ID: 1143286853

View in Genome Browser
Species Human (GRCh38)
Location 17:5796542-5796564
Sequence AGGTGAGAATGTAAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 821
Summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 755}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143286853_1143286860 0 Left 1143286853 17:5796542-5796564 CCAACTTCCTTACATTCTCACCT 0: 1
1: 0
2: 5
3: 60
4: 755
Right 1143286860 17:5796565-5796587 GGTGTTATTACTTGGGCTCTGGG 0: 1
1: 0
2: 1
3: 2
4: 90
1143286853_1143286859 -1 Left 1143286853 17:5796542-5796564 CCAACTTCCTTACATTCTCACCT 0: 1
1: 0
2: 5
3: 60
4: 755
Right 1143286859 17:5796564-5796586 TGGTGTTATTACTTGGGCTCTGG 0: 1
1: 0
2: 2
3: 9
4: 160
1143286853_1143286857 -7 Left 1143286853 17:5796542-5796564 CCAACTTCCTTACATTCTCACCT 0: 1
1: 0
2: 5
3: 60
4: 755
Right 1143286857 17:5796558-5796580 CTCACCTGGTGTTATTACTTGGG 0: 1
1: 0
2: 0
3: 12
4: 94
1143286853_1143286856 -8 Left 1143286853 17:5796542-5796564 CCAACTTCCTTACATTCTCACCT 0: 1
1: 0
2: 5
3: 60
4: 755
Right 1143286856 17:5796557-5796579 TCTCACCTGGTGTTATTACTTGG 0: 1
1: 0
2: 0
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143286853 Original CRISPR AGGTGAGAATGTAAGGAAGT TGG (reversed) Intronic
901453711 1:9351730-9351752 AGGTGTGAACAAAAGGAAGTTGG + Intronic
902141430 1:14360037-14360059 AGGGGAGAATGGAACCAAGTTGG - Intergenic
903839164 1:26225900-26225922 AGGTGAGAATGGAAGGAGACAGG - Intergenic
904776128 1:32907998-32908020 AGGTGGAAAGGTAAGGTAGTTGG - Intergenic
906224147 1:44107063-44107085 AGGTGGGAATGTAATGATGATGG + Intergenic
906301031 1:44681775-44681797 AGGTGGGAAGGTAAGGAGCTTGG + Intronic
907050810 1:51329137-51329159 ATGTAAGCATATAAGGAAGTGGG + Intronic
907754622 1:57299677-57299699 AGGTGAGAATTTTAGAAGGTTGG - Intronic
907855612 1:58300729-58300751 AGGAGAGAAAGCAAGGAAGTAGG + Intronic
908158054 1:61376913-61376935 AGATGAAAATGTAAGGATTTGGG + Intronic
908346052 1:63234217-63234239 TGGTGAGAATGTAGAGAAATTGG - Intergenic
908520764 1:64939384-64939406 TTGTGTGAATGTATGGAAGTTGG - Intronic
908523745 1:64968128-64968150 AGGTGAGGATGTAAAGAAAAAGG + Intergenic
908636119 1:66167059-66167081 TGGAGAGAATGTAGGGAAATTGG + Intronic
908720855 1:67124260-67124282 ACATGAAAATGTAAGTAAGTAGG + Intronic
908846383 1:68328771-68328793 AGGTGATAGTATTAGGAAGTGGG + Intergenic
909041796 1:70662169-70662191 TGGTGAGGATGTAAAGAATTTGG - Intergenic
909368481 1:74857360-74857382 AAGAGAGAATGTAAAGATGTAGG - Intergenic
909440838 1:75693741-75693763 AGGAGAAAATCTAAGGAAGTGGG + Intergenic
909502234 1:76347362-76347384 AGGTAAGTAGGTAAGTAAGTGGG - Intronic
910843175 1:91580730-91580752 TGGTGAGGATGTGAGGAAATTGG + Intergenic
911950674 1:104170392-104170414 AGGAGAGAATGGAAGGACATGGG + Intergenic
912592583 1:110840341-110840363 TGGTGAGAATGTAGAGAAGTTGG + Intergenic
912966417 1:114241117-114241139 TGGGGAGAATGGAAGCAAGTTGG + Intergenic
913233541 1:116761677-116761699 AGGTGAGAATACCAGGAAGCAGG + Intronic
916346471 1:163797413-163797435 AGGTGGTAATGTAAGTAAGGGGG - Intergenic
916429511 1:164713552-164713574 AGGAGAGGATGGAAGGAAGGGGG - Intronic
916522467 1:165577068-165577090 TGGTGAGGATGTAGAGAAGTTGG + Intergenic
916596678 1:166250672-166250694 AGGGGAGAATGGAACCAAGTCGG - Intergenic
916970394 1:170007276-170007298 AGGAGAGAATAGAAGGAAGTGGG + Intronic
917023216 1:170613123-170613145 AGGGGAGAATGGAACCAAGTTGG - Intergenic
917162984 1:172079216-172079238 CGGGGAGAATGGAATGAAGTTGG - Intronic
917278699 1:173358138-173358160 ACGTGATGATGGAAGGAAGTTGG + Intergenic
917304251 1:173610621-173610643 AGGTGAGAAGGGAAGGAGGGGGG + Intronic
918316057 1:183323582-183323604 ATCTGAGAATGCAAAGAAGTGGG + Intronic
918824557 1:189306638-189306660 TGGTGAGAATGTGAAGAAATGGG - Intergenic
919187275 1:194168690-194168712 GGGTGAGAATATTAGGAGGTGGG + Intergenic
919420120 1:197359731-197359753 TGGTGAGAATGCAAAGAAATTGG - Intronic
919460131 1:197867058-197867080 AGGGAAGAAAGTAAGGAAGGAGG + Intergenic
919460843 1:197875052-197875074 TGGTGAGAATGTGAAGAAATTGG - Intergenic
919568303 1:199217164-199217186 AGATGAGAATGGAACGAACTTGG - Intergenic
919575063 1:199297911-199297933 AGGTGAAAATGTATAGGAGTAGG - Intergenic
