ID: 1143284952

View in Genome Browser
Species Human (GRCh38)
Location 17:5781958-5781980
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 2, 1: 4, 2: 2, 3: 33, 4: 367}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900421895 1:2559365-2559387 CTTCAGGTACTGGTGGAGGTGGG - Intronic
900482650 1:2906697-2906719 AGGAAGGCACAGGTGGAGCAGGG + Intergenic
900770946 1:4543619-4543641 ATACAGGCACAGGTGCAGGTAGG - Intergenic
901539646 1:9907631-9907653 AACCAGTTAGAGGTGGAGGAGGG - Intronic
901594110 1:10371207-10371229 AGAGAGGGACAGGTGGAGGAGGG - Exonic
901871069 1:12139558-12139580 AGCCAGGTGGAGGTGGAGGAAGG - Intronic
902295979 1:15467343-15467365 AGGCAGGTAAAGGGAGAGGAAGG - Intronic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
902777288 1:18682919-18682941 GTGCAGGGACAGGTGGAGAAGGG - Intronic
903482240 1:23662168-23662190 TTTCAGGTACCTGTGGAGGATGG - Intergenic
904438956 1:30517403-30517425 ATGCAGGGACAGGTGGGGTGGGG - Intergenic
906152929 1:43598449-43598471 ATGGGGGAACAGGTGGAGGTGGG - Intronic
907267108 1:53269148-53269170 AAGCTGGTACAGTTGGAGCAAGG - Intronic
907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG + Exonic
910199021 1:84678626-84678648 TGGCAGGTAGAGGTGGAGAAAGG + Intronic
910991235 1:93058730-93058752 ATGGAGGTAAAGGAGGAGGCTGG + Intergenic
911256268 1:95637074-95637096 ATGCAGGGACAGGAAGAGCATGG - Intergenic
911571991 1:99528502-99528524 ATTCACAAACAGGTGGAGGATGG - Intergenic
912415835 1:109507906-109507928 CAGCAGGTGCAGGTCGAGGACGG - Exonic
912747085 1:112253915-112253937 AAGAAGGTAGATGTGGAGGAGGG + Intergenic
912759529 1:112354719-112354741 AAGAAGGGAGAGGTGGAGGAAGG - Intergenic
912944814 1:114076120-114076142 CTCCCGGTAGAGGTGGAGGAAGG - Intergenic
913522667 1:119660574-119660596 ATGCAGGGCCAGGTGGGAGACGG + Intronic
914910750 1:151784142-151784164 ATTTAGGCACAGGTGGAGGAAGG - Intronic
915088696 1:153406326-153406348 ATGCAGGGACATGGGGATGATGG + Intergenic
915299776 1:154945316-154945338 ATGCAGGTAGAGGTAGGGCAGGG + Intronic
915471580 1:156128952-156128974 AAGCAGCTGCAGGGGGAGGAGGG - Intronic
916181397 1:162086960-162086982 ACACAGGTACAGTTGGACGAGGG - Intronic
916306767 1:163344403-163344425 CTGGAAGTACAGGTGGAAGAGGG + Intronic
919455759 1:197818217-197818239 ATGCAGCCACTGCTGGAGGATGG - Intergenic
920380418 1:205531756-205531778 AGGCAGGTCCTGGGGGAGGAGGG - Exonic
920457941 1:206115553-206115575 AGGCATGTCCAGGTGCAGGAGGG + Intronic
920844330 1:209581115-209581137 AGCCAGGCACAGGAGGAGGATGG + Intergenic
921988645 1:221340070-221340092 AGGTTGGTAAAGGTGGAGGAAGG + Intergenic
922145617 1:222940785-222940807 ACTGAGGTACAGGTGGAGGTTGG + Intronic
922178490 1:223215462-223215484 ATGCATGGAGAGGTGGGGGAAGG - Intergenic
922352802 1:224748098-224748120 TTCCAGGTACAGGAGGAGGAGGG - Intergenic
922377913 1:224988048-224988070 TTGGAGGTAGAGGTGGGGGAGGG - Intronic
923905135 1:238376221-238376243 AAGCAGGCAGAGGAGGAGGAAGG + Intergenic
1062852875 10:759242-759264 GTGCAGGGAAAGGTGAAGGAGGG + Intergenic
1062982526 10:1737185-1737207 AGGCAGGTGCAGGTGCAGGAGGG - Exonic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063579161 10:7290165-7290187 CTGCAATTTCAGGTGGAGGAAGG + Intronic
1065747962 10:28859106-28859128 ATGGAGCCACAGGTGGATGAAGG - Intronic
1067089528 10:43259547-43259569 ATGCAGGGAGAGGAGGAGGCTGG - Intronic
1067528113 10:47050436-47050458 ATGCAAGGAAAGGGGGAGGAAGG + Intergenic
1067730620 10:48808596-48808618 ATGCATATACAGGTTGAGCAAGG - Intronic
1067733430 10:48830468-48830490 AAGCAGGTGGAGGTGGAGAAAGG + Intronic
