:135070879-135070901 GCTGAGGTTCAGGTAGAGGGAGG - Intergenic
1062303629 9:135889713-135889735 GCTCAGGGGAAGGAGGAGGAGGG - Intronic
1062552841 9:137097972-137097994 GCTCAGGGGCTGGTGGCTGATGG + Intronic
1062610999 9:137373372-137373394 GCTGAGGGGCAGGGGCAGGAAGG + Intronic
1185593589 X:1294170-1294192 GTCCAGGTGGAGGTGGAGTAGGG - Intronic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1187964185 X:24594504-24594526 GCTCAGGTGCAGATTCAGAAAGG - Intronic
1188897108 X:35682742-35682764 GCTCAGGGTCAGATGGAGGCTGG - Intergenic
1189413644 X:40794825-40794847 GTTCTGGTGGAGGTGGTGGAGGG - Intergenic
1190020895 X:46873888-46873910 GCTCAGGGTCAGGTGGGGGTGGG - Intronic
1190448978 X:50558340-50558362 GTTCTGGTGGAGGTGGCGGAGGG - Intergenic
1190912699 X:54787386-54787408 GCAGAGGTGCCAGTGGAGGAGGG - Intronic
1191754767 X:64581615-64581637 GCTCAGGTGAAGGTGGACTGTGG - Intergenic
1192165165 X:68823499-68823521 GCTGAGGGGCAGCTGGAGGGTGG + Intergenic
1192193930 X:69016208-69016230 GGTCTGGGGCAGGAGGAGGAGGG + Intergenic
1192560232 X:72123503-72123525 GCTCAGGTGAGAGAGGAGGAAGG + Intergenic
1192564387 X:72151497-72151519 GCACAGGAGCAGGTGGAGGGGGG + Intergenic
1192585191 X:72313610-72313632 GATGAGGTGCAGGTGGGAGAGGG + Intergenic
1192808764 X:74531835-74531857 GCTCTGGGGGAGGAGGAGGATGG + Exonic
1194926868 X:99836241-99836263 GTTCTGGTGGAGGTGGTGGAGGG + Intergenic
1195636159 X:107118374-107118396 TCTCAGGTGGAGGTGGAGGTAGG + Intronic
1196027325 X:111054790-111054812 GCTGAGGTGATGGTGGAGGCAGG - Intronic
1197773598 X:130106205-130106227 GGTCAGCAGCAGCTGGAGGAGGG - Intronic
1197848430 X:130830173-130830195 GCTCAGGTGCAGGTCCAGAAAGG - Intronic
1200165149 X:154030651-154030673 GCTCAGGTGGAGGTGGGGGCAGG + Exonic
1202088496 Y:21163704-21163726 GAGCAGGTGCAGATGGAGGAAGG + Intergenic