919697991 1:200598881-200598903 AGGAGAGATTCTAAGGAAGGAGG - Intronic
920148174 1:203880934-203880956 AGTTCAGAATCTAAAGAAGTTGG - Intergenic
920303222 1:205002296-205002318 AGCTGAGAGTTTAAGGAAGTAGG + Intronic
920862119 1:209718584-209718606 TGGTGAGAATGTGGGGAAATTGG + Intronic
922209877 1:223478918-223478940 AGGTGAGAGGGTGAGGAGGTGGG + Intergenic
922209893 1:223478966-223478988 AGGTGAGAGGGTGAGGAGGTGGG + Intergenic
922209929 1:223479060-223479082 AGGTGAGAGGGTGAGGAGGTGGG + Intergenic
922209960 1:223479147-223479169 AGGTGAGAAGGTGAGGAGGTAGG + Intergenic
922626472 1:227050318-227050340 AGGTGAGGATGTGGGGAAATGGG + Intronic
922679279 1:227578334-227578356 TGGGGAGAATGAAAGCAAGTTGG - Intronic
922716172 1:227873697-227873719 CGGGGAGAATGGAATGAAGTTGG + Intergenic
922794485 1:228333322-228333344 AGGTGAGAAGGAGAGGGAGTGGG + Exonic
923021348 1:230166697-230166719 AGGGAAGAAAGCAAGGAAGTTGG - Intronic
923073490 1:230588317-230588339 AGGTGTGTAGGTAAGTAAGTAGG + Intergenic
923073568 1:230588865-230588887 AGGTGTGTAGGTAAGTAAGTAGG + Intergenic
923539072 1:234875497-234875519 AGCTGAGAATGAAAGGAAGGTGG + Intergenic
923891285 1:238217715-238217737 TGGTGAGAAAGGAAGCAAGTTGG + Intergenic
923948061 1:238912836-238912858 AGGTGACAGTATTAGGAAGTAGG - Intergenic
924309896 1:242729350-242729372 TGGTGAGGATGTAAAGAAATTGG - Intergenic
924484483 1:244467471-244467493 TGGTAAGAATGTAAAGCAGTAGG + Intronic
924911533 1:248518691-248518713 TGGTGAGAATGGAACCAAGTTGG - Intergenic
924912568 1:248529349-248529371 TGGTGAGAATGGAACCAAGTTGG + Intergenic
1063386232 10:5617821-5617843 AGGTGAGCAAGTAAGCAGGTAGG + Intergenic
1063386235 10:5617845-5617867 AGGTGAGCAAGTAAGCAGGTAGG + Intergenic
1063920333 10:10926225-10926247 AGGTGAGAATGAATGGGAGGTGG + Intergenic
1063969026 10:11368315-11368337 AAGTGAGGAAGTGAGGAAGTAGG - Intergenic
1064105652 10:12498804-12498826 AAGTTTGAATGTAAAGAAGTAGG - Intronic
1064339851 10:14476087-14476109 AGGAGAGAATATAAGGGGGTGGG + Intergenic
1064935255 10:20672146-20672168 AGGTGAGAGTGTTAGCAAATAGG - Intergenic
1065962043 10:30741773-30741795 ACGTGAGCATTTAAGGAATTTGG + Intergenic
1066077246 10:31891679-31891701 CGGGGAGAATGGAACGAAGTTGG - Intronic
1066297691 10:34069027-34069049 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
1067810571 10:49424222-49424244 TGGCGAGAATGGAAGCAAGTTGG - Intergenic
1068085933 10:52373824-52373846 AGGGGAGAATGGAACCAAGTTGG - Intergenic
1068152882 10:53156691-53156713 TGGTGAGGCTGTAGGGAAGTAGG + Intergenic
1068258527 10:54545548-54545570 AGGAGAGAAAGCAAGGAAGGAGG + Intronic
1068271367 10:54730306-54730328 AGGTGAGAATATATGGCATTTGG - Intronic
1068493380 10:57753215-57753237 TGGTGAGAATGTAGAGAAATTGG + Intergenic
1069805814 10:71124092-71124114 TGGCGAGAATGTAAGCAACTTGG - Intergenic
1069948080 10:72001053-72001075 AGGTGAGAATGTGAGACAGAGGG + Intronic
1071058756 10:81544768-81544790 TGGTGAGGATGTGAAGAAGTTGG + Intergenic
1071211008 10:83341968-83341990 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
1071351945 10:84755337-84755359 ATGTGAGAATATGAGGAAATGGG + Intergenic
1071763261 10:88633202-88633224 CGGGGAGAATGTAACCAAGTTGG - Intergenic
1072069920 10:91906247-91906269 AGGTGAGAATACCAGGAGGTAGG + Intergenic
1072075826 10:91972374-91972396 AGGTGAGAGTGGGAGGGAGTGGG - Intronic
1072375102 10:94806536-94806558 AAGTGAGAATGTGAAGAAATTGG - Intronic
1072914167 10:99526998-99527020 AGGTGAGGAAGAAAGGAAGTGGG + Intergenic
1073140968 10:101247429-101247451 AGGTGAGAAGATAAGGGATTGGG + Intergenic
1073487918 10:103833014-103833036 TGGTGAGAATATGGGGAAGTGGG - Intronic
1073979025 10:109132951-109132973 TGGTGAGAATGGAACCAAGTTGG + Intergenic
1074388669 10:113037962-113037984 AAGTGAGAATGGGAAGAAGTTGG + Intronic
1074458135 10:113613159-113613181 AGGACAGAATGAATGGAAGTGGG - Intronic
1074534982 10:114322366-114322388 AGGGGAGAATGAAAGGAGGTGGG - Intronic
1075205774 10:120446592-120446614 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
1075281941 10:121146628-121146650 TGGGGAGAATGGAACGAAGTTGG - Intergenic
1075446830 10:122519082-122519104 AGGTGAGAGTGGAAGGAAAGTGG - Intergenic
