ID: 1143286420

View in Genome Browser
Species Human (GRCh38)
Location 17:5793087-5793109
Sequence CAGGGTATACTTGGGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143286416_1143286420 -6 Left 1143286416 17:5793070-5793092 CCTGAGGCGGGAGACTGCAGGGT 0: 1
1: 0
2: 0
3: 25
4: 212
Right 1143286420 17:5793087-5793109 CAGGGTATACTTGGGTAGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 147
1143286413_1143286420 1 Left 1143286413 17:5793063-5793085 CCAAAGGCCTGAGGCGGGAGACT 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1143286420 17:5793087-5793109 CAGGGTATACTTGGGTAGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143286420 Original CRISPR CAGGGTATACTTGGGTAGGA AGG Intronic
902171713 1:14616793-14616815 CAGGATACACTTGGGAAGGCTGG + Intronic
902623272 1:17662681-17662703 CAGGGTATGGTAGGGAAGGATGG + Intronic
902836077 1:19047574-19047596 CAGAGTTTACTGGGGCAGGAGGG + Intergenic
905441026 1:37996692-37996714 CAGGGTATAATGGGGAAGGAAGG - Intergenic
906125693 1:43425779-43425801 CAGGGTATCCTGGGCTAAGAGGG + Intronic
906200260 1:43955672-43955694 GAGGTTATACTGGAGTAGGATGG - Intronic
909336528 1:74480997-74481019 CAGGGTACACATGAGTGGGAGGG + Intronic
909788657 1:79644893-79644915 CACAGTATAGTTGGGTAGGAAGG - Intergenic
912525343 1:110278707-110278729 CTGGGTCTGCTTGGCTAGGAAGG - Intronic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
915318915 1:155045377-155045399 CAGGGTGTATTGGGGGAGGATGG + Intronic
915592499 1:156878730-156878752 CAGGGTCTGCCTGGGTGGGAAGG + Intronic
916287186 1:163121092-163121114 GAGGGACTACTGGGGTAGGAGGG + Intronic
918253808 1:182729590-182729612 CAGGGTTCACTTAGGTAGCAAGG - Intergenic
919739971 1:200975455-200975477 GAGGGTAGACTCGGGTAGGGTGG - Intronic
921439811 1:215172587-215172609 TATGTTATACTTGCGTAGGATGG - Intronic
1070906313 10:80076514-80076536 CAGGGTAGCCTTGGTGAGGATGG + Intergenic
1071504824 10:86226322-86226344 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504831 10:86226340-86226362 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504859 10:86226416-86226438 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504866 10:86226434-86226456 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504880 10:86226470-86226492 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504936 10:86226630-86226652 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1074210891 10:111333997-111334019 AATGGTATCCTGGGGTAGGATGG + Intergenic
1074828130 10:117229152-117229174 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1074828586 10:117232280-117232302 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1076336762 10:129712142-129712164 CAGGGTTTCCATGGGTGGGAGGG - Intronic
1079146373 11:17855961-17855983 CATGGTATACTTGGGAATGTTGG - Intronic
1082098314 11:48149871-48149893 CAGGGTATAATTTGGCAAGAGGG - Intronic
1082105638 11:48218251-48218273 CAGGGAATATTTAGGAAGGAGGG + Intergenic