1068638418 10:59373991-59374013 AGGAAGGAAGAGGTGGAGGAAGG + Intergenic
1069705450 10:70456569-70456591 AGGCAGGTACAGGCAGAGAAAGG - Intergenic
1070210774 10:74318271-74318293 ATGGAGGTGGAGATGGAGGAAGG - Intronic
1070983318 10:80667263-80667285 AGGCAGGTATAGGTGGCAGAGGG + Intergenic
1071501283 10:86206046-86206068 ATGCTGGCACAGATGGAGGCTGG - Intronic
1073568745 10:104558050-104558072 CTGCAGGTGCTGGTGAAGGATGG + Intergenic
1074053856 10:109904373-109904395 TTGCATGTAGAGGTGGATGAAGG - Intronic
1074643306 10:115414231-115414253 GTGCAGGGCAAGGTGGAGGAGGG - Intronic
1076702700 10:132282426-132282448 GTGCAGGTACAGGTGGGCGCAGG - Intronic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077287250 11:1773083-1773105 GTCCAGGCACAGGTGGGGGAGGG + Intergenic
1077307037 11:1873083-1873105 AGGCAGGGAGAGGTGGAGGCAGG + Intronic
1078451982 11:11447216-11447238 ATGAGGGTACTGTTGGAGGATGG - Intronic
1079920420 11:26427285-26427307 ATCAAGGTGCAGGTGGAGGGAGG - Intronic
1081116805 11:39212624-39212646 ATGGTGGTACACGTGGAGAAAGG - Intergenic
1081240006 11:40693776-40693798 ATCCAGGTAAAGGAAGAGGAGGG + Intronic
1081716839 11:45256464-45256486 ATGCAAAAACAGGTGGAGGTAGG - Intronic
1082731024 11:56797879-56797901 GTGCAGTCACAGGTTGAGGAGGG - Intergenic
1083457731 11:62790183-62790205 CTGCAGGAAGAGGTGGAGGGGGG - Exonic
1083800141 11:65041752-65041774 CTGCAGGCCCAGGTGCAGGAGGG + Exonic
1084713887 11:70861472-70861494 ATGCAAGTTCAGGTGCAGGTAGG - Intronic
1084733105 11:71087247-71087269 ATGGAGGTAACGGTGGAGGCTGG - Intronic
1084800891 11:71543182-71543204 CAGCAGCTGCAGGTGGAGGAGGG + Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086226037 11:84510915-84510937 ATACAGGGACAGAGGGAGGAGGG + Intronic
1086445373 11:86865552-86865574 AGGCAGGTAGAGCTGCAGGAGGG + Intronic
1087424517 11:97970515-97970537 CTGAAGGTGCAGTTGGAGGAAGG + Intergenic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089175804 11:116547972-116547994 AGGGAGGCACAGGTGGAGGGAGG - Intergenic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1091167627 11:133493432-133493454 ATGCATGTACACATGGGGGAAGG - Intronic
1092164302 12:6333546-6333568 ATGCAGGGACAGGAGGATGCAGG - Intronic
1092252208 12:6905822-6905844 CTGCAGGTAGAAGTGGAGTAAGG - Intronic
1092312674 12:7375169-7375191 ATGGGGGTGCAGGTGGAGGGGGG - Intronic
1094136778 12:27136106-27136128 ATGAAGGAAGAGGTGGAGGATGG + Intergenic
1094186516 12:27648863-27648885 ATGAAGGGAGAGGTGGAGGATGG + Intronic
1094362849 12:29649017-29649039 ATGTGGGCAGAGGTGGAGGATGG - Intronic
1096121302 12:49091111-49091133 AAGCTGGTACAGTAGGAGGAGGG - Exonic
1096828409 12:54296550-54296572 ATGAAGATACAGGGGCAGGAGGG - Intronic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1096867402 12:54572963-54572985 TTGCAGGTTCGGATGGAGGAAGG + Intronic
1096974660 12:55693196-55693218 ATGCAGGTTGAGCTGGAGGGCGG - Exonic
1097861608 12:64523634-64523656 CTCCAGTTACAGGAGGAGGAAGG - Intergenic
1098925257 12:76342250-76342272 AAGCAAGTATAGGTAGAGGAGGG + Intergenic
1100111358 12:91245668-91245690 ATGGGGGGACAGGTAGAGGAAGG - Intergenic
1101557198 12:105821474-105821496 ATCAAGGTACAAGTGTAGGAGGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101897906 12:108769774-108769796 AGGAAGGTAGGGGTGGAGGAAGG - Intergenic
1102339382 12:112109553-112109575 GTCCAGGAACAGGTGGTGGAGGG - Intergenic
1102516242 12:113448746-113448768 ATGCAAGTTCAGGTGGAGTCTGG - Intergenic
1102554393 12:113717355-113717377 ATGCAGTCACAGGTGGATGGAGG - Intergenic