1075720802 10:124586242-124586264 AGGTGACAATGTAGGGACGCAGG - Intronic
1075755176 10:124805371-124805393 AAGTGAGAATCTATGGGAGTGGG - Intronic
1076385834 10:130054654-130054676 TGGTGAGAATGTGAAGAAATTGG - Intergenic
1076602009 10:131663372-131663394 AGGTGTGAATGCATGGAAATGGG + Intergenic
1077994695 11:7443127-7443149 AGGTGAACATGTTAGGCAGTCGG - Intronic
1078190990 11:9092066-9092088 AGGTGGGAGTGGAAGGAATTGGG + Intronic
1078303931 11:10163163-10163185 AGATGAGAATGACAGAAAGTGGG + Intronic
1078693814 11:13608971-13608993 TGGTGAGGATGTAAAGAAATTGG - Intergenic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1079452513 11:20609607-20609629 AGGTGAGACTGGAAGGCAATTGG - Intronic
1079653867 11:22964502-22964524 TGGGGAGAATGGAAGCAAGTTGG - Intergenic
1079724186 11:23859659-23859681 AGGTGAGAATATATGGTATTTGG - Intergenic
1079800601 11:24863059-24863081 AGGTAAGGATGTGAGGAAATAGG + Intronic
1080059362 11:27940603-27940625 TGGGGAGAATGGAACGAAGTTGG + Intergenic
1080378501 11:31742289-31742311 CGGTGAGAATGGAACCAAGTTGG + Intronic
1081169385 11:39848062-39848084 AGGGGAGAATGGAACCAAGTTGG + Intergenic
1081362465 11:42197394-42197416 AAGTGAGAATGTATGGTATTTGG - Intergenic
1081442853 11:43099604-43099626 CGGTGAGAATGGAACCAAGTTGG - Intergenic
1081454251 11:43205829-43205851 AGGGGAGAATGGAACCAAGTTGG - Intergenic
1082117976 11:48347523-48347545 GGGGGAGAATGGAAGCAAGTTGG + Intergenic
1082150326 11:48730800-48730822 AGGGGAGAATGGAAGTAAGTTGG + Intergenic
1082182737 11:49140201-49140223 TGGGGAGAATATAAGCAAGTTGG + Intergenic
1082971709 11:59029846-59029868 TGGGGAGAATGTGAGGAAATGGG - Intronic
1083086928 11:60158404-60158426 TGGTGAGGTTGTAAAGAAGTTGG + Intergenic
1083558426 11:63651720-63651742 AGCAGAGAATGAAAGAAAGTGGG - Intronic
1083730671 11:64650819-64650841 CGGGGAGAATGTAAGGAAGGAGG + Intronic
1083910054 11:65702188-65702210 TGGTGAGAATGTGAAGAAATTGG + Intergenic
1085168550 11:74427025-74427047 TGGTGAGAATGTGGGGAAATGGG - Intergenic
1085248633 11:75125933-75125955 AGAGGAGCATGTAAGGAAGGAGG + Intronic
1085800851 11:79587631-79587653 TGGGGAGAATGGAACGAAGTTGG + Intergenic
1086062760 11:82717366-82717388 AGGTGTGCATGTGAGGAAGTGGG - Intergenic
1086124243 11:83333596-83333618 AGGTGAGTATGGAGGGGAGTTGG - Intergenic
1086611948 11:88767949-88767971 TGGTAAGAATGTAGGGAAATTGG + Intronic
1086871523 11:92043073-92043095 ACTTGAGAATCTAAGGCAGTAGG + Intergenic
1086902054 11:92378959-92378981 AGGTGATAATATTAGGAAGTAGG - Intronic
1086943264 11:92819961-92819983 GGGTGTGAATATCAGGAAGTGGG - Intronic
1087181613 11:95147773-95147795 AGATGGTAATGTCAGGAAGTGGG - Intergenic
1087270943 11:96111046-96111068 AGGTCAGAAAATAAGGGAGTGGG + Intronic
1087365779 11:97217204-97217226 AGGACAGAATGAAAGGAAGTAGG - Intergenic
1088342703 11:108787438-108787460 AGGAGAGAGTGTAAGCAACTTGG - Intronic
1088656040 11:112000833-112000855 TGGTGAGAATGTGGAGAAGTTGG + Intronic
1088890474 11:114040331-114040353 AGGTGATGATATTAGGAAGTAGG - Intergenic
1088934639 11:114387355-114387377 ATGTGATAATATTAGGAAGTAGG + Intergenic
1088948888 11:114545072-114545094 TGGTGAGAATGTAGAGCAGTAGG + Intronic
1089059903 11:115618006-115618028 AGCAGAGGATGTAAGGAACTAGG + Intergenic
1089982258 11:122781989-122782011 ATTTGAGAATTTAAGGAACTTGG - Intronic
1090746497 11:129709784-129709806 TGGGGAGAGTCTAAGGAAGTGGG + Intergenic
1090756051 11:129792903-129792925 AGGTGAGAATGGAAGGAGAGAGG + Intergenic
1090984846 11:131757080-131757102 AGGAGATAATGTATGGAATTAGG - Intronic
1091490644 12:929743-929765 AGGTGAGCAGGTAGGGAAGTAGG - Intronic
1091559250 12:1598542-1598564 GGGTGAGAATGTAAAGTTGTGGG + Intronic
1091783969 12:3231221-3231243 AGGGGAGAATGAAGGGAAGCGGG + Intronic
1092718610 12:11417693-11417715 AGGGGAGAATGGAACCAAGTTGG + Intronic
1093275307 12:17117888-17117910 TGGGGAGAATGTAAACAAGTTGG + Intergenic
1093309667 12:17563693-17563715 AGGGGAGAATGGAACCAAGTTGG - Intergenic
1093696684 12:22168977-22168999 TGGTGAGAATGCAAAGAAATTGG + Intronic
1094478578 12:30861767-30861789 AGGTGATAGTATAAGGAGGTAGG - Intergenic
1094724014 12:33093791-33093813 AGGGGAGAATGTGGAGAAGTTGG - Intergenic
1094747111 12:33357600-33357622 AAGTGAGAATGTCAGGTAGATGG - Intergenic