1084345356 11:68543606-68543628 CAGGGAAGACTGGGGCAGGAGGG - Intronic
1084863375 11:72037150-72037172 TAGAGTATACTTGGATAGGAAGG - Intronic
1087949194 11:104199277-104199299 CAGGGTATATTAGGGCAGGTTGG + Intergenic
1089346121 11:117792857-117792879 CTGGGGATATTGGGGTAGGATGG - Intronic
1092773311 12:11918268-11918290 TAGGGTCTACTTAGGTAGCAGGG - Intergenic
1093063041 12:14627413-14627435 CAGAGTCTAGTTGGGTAGAATGG + Intronic
1102416712 12:112768948-112768970 TAGGGTGTACTAGAGTAGGAAGG - Intronic
1104054415 12:125218516-125218538 CATGGCATTCTGGGGTAGGAGGG + Intronic
1107253053 13:38389036-38389058 CAGGGTATACTTGGTCAGTTTGG + Intergenic
1116609378 14:47047505-47047527 CTGGGTATACTTGGGAAAGTAGG + Intronic
1118843343 14:69528432-69528454 CAGGGGAGACTTGGGAAGCAGGG - Exonic
1121124107 14:91394972-91394994 CAGGGGACACGTGGGTGGGAGGG - Intronic
1121545975 14:94763907-94763929 CAAGGTATATTTGGGTACAAGGG + Intergenic
1128670950 15:69574456-69574478 GAGAGAATACTTTGGTAGGAGGG - Intergenic
1129769664 15:78194854-78194876 CAGGGTAGACTGGGGTAGACTGG + Intronic
1132045500 15:98559819-98559841 CGGGGCATACTTGGGTAGCAAGG + Intergenic
1132263865 15:100449108-100449130 AATGGTATACTTGGGCAGTAGGG - Intronic
1133526780 16:6613290-6613312 AAGGGTAAACTTGGGAAGGATGG + Intronic
1135792978 16:25415067-25415089 CATGGAATACTTGGGGAGGCTGG + Intergenic
1137631332 16:49947895-49947917 GAGGATATACTGGAGTAGGATGG + Intergenic
1143286420 17:5793087-5793109 CAGGGTATACTTGGGTAGGAAGG + Intronic
1149001088 17:51758468-51758490 CATGGTATCCTTGGGTTGGATGG - Intronic
1149140873 17:53431510-53431532 CAGGGTATACTTGGCAATCAAGG + Intergenic
1149560467 17:57604703-57604725 CAGGGGATTCTGGGGAAGGAAGG + Intronic
1151390667 17:73784795-73784817 CAGGCTACACTTGAGTAGCAAGG + Intergenic
1153273754 18:3348592-3348614 CAGGGTATAATGAGGTAGGAAGG - Intergenic
1155108859 18:22694162-22694184 TAGGGAATACATGGTTAGGAAGG - Intergenic
1155162255 18:23205642-23205664 GAGGTTATACTGGAGTAGGACGG + Intronic
1159099022 18:63937839-63937861 CTGGGGATTGTTGGGTAGGAGGG - Intergenic
1159800533 18:72893936-72893958 CAGGAGAAACATGGGTAGGATGG + Intergenic
1159920954 18:74227006-74227028 GAGGTTATACTAGGGTAGGGTGG - Intergenic
1160299854 18:77669654-77669676 GAGGTTAGACTTGAGTAGGATGG + Intergenic
1162194817 19:8976365-8976387 CAGGGTAGACTTCAGTAAGATGG + Exonic
1163551627 19:17968833-17968855 CGGGGTGTATTTGGGTTGGAAGG - Intronic
1164455611 19:28404134-28404156 CAGGGTGTACATGGGGAGGCTGG + Intergenic
1165952326 19:39481227-39481249 CAGGTGATACTTGAGCAGGAGGG + Intronic
1168193476 19:54756592-54756614 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168195539 19:54771330-54771352 CAGGGTAGACATGGGGTGGAGGG - Intronic
926371631 2:12184696-12184718 AAGGGTAGACCTGGGTAAGAGGG + Intergenic
926431732 2:12793919-12793941 CAGACTATTCTTGAGTAGGATGG + Intergenic
928748632 2:34445357-34445379 CAGGAAATGCTTGGGAAGGAGGG - Intergenic
932650784 2:73553780-73553802 AAGGATATATATGGGTAGGAGGG + Intronic