1104357913 12:128104490-128104512 ATGCAGGTGGAGATAGAGGAAGG - Intergenic
1104391010 12:128390567-128390589 GTGCGGCTACAGGTGGAGGCAGG - Intronic
1108171372 13:47745290-47745312 ATGCAGCTAGAGGTAGAGCAAGG - Intergenic
1110379686 13:74836076-74836098 ATGGAGGTAAAGGTCCAGGATGG - Intergenic
1110760228 13:79223065-79223087 ATGCAGGCACAAGTCAAGGAAGG + Intergenic
1112158607 13:96845576-96845598 GTGCAGGTACAGATGGTTGAGGG - Intergenic
1112210784 13:97375082-97375104 GTGCAGGTGGATGTGGAGGACGG + Intronic
1113749632 13:112768244-112768266 CTGCTGGTAGAGGTGGAGGCGGG - Intronic
1114083583 14:19220853-19220875 TGGCAGATACAGGAGGAGGATGG + Intergenic
1116021755 14:39469676-39469698 ATGCAGCTGCTGCTGGAGGATGG + Intergenic
1117392947 14:55279914-55279936 ATGGAGGTAAAGGGAGAGGATGG - Intronic
1117682455 14:58218674-58218696 ATGTAGATCCAGGTGGAAGAAGG + Intronic
1119161920 14:72459770-72459792 ATGGTGGTACATGGGGAGGAGGG + Intronic
1119624472 14:76160204-76160226 AGGCAGCTACAGGTTGAGGCAGG - Intronic
1120410336 14:84145989-84146011 ATGCAGGTGCATTTAGAGGAGGG + Intergenic
1120591992 14:86386488-86386510 AGGCAGGGACAGGTGCAGGGTGG + Intergenic
1120723852 14:87916470-87916492 ATGGAGGTACAGCGGGAGAAAGG + Intronic
1122056288 14:99100557-99100579 ACTCAGGTACAGGTGGTGCATGG - Intergenic
1122233708 14:100320385-100320407 ATGGAGGGACGGATGGAGGAGGG - Intergenic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1123145848 14:106129407-106129429 AGGCAGGTGCAGATGGAGGCTGG - Intergenic
1123166593 14:106330973-106330995 AGGCAGGTGCAGATGGAGGGAGG - Intergenic
1123169277 14:106356012-106356034 AGGCAGGTGCAGATGGAGGGAGG - Intergenic
1202895194 14_GL000194v1_random:2622-2644 TGGCAGATACAGGAGGAGGATGG + Intergenic
1127311868 15:57759535-57759557 ATGCAGCTGCAGGTGGAGAAGGG - Intronic
1127544425 15:59976991-59977013 ATGCAGGTACAGCAAGAGCAAGG + Intergenic
1128757509 15:70193564-70193586 ATGCAGGCACATGGGAAGGAAGG + Intergenic
1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG + Intergenic
1129236366 15:74225987-74226009 TGTCAGGTCCAGGTGGAGGAAGG - Intergenic
1129596736 15:76970634-76970656 AAGGAGGTACAGATGGAAGAAGG + Intergenic
1129672838 15:77616617-77616639 TTGCAGGTGCAGGGGGAGGAGGG - Intronic
1129685144 15:77681743-77681765 ATGAGGGGACAGGTGGAGGGAGG + Intronic
1130276063 15:82476929-82476951 CTGCAGGTTCACCTGGAGGAAGG + Intergenic
1130468423 15:84204320-84204342 CTGCAGGTTCACCTGGAGGAAGG + Intergenic
1130485323 15:84395430-84395452 CTGCAGGTTCACCTGGAGGAAGG - Intergenic
1130495843 15:84469222-84469244 CTGCAGGTTCACCTGGAGGAAGG - Intergenic
1130990835 15:88874772-88874794 GTGCAGGGACAGGGGGAGAAGGG + Exonic
1131514479 15:93067930-93067952 AGGCAGGACCAGGAGGAGGAAGG + Intronic
1131685259 15:94760485-94760507 ATGCTGGTATAAGTGGAGGTGGG - Intergenic
1132930660 16:2457494-2457516 ATGCAGGCCGAGGTGGATGAGGG - Exonic
1133668995 16:7999148-7999170 ATGCAAGAACAGGAGGAGGGGGG - Intergenic
1133994739 16:10739911-10739933 TTGCAGGACCAGGAGGAGGAGGG + Intergenic
1134672823 16:16068297-16068319 GTGCAGGTACAGGGGGAAGCTGG + Exonic
1135114519 16:19713563-19713585 ATGGAGGTGGAGGAGGAGGATGG + Intronic
1137494997 16:48962720-48962742 ATGCAGGTATAAGTGAAGCATGG + Intergenic
1139321657 16:66119218-66119240 AAGGAGGTATAGGAGGAGGAAGG - Intergenic
1140479228 16:75253519-75253541 ATGCAGCTACTGGGGGAGGAGGG - Intronic
1140830370 16:78745301-78745323 TTGAAGGCAGAGGTGGAGGAAGG - Intronic