1094802050 12:34048422-34048444 AGGTGAGGACGTGAGGATGTGGG - Intergenic
1094804051 12:34071420-34071442 TGGGGAGAATGGAACGAAGTTGG - Intergenic
1094805332 12:34084764-34084786 TGGGGAGAATGGAACGAAGTTGG + Intergenic
1094877844 12:34671673-34671695 TGGGGAGAATGGAAGCAAGTTGG - Intergenic
1095059433 12:37665188-37665210 AGGGGAGAATGGAACCAAGTTGG - Intergenic
1095120344 12:38410298-38410320 AGGTGATAGTGTTAGGAGGTGGG + Intergenic
1095483277 12:42657965-42657987 TGGTGAGAATGCAACCAAGTTGG - Intergenic
1095990515 12:48031123-48031145 AGGTGAGCATTAAAGGAAGGCGG + Intergenic
1096095531 12:48933100-48933122 AGGTGTAGATGTGAGGAAGTTGG - Intronic
1096904025 12:54916596-54916618 TGGTGAGAGTGTAAGAAAATGGG - Intergenic
1097635919 12:62121978-62122000 AAGTGAGAATGTGTGGTAGTTGG - Intronic
1097671335 12:62542734-62542756 ATGTGTGAATGTCAAGAAGTAGG - Intronic
1097740955 12:63241915-63241937 TGGGGAGAATGGAACGAAGTTGG + Intergenic
1098176963 12:67802917-67802939 AGGTGAGCAAGGAAGGCAGTCGG - Intergenic
1098438623 12:70495811-70495833 TGGGGAGAATGGAAGCAAGTTGG - Intergenic
1098471206 12:70846550-70846572 AGGTGATAGTGTTAGGAGGTGGG + Intronic
1098502700 12:71212083-71212105 AAGTGAGAACGTATGGAATTTGG - Intronic
1098899996 12:76102681-76102703 AGGGGAGAATTTCAGGAAGTTGG - Intergenic
1099261419 12:80387365-80387387 AGGGGAGAATGGAACCAAGTTGG + Intergenic
1099502528 12:83431595-83431617 TGGTGAGAATGGAATCAAGTTGG - Intergenic
1099550877 12:84042356-84042378 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
1100526657 12:95425937-95425959 TGGTGAGGATGTGGGGAAGTTGG - Intergenic
1100652232 12:96603554-96603576 ACGGGAGAATGGAACGAAGTTGG - Intronic
1100779305 12:98007398-98007420 AGGTGATAGTGTTAGGAAATGGG + Intergenic
1101132910 12:101707676-101707698 AGGTGAGAAGGCAAGGAAAAGGG + Intronic
1101537261 12:105629668-105629690 TGGTGAGAATGGAACCAAGTTGG + Intergenic
1101740596 12:107496969-107496991 AGGTGTGAACTTAAGGTAGTAGG + Intronic
1104062407 12:125279611-125279633 AAGAGAGAATATAAGGAAGCTGG + Intronic
1104185371 12:126425437-126425459 AGGTGATAAAGTCAGGCAGTTGG + Intergenic
1104618112 12:130287267-130287289 AGGAGAGAATGCATGCAAGTAGG - Intergenic
1105072873 12:133246467-133246489 CGGGGAGAATGGAACGAAGTTGG + Intergenic
1105831572 13:24166884-24166906 AGGTGATGATGTGAAGAAGTGGG - Intronic
1106762029 13:32876826-32876848 AGGTGATGATATAAGGAGGTGGG + Intergenic
1106812498 13:33373798-33373820 TGGTGAGAATGTAGAGAAATTGG + Intergenic
1106978549 13:35251330-35251352 TGGTGAGGATGTGAGGAAGCTGG - Intronic
1107120257 13:36788428-36788450 AGGAGAGACTGTTAGGAAGCTGG - Intergenic
1107607351 13:42072874-42072896 AGTTAAGAAGGAAAGGAAGTTGG - Intronic
1108268537 13:48735891-48735913 GGGAGAGAATGGAAGGAAGAAGG + Intergenic
1108271295 13:48762191-48762213 AGGAGAGACTGTAAGAATGTCGG + Intergenic
1109369274 13:61400155-61400177 AGGTGATAATATTAGGATGTGGG + Intergenic
1109385785 13:61627873-61627895 TGGTGAGAATGGAACCAAGTTGG - Intergenic
1110095939 13:71520860-71520882 AGGTGAGAAGGTAAGTTAGTAGG + Intronic
1110837874 13:80105831-80105853 AGGTGAGAATGTAGAGAAAAGGG - Intergenic
1111522670 13:89426633-89426655 ATGTGAGAATGGAAATAAGTTGG - Intergenic
1111765141 13:92518170-92518192 AGGGGAGAATGGAACCAAGTTGG + Intronic
1112189290 13:97159995-97160017 TGGGGAGAATGGAACGAAGTTGG - Intergenic
1112214081 13:97412068-97412090 AGGTGAGACTGAAGGGAAGTTGG - Intergenic
1112218592 13:97462815-97462837 AAGTGAGAATGTTGGGAATTTGG + Intronic
1112994789 13:105560429-105560451 ATGTGATGATGTGAGGAAGTGGG - Intergenic
1113077820 13:106485326-106485348 AGGTGAGAAAGGAAGGAAGAAGG - Intergenic
1114300182 14:21368932-21368954 AGGCGAGGATGAAAAGAAGTGGG + Intronic
1114749299 14:25184943-25184965 AGGGGAGAATGGAACCAAGTTGG + Intergenic
1114845050 14:26310460-26310482 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
1114869058 14:26633871-26633893 TGGTGAGAATGGAACCAAGTTGG - Intergenic
1115100336 14:29690817-29690839 AGATGAGAATGTAAGAATGGGGG - Intronic
1115712448 14:36065940-36065962 AGGTGATAATATTAGGAGGTGGG + Intergenic
1115872261 14:37817730-37817752 AGGAGAGAATGGAAGAAACTGGG + Intronic
1116034148 14:39607748-39607770 AGGTGTGAATACTAGGAAGTGGG + Intergenic