933619019 2:84515844-84515866 CAGGGTCTGCTTTGGTAGAAGGG + Intergenic
935548275 2:104423865-104423887 CAGGGAAGACTTGGGGAGGTTGG - Intergenic
940708769 2:157136433-157136455 CTAGGTAAACTAGGGTAGGATGG - Intergenic
942298769 2:174542076-174542098 CATTGTATACTTCTGTAGGAAGG + Intergenic
942428234 2:175881747-175881769 CTGGGTCTACTTGGGGTGGAGGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945234355 2:207620922-207620944 CAGACTACACTTGGGTAGGAAGG - Intronic
946192287 2:218013916-218013938 CAGGGCAAACTTGGGGAGAAGGG - Intergenic
946909840 2:224449150-224449172 CAGAATATACTTCAGTAGGAAGG - Intergenic
948560722 2:238849328-238849350 CAGGGTTTGCCTGGGGAGGACGG + Intronic
1168853064 20:989761-989783 CAGGTTATAACTGGGTAAGAAGG - Intronic
1169067891 20:2704829-2704851 CAGGGGATATTTGGGGAAGAGGG + Intronic
1169401001 20:5280108-5280130 AATGGCAGACTTGGGTAGGAGGG + Intergenic
1172925606 20:38531755-38531777 TAGGGTATACTGGGGTAAGTTGG + Intronic
1173481176 20:43400671-43400693 CAGGTCATACTGGAGTAGGATGG - Intergenic
1174838695 20:53881404-53881426 CCTTGTATATTTGGGTAGGAGGG - Intergenic
1174936126 20:54871021-54871043 CAGGGTCTACTTGAGTGGGGAGG + Intergenic
1178215431 21:30592431-30592453 GAGGTCATCCTTGGGTAGGAAGG - Exonic
1178215512 21:30592914-30592936 CAGGGTATTTTTGGGTTAGATGG - Exonic
1178215999 21:30598888-30598910 GAGGTTGTCCTTGGGTAGGAAGG + Exonic
1180027457 21:45175928-45175950 CAGGGCGTTCTTGGGGAGGACGG - Exonic
1181183636 22:21085333-21085355 CAGGGTATTCTTGGGCTGCAGGG + Intergenic
1183375652 22:37463405-37463427 CAGGGTAGACGTGGGGAGGGAGG + Intergenic
1184848339 22:47102750-47102772 CAGAGTAGGATTGGGTAGGAGGG + Intronic
1184891597 22:47382752-47382774 CAGGGAATACTTTGGGAGTATGG + Intergenic
1185416988 22:50715808-50715830 CAGGGTGGACTTGGGTTTGAAGG + Intergenic
953587649 3:44219183-44219205 GAGGGTATAGGTGGGGAGGAGGG - Intergenic
959172770 3:102862409-102862431 CAGGGGCTACATGGGTGGGAGGG + Intergenic
960448364 3:117776040-117776062 GAAGGTTTACTGGGGTAGGAGGG + Intergenic
962360113 3:134733532-134733554 GAGGTTATACTGGGGTAGGGTGG + Intronic
964763798 3:160158935-160158957 CAGGGTATTCTAGGAGAGGAAGG + Intergenic
968984103 4:3866049-3866071 CCGGGTAGACGTGGGCAGGAGGG + Intergenic
973160991 4:47016201-47016223 CATGTTATACCTGGGTAAGAAGG - Intronic
973196542 4:47449437-47449459 CATGGTGGACTTGGGGAGGAAGG + Intergenic
975516848 4:75257544-75257566 AAGGATATACATGTGTAGGATGG - Intergenic
978786869 4:112619875-112619897 CATAGTATACTTAGGTAGAAAGG - Intronic
979904085 4:126262482-126262504 CAGAGTAGACTGGGGTAGGGAGG + Intergenic
985355370 4:189113623-189113645 AAGGGTACACATGCGTAGGAAGG - Intergenic
986693258 5:10331284-10331306 GAGAGTATACTTGGGAGGGAAGG - Intergenic
986757303 5:10850099-10850121 GAGGGTATACTTGAGGAAGATGG + Intergenic
990996489 5:61737085-61737107 CAGGGTGCAGTTGGGGAGGAAGG + Intronic
991244273 5:64492431-64492453 GAGGGTAGAGGTGGGTAGGAGGG + Intergenic