1142125986 16:88410955-88410977 ATGGAGGTAGAGGTGGAGTGAGG - Intergenic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284923 17:5781800-5781822 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284929 17:5781834-5781856 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284946 17:5781924-5781946 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143301180 17:5911725-5911747 TTGCAGGTCCAGGGGAAGGAGGG + Intronic
1144576336 17:16432043-16432065 ATGGAGGGACAGGAGGACGAGGG + Exonic
1144854534 17:18260732-18260754 ACGCAGGTACAGCTGGAGCGCGG + Intronic
1144968622 17:19093395-19093417 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1144979293 17:19158668-19158690 TTGCAGGAAGAGGAGGAGGAGGG - Exonic
1144988929 17:19219564-19219586 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1145002102 17:19312735-19312757 ATGCAGGTGCCCGAGGAGGAGGG + Intronic
1145993858 17:29094639-29094661 ATGCTGGAACAGGTACAGGAGGG - Exonic
1146437489 17:32864215-32864237 TTACAGGTAGAGGTGGAGTAGGG - Intronic
1146787976 17:35734861-35734883 ATGCAGGAAAAAATGGAGGAGGG + Intronic
1146919581 17:36701561-36701583 ATGCAGTTGAAGGAGGAGGAAGG - Intergenic
1147344264 17:39777994-39778016 ATGAAGGTACTGGTTGGGGATGG - Intronic
1147995822 17:44359878-44359900 GTGCAGGGGCAGGTGGAGGGGGG - Intronic
1148686533 17:49504046-49504068 ATGCAGCTGGAGGTGGAGGAGGG - Intronic
1148752366 17:49952614-49952636 AAGGAGGTACAGCTAGAGGAAGG - Intergenic
1149581413 17:57752940-57752962 ATGCAGGTACAGCTTGAGACTGG - Intergenic
1149661370 17:58335767-58335789 ATGTGAGTACAGGTGGAAGAGGG + Intergenic
1150932796 17:69603554-69603576 ATGCTGGTAGATGTGGAGGATGG + Intergenic
1151427702 17:74041755-74041777 ATGCAGGGACAGAGAGAGGAAGG - Intergenic
1152723695 17:81935029-81935051 ACGCACGCCCAGGTGGAGGACGG - Exonic
1152930394 17:83106380-83106402 ATTCAGATATAGCTGGAGGATGG + Intergenic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1153519546 18:5938741-5938763 ATGCTAGGAAAGGTGGAGGAAGG + Intergenic
1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG + Intergenic
1154342166 18:13512707-13512729 ATGCAGTTAGAGTTAGAGGAGGG - Intronic
1154500262 18:14992515-14992537 TGGCAGATACAGGAGGAGGATGG + Intergenic
1155565543 18:27129994-27130016 AAGAAGGCAAAGGTGGAGGAGGG + Intronic
1156479690 18:37428287-37428309 ATGCATGGAGAGGTGAAGGAGGG + Intronic
1156865434 18:41884178-41884200 AGGCTGGTACAGGTACAGGAAGG + Intergenic
1157282976 18:46358306-46358328 ATCCAGGTACATGGGGAGCAGGG + Intronic
1158619835 18:59023375-59023397 ATGCAGGTGGAGGTAGAGGTTGG - Intergenic
1158624321 18:59058339-59058361 ATGCAGGGACCACTGGAGGAAGG - Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159884248 18:73889136-73889158 GTGCATGTCCAAGTGGAGGATGG - Intergenic
1160588045 18:79923354-79923376 ATGCATGGGCAGGTGGTGGATGG + Intronic
1161243157 19:3234158-3234180 ATGGAGGCCCAGGTAGAGGAGGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161509942 19:4664725-4664747 ATGCACGTGCAGGTGGGGGGTGG - Intronic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1162823704 19:13238137-13238159 ATGCAGGAAGAGATGGAGGGTGG - Intronic
1165467369 19:35982891-35982913 CAGCAGGTACAGGAGGAGGAAGG - Intergenic
1165570842 19:36773344-36773366 ATGAAGGTGAAGGTGGAGGTGGG + Intronic
1165966068 19:39581930-39581952 ATAGAGGTACCGGGGGAGGAAGG - Intergenic
1165982720 19:39738188-39738210 AGGGAGGTACTGGAGGAGGAAGG + Intergenic
1166381139 19:42356000-42356022 AACCAGGTACAGGTGGGAGAGGG + Exonic
1166794969 19:45420486-45420508 GTGCAAGAAGAGGTGGAGGAGGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167583643 19:50360980-50361002 ATGGATGTACTGGTGGAGCAGGG - Exonic