1117002891 14:51389620-51389642 TGGTGAGAATGTAAAGAAACTGG - Intergenic
1117489312 14:56230143-56230165 AGGGGAGAATGGAACCAAGTTGG + Intronic
1117524267 14:56581268-56581290 AGGTGAGAATATCAGGACTTGGG + Intronic
1119464246 14:74842040-74842062 ACATGAGAGTTTAAGGAAGTTGG - Intronic
1120134440 14:80848998-80849020 AGGTAAGAATGGAAGCAAGGAGG + Intronic
1120324304 14:83005893-83005915 AGGTGAGAAAGCAAGGTGGTTGG + Intergenic
1120713758 14:87818827-87818849 AGCTGAGAAGGCAAGGAAGGTGG + Intergenic
1120723678 14:87915179-87915201 TGGGGAGAATGTAAGAAACTTGG - Intronic
1120962077 14:90134255-90134277 AGGTCAGAATGTATAGAATTTGG + Intronic
1121642098 14:95492132-95492154 TGGTGAAGATGTAGGGAAGTTGG + Intergenic
1121691142 14:95877610-95877632 AGGTCACAAGGTTAGGAAGTGGG + Intergenic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1122217128 14:100212028-100212050 AGGAGAGGATGGAAGGGAGTAGG - Intergenic
1124385541 15:29205452-29205474 TGGTGAGGATGTAGAGAAGTTGG - Intronic
1125123874 15:36196776-36196798 TGGGGAGAATGGAACGAAGTTGG + Intergenic
1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG + Intronic
1125408809 15:39383429-39383451 ATGTGAGGATATTAGGAAGTGGG - Intergenic
1125455316 15:39852922-39852944 AGGTGAGGATGTGAAGAAATTGG + Intronic
1126062181 15:44793293-44793315 TGGTGAGAATGTGGGGAAATGGG + Intergenic
1126233226 15:46352135-46352157 AAGTGAGAATGTATGGTACTTGG + Intergenic
1126393915 15:48191512-48191534 ATGTGAGACTGAAAGGAGGTGGG - Intergenic
1127166747 15:56251545-56251567 AGGAGAGAAGGTTAGGCAGTTGG + Intronic
1127468181 15:59265563-59265585 AGGTCAGAATGAAATGAAGAGGG + Intronic
1127921305 15:63496441-63496463 CGGTGAGAAAGTAAGGAAAGGGG - Intergenic
1128027205 15:64448061-64448083 AGGTGAGAATGAAATGGAGGAGG - Intronic
1128418755 15:67471725-67471747 AGATGAGAATGTAAAGACCTTGG - Intronic
1128852353 15:70972582-70972604 CGGGGAGAATGGAAGCAAGTTGG - Intronic
1129796379 15:78380541-78380563 AGGGGAGAATGGAACCAAGTTGG - Intergenic
1130382767 15:83385055-83385077 AGGGGAGAATGGAACCAAGTTGG + Intergenic
1130442083 15:83964566-83964588 AGGGGAGAATGGAACCAAGTTGG + Intronic
1130476056 15:84268699-84268721 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130483477 15:84382753-84382775 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130618448 15:85435359-85435381 AGGGGAGAATGGAACCAAGTTGG + Intronic
1130779334 15:87018162-87018184 AGATGAGAATGGAACCAAGTTGG + Intronic
1132264387 15:100455097-100455119 TGGTGAGAATGTAAAGAAGAGGG + Intronic
1133191710 16:4138670-4138692 AGGTGATAGTGTTAGGAGGTGGG + Intergenic
1133578523 16:7118699-7118721 AGGCGTGAATGTTAGGATGTGGG + Intronic
1133813353 16:9178027-9178049 AGGTGATAATGTTAGGAAGTGGG - Intergenic
1134629932 16:15749333-15749355 AGGTGAGAAGTGAAGGAACTAGG - Intronic
1134745231 16:16582642-16582664 AGGAGAGAAAGGAAGGAAGGAGG - Intergenic
1135000246 16:18771133-18771155 AGGAGAGAAAGGAAGGAAGGAGG + Intergenic
1135231936 16:20716643-20716665 AGGTGAGGGTGTGAGGATGTGGG - Intronic
1135254441 16:20929762-20929784 AGGTGGGGATGTAGGGAAGGTGG - Intergenic
1135645344 16:24156802-24156824 AAGGGAGAAGGTAAGGGAGTAGG - Intronic
1135650149 16:24198927-24198949 AGGCTAGAATGGAAGGAAGGAGG - Intronic
1136649918 16:31660328-31660350 AGGTGAGGATGTGAGGATGTGGG - Intergenic
1136650763 16:31668165-31668187 AGGTGAGGACGTGAGGACGTGGG - Intergenic
1137407453 16:48200748-48200770 AGGTGAGAATGAAGAGAGGTTGG + Intronic
1137536581 16:49331615-49331637 AGGTCAGAATTTCATGAAGTGGG + Intergenic
1137564177 16:49523069-49523091 GGATGAGGATGCAAGGAAGTTGG + Intronic
1138700142 16:58854057-58854079 CGGGGAGATTGGAAGGAAGTTGG + Intergenic
1140045787 16:71439731-71439753 TGGTGAGAATGTGGGGAAATTGG + Intergenic
1141560700 16:84866050-84866072 AGGAGAGAAGGGATGGAAGTGGG + Intronic
1142914746 17:3127146-3127168 TGATCAGAATGTAATGAAGTGGG + Exonic
1143286853 17:5796542-5796564 AGGTGAGAATGTAAGGAAGTTGG - Intronic
1143571206 17:7759877-7759899 TGGTGAGAATGTCAGGGAGGTGG - Exonic
1143606239 17:7987951-7987973 AGGTGACAACGTAAGGCAGATGG - Intergenic
1144343254 17:14328357-14328379 AGATGAGAATGTAGGGAGGTTGG + Intronic
1144387386 17:14761386-14761408 TTGTGAGAAAGTAAGTAAGTGGG + Intergenic