991395927 5:66205398-66205420 CAGGTCATACTAGAGTAGGATGG - Intergenic
993532845 5:89045029-89045051 CAGGGAATGCTTGGGTATGGGGG + Intergenic
995876445 5:116795174-116795196 CAGGGTCTCCCTGGGTAGGCTGG - Intergenic
998148158 5:139742129-139742151 CAGGGTATATGTGGGTATGGGGG + Intergenic
1000635845 5:163642936-163642958 CTGAGTATACATGGGTGGGAGGG - Intergenic
1002099925 5:176852443-176852465 CAGGGAAAACTGGGGAAGGAAGG - Intronic
1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG + Intergenic
1003112309 6:3260244-3260266 AAGGTTATACTGGAGTAGGATGG - Intronic
1005307188 6:24525191-24525213 CAGATTATATTTGGGGAGGAAGG + Intronic
1007158523 6:39770156-39770178 GAGGGAGTACATGGGTAGGAAGG - Intergenic
1007206195 6:40153580-40153602 CTGGGTATACTTTTATAGGATGG - Intergenic
1007865944 6:44971020-44971042 CTGTGTATCCTTGGGGAGGATGG - Intronic
1007944114 6:45810132-45810154 GAGGGTATATTGTGGTAGGATGG - Intergenic
1013091967 6:106908270-106908292 CAAGGGAGACTTGGGGAGGAGGG - Intergenic
1016356136 6:143220219-143220241 CAGGGTATCTTTAGTTAGGATGG - Intronic
1017051634 6:150399092-150399114 CAGGGTACCCTTGGGTCGCACGG + Exonic
1019501548 7:1367247-1367269 CAGGGGATTCCTGGGAAGGAGGG - Intergenic
1019613216 7:1947278-1947300 CAGGCAATACTTGGGGAGGGAGG + Intronic
1019706090 7:2497947-2497969 CAGGGTCTGCTGGGGAAGGAGGG + Intergenic
1019740433 7:2670337-2670359 GAGGGTACGCTTGGGTGGGAGGG + Intergenic
1022908921 7:34881475-34881497 GAGGTCATACTGGGGTAGGATGG - Intergenic
1023028610 7:36074193-36074215 GAAGGTCTACTTGGGGAGGAGGG - Intergenic
1027998768 7:85464208-85464230 CAGGGTATATGTGTGTAGGGTGG - Intergenic
1033374836 7:140748756-140748778 CAGGGAATAGTTGCTTAGGAAGG + Intronic
1036595389 8:10207196-10207218 CAGTGTTTACTAGGGTGGGAAGG + Intronic
1042672169 8:71276429-71276451 CATGGAATACTTGGGTAGAGAGG - Intronic
1043245184 8:77990403-77990425 GAGGTTATTCTGGGGTAGGATGG + Intergenic
1049833571 8:144718234-144718256 TAGGATGTACTTGGGAAGGAAGG - Intergenic
1049956732 9:700008-700030 CAGGTTATACGTAGGTAGGTAGG - Intronic
1056880410 9:90386672-90386694 CAGGGTAGACTTGGGCAAGGGGG + Intergenic
1061158833 9:128881917-128881939 CGGGGTGTACTTGGGAACGAGGG - Exonic
1186902200 X:14068691-14068713 GAGGTTATACTGGAGTAGGATGG - Intergenic
1187724732 X:22190608-22190630 CAGGGTATGCTGGTGAAGGAAGG + Intronic
1188843287 X:35042368-35042390 TGGGGTCTACTTGGGTGGGAAGG + Intergenic
1189054865 X:37687940-37687962 CAGGGCTTACCTGGCTAGGAAGG - Intronic
1193479225 X:82006864-82006886 CGGGGTATACTTGAGGATGAAGG - Intergenic
1194729672 X:97439100-97439122 CAGGGTAGAAGAGGGTAGGATGG + Intronic
1194842417 X:98760433-98760455 CAGGGTCTACTTGTGTGGGGAGG - Intergenic
1196970961 X:121108213-121108235 CAGGGTGTATTTGGTTAAGATGG - Intergenic
1199034739 X:143036443-143036465 CAGAGTATACTTGGGAATTATGG - Intergenic
1199818368 X:151420498-151420520 GAGGGTAAAGTTGGGTAGTAAGG + Intergenic
1201520486 Y:14868271-14868293 TAGGGTATTCTTGGCTAGGTGGG - Intergenic