1167601370 19:50456858-50456880 ATGGAGGTACAGATGATGGATGG - Intronic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925123606 2:1438156-1438178 GTGCAGGTACATGTTGAGGGTGG + Intronic
926146127 2:10398092-10398114 ATGCAGGAGCAGGTGGGGCAGGG - Intronic
926190246 2:10722431-10722453 ATGCAGGATGGGGTGGAGGAAGG - Intronic
929172877 2:38948995-38949017 ATCCAGGCACAGGAGGTGGAGGG + Intronic
932290525 2:70573756-70573778 ATGCAGTTGCAGTTGGATGATGG - Intergenic
933349576 2:81136702-81136724 AGGCAGGTCCATGTGGAGGCTGG - Intergenic
933526209 2:83443114-83443136 ATACAGGAACACTTGGAGGAAGG - Intergenic
936618898 2:114074859-114074881 ATGCAGGTACAGAAGGATCAGGG + Intergenic
936861504 2:117025931-117025953 ATGAAAGTACAGGTTGAGTAGGG - Intergenic
938493005 2:131775780-131775802 TGGCAGATACAGGAGGAGGATGG - Intergenic
940163709 2:150743489-150743511 ATACACATACAGTTGGAGGAGGG - Intergenic
942421207 2:175809867-175809889 ATGCAGCTACAGGCCAAGGAAGG - Intergenic
943300180 2:186188577-186188599 AGGCATGTAGAGGTGGAGGGAGG - Intergenic
944423770 2:199557948-199557970 TTGCTTGTACAGGTGGTGGAGGG + Intergenic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946211405 2:218150196-218150218 ATGCAGGAAAGGGTGGAGGAAGG - Intergenic
947591595 2:231388964-231388986 GTGGTGGGACAGGTGGAGGAGGG + Intergenic
947620956 2:231590753-231590775 ATCCTGGGAGAGGTGGAGGAGGG + Intergenic
947927474 2:233934241-233934263 GTGCAGGGAGAGGTGGAGGCAGG - Intronic
948371932 2:237495142-237495164 ATGGAGGCACAGGTGAGGGAGGG - Intronic
948505564 2:238425127-238425149 GTGGAGGTGCAGGTGCAGGAGGG + Intergenic
948838299 2:240636796-240636818 ATGCAGGAACAGAAGGGGGAGGG - Intergenic
948916415 2:241036861-241036883 AGGCAGGAGCAGGTGTAGGAGGG - Exonic
1169571471 20:6911315-6911337 ATGAAGGTCCTGGTGGAAGAAGG + Intergenic
1170878867 20:20277270-20277292 ATGCAGGTGATGGTGGAGGCGGG - Exonic
1171205493 20:23276152-23276174 ATGCGGGAACAGCTGGATGATGG - Intergenic
1171390799 20:24800462-24800484 AAGCAGGTGTGGGTGGAGGATGG - Intergenic
1171400637 20:24871225-24871247 ATGCAGGGACAGGCTGAGCATGG + Intergenic
1171796204 20:29568226-29568248 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1171852032 20:30315941-30315963 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1172461986 20:35126120-35126142 TTGGAGGGACAGGTTGAGGATGG - Intronic
1172474900 20:35229204-35229226 AAGGAGGAAGAGGTGGAGGAAGG - Intronic
1172511377 20:35503485-35503507 ATGCAGGAACGGGCAGAGGAAGG + Exonic
1172708565 20:36901985-36902007 ATACAGTGACAGATGGAGGAAGG + Intronic
1173035414 20:39404457-39404479 ATGCTGCAACTGGTGGAGGAAGG + Intergenic
1174415492 20:50363597-50363619 AAGCAGGGGCAGGTGGAGGGGGG + Intergenic
1175577960 20:60076784-60076806 ATGCAGCTACACAGGGAGGAAGG - Intergenic
1176614896 21:9018609-9018631 TGGCAGATACAGGAGGAGGATGG + Intergenic
1176710314 21:10145262-10145284 TGGCAGATACAGGAGGAGGATGG - Intergenic
1179520185 21:41938488-41938510 ATGCAGGTTCTGGAGGTGGATGG - Intronic
1180063652 21:45402265-45402287 TGGCAGGTGCAGGTGGAGGCAGG + Intergenic
1180294393 22:10872414-10872436 TGGCAGATACAGGAGGAGGATGG - Intergenic
1180497199 22:15901828-15901850 TGGCAGATACAGGAGGAGGATGG - Intergenic
1180742809 22:18065482-18065504 ATGCAGGTGCAGGCAGAGGCGGG + Intergenic
1181830725 22:25558395-25558417 ATGCAGATCCAGTTGGAGGCAGG - Intergenic
1182031865 22:27165462-27165484 TTTCAGGTAGAGTTGGAGGAGGG + Intergenic
1182772185 22:32803617-32803639 ATGTGGGTGGAGGTGGAGGAGGG - Intronic