1144411431 17:15005721-15005743 AGCTGAGACTGGAAGCAAGTCGG - Intergenic
1144546697 17:16203150-16203172 AGTTGAGAAAGTATTGAAGTGGG - Intronic
1144562518 17:16332912-16332934 TGGTGAGGATGTAAAGAAATTGG + Intronic
1145299674 17:21624155-21624177 AGTTGAGAAAGTATTGAAGTGGG + Intergenic
1145350608 17:22079112-22079134 AGTTGAGAAAGTATTGAAGTGGG - Intergenic
1146233935 17:31139786-31139808 AAGTAACAAAGTAAGGAAGTAGG + Intronic
1146608009 17:34278578-34278600 CGGGGAGAATGCAACGAAGTTGG + Intergenic
1146648719 17:34592829-34592851 AGGTGGGAATGTGGGGAGGTGGG - Intronic
1148287549 17:46408762-46408784 AACTGGAAATGTAAGGAAGTTGG + Intergenic
1148309717 17:46626341-46626363 AACTGGAAATGTAAGGAAGTTGG + Intronic
1148945668 17:51260103-51260125 AGGAGGGTATGTAGGGAAGTGGG - Intronic
1148981188 17:51576243-51576265 AGGAGAGAATGGAACCAAGTTGG + Intergenic
1149145061 17:53480388-53480410 AGGTGAGAATGAGGAGAAGTTGG - Intergenic
1149255556 17:54822199-54822221 CGGGGAGAATGTAACCAAGTTGG + Intergenic
1149383142 17:56114525-56114547 TGGTGAGAGTATAAGGAAATAGG + Intronic
1149520980 17:57318175-57318197 AGGTGAGAAGGTGAGAAGGTGGG + Intronic
1150166448 17:62948104-62948126 AGGTGAGAGTATCAGGAGGTGGG + Intergenic
1153782066 18:8503794-8503816 AGGTGATAGTGTTAGGAAGTGGG + Intergenic
1155795141 18:30026448-30026470 TGGGGAGAATGTAACCAAGTTGG - Intergenic
1155796554 18:30044818-30044840 AGGTGAGGATGTGAGGACGTGGG - Intergenic
1156967587 18:43114031-43114053 AGGTTAGGATTTAAGGAAGGAGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158240486 18:55371817-55371839 AGCTGAGAGTGGAAGCAAGTGGG - Intronic
1158368041 18:56762736-56762758 AGAGCAGAATTTAAGGAAGTGGG - Intronic
1158524554 18:58200901-58200923 AGGTAAGAAGGTGGGGAAGTGGG - Intronic
1158895430 18:61908601-61908623 ATGTGAAAATGTAAAGAAGTAGG - Intergenic
1159618873 18:70614217-70614239 AGGAGAGAAAGAGAGGAAGTGGG - Intergenic
1160133019 18:76246488-76246510 AGGAGAGAATGGAAGGAAGCAGG - Intergenic
1161046313 19:2136677-2136699 AGGGGAGAAGGGAAGAAAGTGGG + Intronic
1161556725 19:4946963-4946985 TGGTGAGAATGTGGGGAAATTGG - Intronic
1162006642 19:7785048-7785070 TGGTGAAGATGTGAGGAAGTGGG - Intergenic
1162951926 19:14076233-14076255 AGGAGAGGAAGGAAGGAAGTTGG + Intergenic
1163992931 19:21016133-21016155 AACTGAAAATGTAAGGAAATAGG + Intergenic
1164137165 19:22426208-22426230 AGGTGAAAAAGTAAGGGACTGGG + Intronic
1165833743 19:38742550-38742572 AGGTGAGGATGGAAGGAGGGAGG + Intronic
1166857574 19:45790860-45790882 AGGTGAGAAGGCAGAGAAGTTGG + Intronic
1168500941 19:56892641-56892663 ATATGAGAATGTAGGGAAATTGG + Intergenic
925449325 2:3954495-3954517 ACGTGAGGATGCAGGGAAGTGGG + Intergenic
925960447 2:9009625-9009647 AGATGAGAATGTAAATAAGAGGG - Intergenic
926449210 2:12981872-12981894 ATGTGAGGATATTAGGAAGTGGG - Intergenic
926470575 2:13251616-13251638 AGGTAAGAATGGTAGGAATTTGG - Intergenic
926583168 2:14654480-14654502 AAGTGAGGATGTTAAGAAGTAGG - Intergenic
926776781 2:16430987-16431009 GGGTGAGAATTTAGGGAAGTGGG - Intergenic
927198293 2:20563182-20563204 AGGTGAGGATGCAAGGACATGGG - Intronic
927529574 2:23782228-23782250 TGGTTAGAGTATAAGGAAGTGGG - Intronic
927814610 2:26203626-26203648 AGGTTAGGATGTAAGGAAATGGG - Intronic
928105952 2:28470840-28470862 AGGTGAGAATGGAATGAATCAGG - Intronic
928220589 2:29399793-29399815 ATGTGAAAATGCAAGGAAGAAGG - Intronic
928704468 2:33933259-33933281 AGGTGAGAAAGAAGGGAAGAAGG - Intergenic
928767620 2:34666455-34666477 AGGTGATAGTATTAGGAAGTGGG + Intergenic
929255974 2:39812274-39812296 AGGGGAGAATGGAACCAAGTTGG - Intergenic
929382230 2:41366550-41366572 TGGGGAGAATGTAAGCAAATTGG + Intergenic
929962012 2:46504057-46504079 AGGTGATAGTGTTAAGAAGTGGG + Intronic
930161582 2:48163394-48163416 AGGTGAGGCTGCAAGGCAGTGGG + Intergenic
930820479 2:55641562-55641584 AGGTAAGGATTTAAGGAAGGTGG + Intronic
930911549 2:56635837-56635859 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
930948467 2:57106403-57106425 AGGTTAGAATGAGATGAAGTAGG + Intergenic
932021974 2:68096556-68096578 AGGTGAGAATGAGAGAAAGATGG - Intronic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932270572 2:70405430-70405452 TGGTGAGGATGTGAGGATGTGGG - Intergenic