1183377289 22:37472590-37472612 ATCCTGGCACAGGTGGAGGAGGG + Intronic
1185099037 22:48827895-48827917 ATGCAGCTTCAGGTGGAGGCGGG + Intronic
949782749 3:7708569-7708591 ATACAGGTACAGGGACAGGAAGG + Intronic
949888540 3:8714932-8714954 ACGCAGGTCCCGGTGGAGGGAGG - Intronic
950105166 3:10384045-10384067 TTTCAGGCACAGGAGGAGGAAGG - Intronic
950534220 3:13570025-13570047 ATGCAGGTGAGGATGGAGGATGG + Intronic
950539852 3:13605321-13605343 ATGCAGATGGAGGTGGTGGATGG - Intronic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954634026 3:52061910-52061932 ATGAAGGCACATGTGGAGGCAGG - Intergenic
954712905 3:52513789-52513811 AGCCAGGTACAGCAGGAGGAGGG + Exonic
955348901 3:58179977-58179999 GGGCAGGGAGAGGTGGAGGAGGG - Intergenic
955393429 3:58537359-58537381 ATGCAGGAAGAGAGGGAGGAAGG - Intergenic
956103396 3:65791597-65791619 AGGCAGGAAGAGGTGGAGGATGG + Intronic
957526366 3:81383601-81383623 ATGCAGTTACTGAAGGAGGAGGG + Intergenic
959207976 3:103337308-103337330 ATGCTGGTGCAGGTAGAGGTGGG + Intergenic
961018460 3:123484755-123484777 AGGCAGGCACAGGTCGATGAAGG + Intergenic
961543857 3:127618548-127618570 GTGCAGGTGCAGGTGAGGGAAGG - Intronic
962095668 3:132289898-132289920 ATGCAGGTACAATGGAAGGAGGG + Intergenic
962213582 3:133500790-133500812 AGGCAGGTCCTGGTGGAGGCAGG + Intergenic
964592838 3:158384864-158384886 AAGCAGGTCAGGGTGGAGGAGGG + Intronic
964820416 3:160762777-160762799 ATGCAGGCACCGTTGGAAGAAGG + Intronic
965683498 3:171276373-171276395 ATGGAGGAACCTGTGGAGGAGGG + Intronic
966296346 3:178427816-178427838 ATGCAGGCACTGGTGGTGGCAGG + Intronic
966915696 3:184583160-184583182 ACGCAGGAACAGGCGGGGGAGGG + Intronic
968646162 4:1741629-1741651 CTGCAGGTGCAGCTGGAAGAGGG + Intronic
968662222 4:1803402-1803424 GGGCGGGTGCAGGTGGAGGATGG - Intronic
970882776 4:20951135-20951157 ATGCATGTATAGGTGGGGCAGGG - Intronic
971260216 4:25050183-25050205 ATTCAGGTACATGTGCAGGTTGG - Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
972982875 4:44726581-44726603 ATGCAGATAAAGGCGCAGGAAGG + Exonic
977362688 4:96026199-96026221 GTGAAGGTACAGGTGTAGGATGG - Intergenic
979926780 4:126577449-126577471 ATTCAGGAAGAGGTGGAGAAGGG - Intergenic
982707246 4:158723507-158723529 AGCCAGGAACAGGTGGCGGAGGG - Intergenic
982750036 4:159149941-159149963 AAACAGGCACAGGTGGAGGTTGG + Intronic
983193172 4:164776118-164776140 ATTCAAGTAGAGGGGGAGGAGGG - Intergenic
984180833 4:176480513-176480535 ATGCAGGTAAAGGGCCAGGATGG - Intergenic
984631912 4:182070135-182070157 GTGGAGGCACAGGTGGGGGAAGG + Intergenic
984638833 4:182142567-182142589 GTACAGGTACAGGTGGAGGTCGG + Intergenic
985179332 4:187239555-187239577 AGGCAGGTACAAAGGGAGGAAGG - Intergenic
985337389 4:188911432-188911454 ATGCAGGTGCAGATGGAGGTTGG - Intergenic
985643644 5:1074978-1075000 AGGCGGGTGCAGGTGGAGGGAGG + Intronic
985864420 5:2503172-2503194 ATGGAGGTGCAGGTGGAGTGTGG - Intergenic
988524313 5:31973556-31973578 AACCAGGGAAAGGTGGAGGATGG + Intronic
991126583 5:63076526-63076548 ATGCAGGTAGAGTTGAAGGAAGG - Intergenic
992620692 5:78589608-78589630 ATGCGGGTGCAGGTTGAGGAGGG - Intronic
993005483 5:82424464-82424486 ATGCAGGTGCAGGTTGAAAAAGG - Intergenic
993007139 5:82440926-82440948 AAGCAGGTAGAGGAGGAGGATGG - Intergenic
993223289 5:85131936-85131958 ATGCAGATGCAGGGGGAAGAAGG - Intergenic
993830830 5:92755908-92755930 ATACAGCTACGGGTGCAGGAGGG - Intergenic
994038601 5:95230983-95231005 ATGCAAATAGAGGTAGAGGATGG + Intronic
997214647 5:132100761-132100783 ATGCAGGTGCAGCTGGAGGAAGG - Intergenic
999295858 5:150459061-150459083 GGGCAGGTACACGTGGAGGGTGG + Intergenic
1000844175 5:166258314-166258336 CTGCAGTTAAAGGAGGAGGAAGG + Intergenic
1001840862 5:174875658-174875680 AAGCAGATACAGGTGCAGGTAGG - Intergenic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002307376 5:178291724-178291746 ATGCAGGTGCTGGTGGGTGAGGG + Intronic
1002604780 5:180376154-180376176 GTGCACATGCAGGTGGAGGATGG - Intergenic
1003395747 6:5750578-5750600 TTGCAGGTGCAGGAGGAAGAAGG + Intronic
1003684980 6:8293800-8293822 GTGCAGGTTAATGTGGAGGAAGG + Intergenic
1004351457 6:14893655-14893677 ATGCAGGTGCAGATAAAGGAAGG - Intergenic
1004743081 6:18482081-18482103 ATAGAGGTACAGATGGAGGCAGG - Intergenic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1006481836 6:34301304-34301326 ATGTAGGGAGAGGTGGAGAATGG - Intronic
1007509846 6:42366515-42366537 ATGCAGGTGCAGGAAGAGGAGGG - Intronic
1007821364 6:44562800-44562822 CTGCAAGTCCAGGTGGAGAATGG - Intergenic
1008843586 6:55935112-55935134 ATGCAGGGAAAGGTGAATGAAGG - Intergenic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1010472260 6:76242504-76242526 ATCTAGGGTCAGGTGGAGGAGGG + Intergenic
1010887374 6:81261575-81261597 ATGGAGGTTTAGGAGGAGGAGGG + Intergenic
1011465077 6:87647015-87647037 ATGATGGTACAAGTGAAGGAAGG - Intronic
1013071105 6:106730138-106730160 AAGCAAGTACAGGTAGAGCATGG + Intergenic
1015393832 6:132713522-132713544 TTTCTGGTACAGATGGAGGATGG - Intronic
1015569823 6:134609370-134609392 ATGCATGTTCTGTTGGAGGAAGG - Intergenic
1016834301 6:148461982-148462004 GTGCATGTACAGGGGGAGGCAGG - Intronic
1017595914 6:156028361-156028383 AAGCAGGTTGAGGTGGAGAAGGG + Intergenic
1017918928 6:158854914-158854936 ATTCTGGTACAGTTGGAGGGAGG + Intergenic
1021510835 7:21430117-21430139 GTGCAGGTAGTGGAGGAGGAGGG - Exonic
1024353909 7:48395229-48395251 CTCCAGTTGCAGGTGGAGGATGG + Intronic
1024485446 7:49912538-49912560 ATGCAGGTACACGGTGAGGACGG - Exonic
1024678102 7:51656114-51656136 ATCGAGGTCCAGGTGGAGGAAGG + Intergenic
1025025983 7:55516554-55516576 ATGCAGGGACAGGCAGAGTAGGG + Intronic
1025735541 7:64143606-64143628 ATGCAGGGACGGATGGAGGGAGG + Intronic
1026337997 7:69411284-69411306 ATGCTGGACCTGGTGGAGGAGGG - Intergenic
1026805713 7:73428908-73428930 ATGAAGGCACAGGTGCAGCATGG + Intergenic
1028770319 7:94612776-94612798 AAGGAGGAACAGGTGGAGGTGGG - Intronic
1029653973 7:101912244-101912266 ATGGAGATAGAGGAGGAGGAGGG - Intronic
1032506212 7:132436486-132436508 GTGAAGGTGCAGGTGGAGGAAGG - Intronic
1033337134 7:140463444-140463466 TTGCAGGTATAGCTAGAGGAAGG - Intronic
1034426444 7:151016646-151016668 ATGCAGGGGCATGTGGAGGGGGG - Intronic
1034458053 7:151182208-151182230 ATGCTGGGACTGGAGGAGGAAGG + Intronic
1035174712 7:157042079-157042101 ACGAAGGTACAGGTGAAAGACGG + Intergenic
1035737421 8:1898647-1898669 AGGCAGTTACAGGAGGTGGAGGG + Intronic
1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG + Intergenic
1037806423 8:22060106-22060128 AGGCAGGTCCAGGTGACGGAAGG - Intronic
1038914380 8:32004216-32004238 ATTCAGGGACTGGTTGAGGATGG + Intronic
1040521549 8:48180593-48180615 CTGCAGGCTCAGGTAGAGGAAGG - Intergenic
1041780167 8:61569103-61569125 ATACAGGCACAGGTAGAGGATGG + Intronic
1045009364 8:97944109-97944131 AGGGAGGTCCAGGCGGAGGAGGG + Intronic
1045533374 8:103004789-103004811 AAGCAGTTGCAAGTGGAGGATGG + Intergenic
1045730930 8:105239850-105239872 ATTCAGGAAGATGTGGAGGAAGG - Intronic
1045891594 8:107164398-107164420 ATGGAGGGACAGGTGGCAGAGGG - Intergenic