932479384 2:72029404-72029426 AGGAGAGAATGTAGGGGATTTGG + Intergenic
933048604 2:77573059-77573081 AGATGAGAAAGTAATGAAGCAGG - Intronic
933427172 2:82127970-82127992 AGGTGAGAATGTAAGTTAAATGG - Intergenic
933602825 2:84350248-84350270 AAGTCATAATGCAAGGAAGTGGG + Intergenic
933999027 2:87691279-87691301 TGGTGAGAATGTAGGGAAACTGG - Intergenic
934724570 2:96607438-96607460 AGTTGAGAATCTAAGGAGTTTGG - Intronic
934920854 2:98344223-98344245 AGGTGAGAGTGGGAGGAAGGGGG - Intronic
935279447 2:101504873-101504895 AGGTGAGGAGGTGAGGAGGTGGG - Intergenic
935402265 2:102672573-102672595 AGGAGAGACTGAAGGGAAGTTGG + Intronic
936294817 2:111259604-111259626 TGGTGAGAATGTAGGGAAACTGG + Intergenic
936859752 2:117002661-117002683 CGGGGAGAATGGAACGAAGTTGG + Intergenic
937063920 2:119002933-119002955 AGGGGAGAATGGAACAAAGTTGG - Intergenic
937189853 2:120084723-120084745 AGGGGAGAATGGAACCAAGTTGG - Intronic
937584547 2:123530687-123530709 GGCTGAGAATGTAGGGAATTTGG - Intergenic
938273681 2:129997307-129997329 ATGTGAGAAAGGAAGGAAGGGGG + Intergenic
938442199 2:131346098-131346120 CGGGGAGAATGTAACCAAGTTGG - Intronic
938493866 2:131781230-131781252 AGAAGAGAATGTAAGCAACTTGG - Intergenic
938659288 2:133469609-133469631 TGGGGAGAATGGAAGCAAGTTGG - Intronic
938788408 2:134655146-134655168 TGGTGAGAATGGAACCAAGTTGG - Intronic
938952154 2:136265349-136265371 TGGGGAGAATGGAAGCAAGTTGG - Intergenic
939010871 2:136844537-136844559 AGGAGACAATGAAAGGAGGTTGG - Intronic
939195478 2:138965729-138965751 AAGTGAGAATGTGAGGTATTTGG + Intergenic
939348280 2:140997335-140997357 AGGTCATAATGTTGGGAAGTAGG + Intronic
939654141 2:144801841-144801863 GGGTGGGTATATAAGGAAGTAGG + Intergenic
939686987 2:145212423-145212445 ATGGGAGAATGGAAGCAAGTTGG - Intergenic
939795041 2:146632744-146632766 AGGTGATAGTGTTAGGAGGTGGG - Intergenic
939992221 2:148886427-148886449 GGGTGGGAAGGTAAGGAAATGGG + Intronic
940396722 2:153198352-153198374 AGGTGAGAATGTAGGCCACTGGG + Intergenic
940582893 2:155603086-155603108 AAGTGAGAATATAAGGTATTTGG + Intergenic
940599701 2:155843195-155843217 AAGTGAGAAAGGAAGGAAGATGG - Intergenic
940726318 2:157340749-157340771 AGGTGAAGATGTAAAGAATTTGG - Intergenic
940801461 2:158137328-158137350 AGGTGAGCATGGAAGGAATCTGG - Intergenic
941542744 2:166806841-166806863 AGGTGTGATTATAAGGAGGTGGG + Intergenic
942111838 2:172690359-172690381 AGGAGAGAATGTAGAGAAATTGG + Intergenic
942197560 2:173536873-173536895 AGATGAGACTGTAATGAAGCAGG + Intergenic
942410379 2:175703455-175703477 TGGGGAGAATGGAAGCAAGTTGG - Intergenic
942718230 2:178919004-178919026 AGGTGATGATATTAGGAAGTAGG + Intronic
942790576 2:179756577-179756599 TGGGGAGAATGGAAGCAAGTTGG - Intronic
942978180 2:182044501-182044523 AGGTGAGTGGGCAAGGAAGTTGG - Intronic
943467164 2:188241970-188241992 AGGTGATAGTGTTAAGAAGTGGG + Intergenic
943583659 2:189713162-189713184 AGGGGAGAATGGAACCAAGTTGG + Intronic
944269995 2:197771625-197771647 AGGAAAGAGGGTAAGGAAGTGGG + Intronic
944854315 2:203751903-203751925 AGGTGAGGACTTTAGGAAGTCGG - Intergenic
945868330 2:215201152-215201174 ACGTGAGAAAGTGAGGAAGAAGG + Intergenic
946393563 2:219431278-219431300 AGGGGAGAGTGGAAGGAAATGGG - Intergenic
946884105 2:224205760-224205782 AGGTGAGAAGGAAAGGAAGATGG - Intergenic
947196243 2:227570841-227570863 AGGGAAGAATGTAAGGAAGCTGG + Intergenic
947264722 2:228266121-228266143 AGGTAAGAATGTAACGAAGTGGG - Intergenic
948439843 2:237979614-237979636 AGGGGAGGATGTAAGGCAGTTGG + Intronic
948554326 2:238796793-238796815 ATGTGAGAATGTCAGGAAGAAGG - Intergenic
948701292 2:239762096-239762118 GGGTGTGAATGCCAGGAAGTGGG - Intergenic
1169979074 20:11363409-11363431 AGGAGAGAATGGAAGGAAGCTGG - Intergenic
1170175434 20:13463866-13463888 TGGTGAGGATGTAAAGAAATGGG + Intronic
1170391451 20:15879306-15879328 AGGTGATAGTCTATGGAAGTAGG - Intronic
1170451801 20:16490844-16490866 CGGTGAGAATGTATGGGATTAGG - Intronic
1170822020 20:19762304-19762326 AGGAGACAAAGTGAGGAAGTTGG + Intergenic
1171214720 20:23344056-23344078 TGGTGAGAATGTGGGGAAATTGG - Intergenic
1171560856 20:26124102-26124124 AGTTGAGAAAGTATTGAAGTGGG - Intergenic