1047020093 8:120766193-120766215 ATGTAGGTAAAAGTGAAGGAGGG - Intronic
1047756972 8:127926440-127926462 AAGCAGCTCCAGTTGGAGGAAGG - Intergenic
1048071773 8:131028873-131028895 ATACAGGTACAGCTGGGGGCAGG - Intronic
1048734119 8:137479337-137479359 GTGCTGGTACAGGTGGAAAATGG + Intergenic
1049688961 8:143950446-143950468 GTGCAGGTACTGGCGGAGGTGGG + Exonic
1049799939 8:144513029-144513051 GTGCAGGTGCAGGTGCAGGCTGG + Exonic
1052812721 9:33075820-33075842 TGGCAAGGACAGGTGGAGGATGG + Intronic
1053002522 9:34585195-34585217 AGGCAGGTACAGGGTGAGCAAGG + Intronic
1053647289 9:40130960-40130982 TGGCAGATACAGGAGGAGGATGG - Intergenic
1053758437 9:41332883-41332905 TGGCAGATACAGGAGGAGGATGG + Intergenic
1053789815 9:41679197-41679219 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054155325 9:61635559-61635581 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054178155 9:61890887-61890909 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054328289 9:63728916-63728938 TGGCAGATACAGGAGGAGGATGG - Intergenic
1054519394 9:66063548-66063570 ATGCAGGAACAGGTTCAGAAGGG - Intergenic
1054537290 9:66245210-66245232 TGGCAGATACAGGAGGAGGATGG + Intergenic
1054659374 9:67689937-67689959 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1056190760 9:84181775-84181797 ATGCAGGTGCTGGTGTTGGAAGG + Intergenic
1056208829 9:84345663-84345685 TGGCAGGTACAGTTGGAGAATGG - Intergenic
1056330425 9:85516799-85516821 ATGCTGGTAGAGGGTGAGGATGG - Intergenic
1056943833 9:90977195-90977217 ATTCAGGGGCAGGGGGAGGAAGG + Intergenic
1057385699 9:94604345-94604367 AGGCAGCTACAGCTGGATGATGG + Intronic
1057398447 9:94701255-94701277 ATACAGGGCCAGGTGGAGGATGG - Intergenic
1057423996 9:94934201-94934223 AGCCAGGTCCTGGTGGAGGAGGG - Intronic
1057563314 9:96146077-96146099 ATGGGGGTACTGGTGGAGGAAGG + Intergenic
1058463420 9:105204755-105204777 ATGCAGGAACAGGAGCAGAAAGG - Intergenic
1058804650 9:108579040-108579062 GGACAGGTACAGCTGGAGGAGGG + Intergenic
1058980643 9:110166830-110166852 ATGCAGTTACAGGCAGAGGTGGG - Intronic
1059940362 9:119353290-119353312 AAGGAGGGAAAGGTGGAGGAAGG - Intronic
1060352501 9:122871112-122871134 ATGTGGCTACAGGTGCAGGAAGG - Intronic
1060785884 9:126451386-126451408 CTGCACCTCCAGGTGGAGGAGGG + Intronic
1061196151 9:129108260-129108282 ATGCAGGTAGGGATGGGGGAGGG + Intronic
1062076693 9:134593580-134593602 CTCCAGGCGCAGGTGGAGGATGG - Intergenic
1062400727 9:136371532-136371554 GGGCAGGGACAGGTGGAGGCTGG + Intronic
1202795078 9_KI270719v1_random:114257-114279 TGGCAGATACAGGAGGAGGATGG - Intergenic
1185491194 X:518242-518264 ATACAGGCTGAGGTGGAGGATGG - Intergenic
1186855826 X:13625216-13625238 ATGGAGGTGCAGGAGGAGCAGGG - Intronic
1187007306 X:15245476-15245498 ATGCAGGAACAGGGGTAGGGGGG - Intronic
1187292878 X:17972263-17972285 ATGCTGGTGTAGGAGGAGGAAGG - Intergenic
1189526082 X:41823409-41823431 ATGCAGGGGCATGTGGAGGCAGG - Intronic
1190311469 X:49119815-49119837 CTACAGGTTCAGGTAGAGGAAGG + Intronic
1193189105 X:78548572-78548594 AAGAAGGCACAGGAGGAGGAGGG - Intergenic
1193640217 X:84003226-84003248 GTGCAAGTATAGGTGGAGGAGGG - Intergenic
1194427426 X:93756812-93756834 ATTTAGGTTCAGGTGGAGGTGGG + Intergenic
1199514701 X:148663343-148663365 ATGTAGATACCTGTGGAGGAAGG - Intronic
1199702492 X:150392881-150392903 ATGCAGGTAATGGGGGAGGGGGG - Intronic
1199710286 X:150464200-150464222 ATGCAGGCTGCGGTGGAGGAAGG - Intronic
1199874662 X:151920655-151920677 ATGAAGGTAGGGGTGGGGGAGGG - Intronic
1202088496 Y:21163704-21163726 GAGCAGGTGCAGATGGAGGAAGG + Intergenic