1172128536 20:32639960-32639982 TCGTGAGAATGAAAGGAAGCAGG - Intergenic
1172352181 20:34251702-34251724 AGGTTATAGTGTAAGGAGGTGGG + Intronic
1172760574 20:37318434-37318456 GGGAAAGAATTTAAGGAAGTTGG - Intergenic
1173133616 20:40418410-40418432 AGGTGAGAATGGATTGAAGGGGG + Intergenic
1173133765 20:40420955-40420977 AGGTGGGAATTCAAGGAAGTAGG + Intergenic
1173137125 20:40448160-40448182 AGGAGAAAATGTCAGGAAGCAGG + Intergenic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1174308542 20:49632322-49632344 AGTTGGGAATGTAGGGAAGGTGG - Intergenic
1174882641 20:54297109-54297131 AGAGCAGGATGTAAGGAAGTTGG - Intergenic
1175115454 20:56678723-56678745 AGGAGAGATTGTAAGAAGGTGGG + Intergenic
1175479003 20:59298632-59298654 AGGTGATGATGTCAGGAGGTGGG + Intergenic
1175658350 20:60791560-60791582 ATGGGAGAATGTATGGAAGGAGG - Intergenic
1175761998 20:61567532-61567554 AGGTGATGATGTCAGGAGGTGGG - Intronic
1175880306 20:62254189-62254211 ATGTGACAATGTTAGGATGTGGG - Intronic
1176006315 20:62865276-62865298 AGGTGAGACTGGATAGAAGTCGG + Intergenic
1176650360 21:9540965-9540987 AGTTGAGAAAGTATTGAAGTGGG + Intergenic
1177092146 21:16782460-16782482 TGGGGAGAATGGAAGCAAGTTGG + Intergenic
1177611227 21:23451214-23451236 AGTTGCGGATGTAAGGAAGGAGG + Intergenic
1177722482 21:24926578-24926600 AGCTGTGAATGTCAGGAATTGGG - Intergenic
1177930681 21:27279115-27279137 AGATGATAATATTAGGAAGTGGG - Intergenic
1177974776 21:27834290-27834312 GGGTGAGATTGAAAAGAAGTTGG - Intergenic
1178168240 21:30007575-30007597 AGGTGAGAATATTAGGAGGTGGG - Intergenic
1178481970 21:32987292-32987314 AGGTGGGAATGTAAAGAAAGGGG + Intergenic
1178687632 21:34723684-34723706 GGGTCAGAGGGTAAGGAAGTGGG + Intergenic
1178845145 21:36168501-36168523 TGGTGAGGATGTTAGGAAATTGG - Intronic
1179592956 21:42423052-42423074 AGAAGAGAATGTAAGAAAGCTGG + Intronic
1179635090 21:42703641-42703663 AGAGGTGAATGGAAGGAAGTTGG + Intronic
1180015609 21:45081067-45081089 TGGAGAGAATGCAAGGAAGCTGG - Intronic
1180837114 22:18935386-18935408 AGGTGAGACTGTACAGAGGTCGG - Intronic
1181064843 22:20300637-20300659 AGGTGAGACTGTACAGAGGTCGG + Intergenic
1183210247 22:36446895-36446917 AGGTGATGGTGTTAGGAAGTGGG - Intergenic
1183797303 22:40130312-40130334 AGGAAAGAAAGAAAGGAAGTGGG + Intronic
1183910203 22:41073491-41073513 AGGTGATGATGTTAGGAGGTAGG + Intergenic
1203287207 22_KI270734v1_random:160685-160707 AGGTGAGACTGTACAGAGGTCGG - Intergenic
949425399 3:3910326-3910348 CGGTGAGAATGGAACCAAGTTGG + Intronic
949492146 3:4599544-4599566 AGGTGAGGACCAAAGGAAGTAGG - Intronic
949518303 3:4826792-4826814 AGGTCAGAATGTAGGAAATTCGG - Intronic
949583520 3:5414063-5414085 AGGAGAGAATGGAACCAAGTTGG + Intergenic
949660318 3:6271492-6271514 AGGGGAGAATGGAACCAAGTTGG - Intergenic
949701882 3:6768736-6768758 AGGGGAGAATGGAACCAAGTTGG - Intergenic
949789740 3:7779939-7779961 TGGTGAGAATGGAAGGAAAAAGG - Intergenic
950278599 3:11685065-11685087 AAGTGAGAATGTGAGGTATTTGG + Intronic
950657798 3:14447872-14447894 AGGGGAGGAGATAAGGAAGTGGG - Intronic
951243362 3:20312677-20312699 AGGTGTGAATGTCAGGAGATGGG + Intergenic
951295883 3:20934137-20934159 AGGAGAGAATGGAAGGAAATTGG + Intergenic
951450121 3:22827863-22827885 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
951562889 3:23985882-23985904 TGGTGAGGATGTGGGGAAGTTGG + Intergenic
951596035 3:24319012-24319034 AGGTGAAAATGCAAAGGAGTAGG + Intronic
951741848 3:25933033-25933055 TGGGGAGAATGGAACGAAGTTGG + Intergenic
951836587 3:26990144-26990166 ACGTGAGAATTCAAGGAACTAGG - Intergenic
952097756 3:29974249-29974271 AGGTGAAAATGAAAGGTGGTGGG - Intronic
952514865 3:34093697-34093719 TGGTGAGAATGTGAAGAAATTGG - Intergenic
952726505 3:36591998-36592020 ATGTGATGATGTTAGGAAGTGGG - Intergenic
953239548 3:41136584-41136606 AGGTGATGGTGTTAGGAAGTGGG + Intergenic
953456312 3:43045036-43045058 AGGTGAGGGTGTGAGGATGTGGG + Intronic
954277658 3:49553256-49553278 AGGAGAAAATATCAGGAAGTGGG + Intergenic
954741694 3:52757108-52757130 TGGTGAGAATGTAGAGAAATTGG + Intronic
955088146 3:55722703-55722725 AGGTGGGCATGGAAAGAAGTAGG - Intronic
955119069 3:56037596-56037618 TGGTGAGAATGGAACCAAGTTGG + Intronic
955326033 3:58009718-58009740 AGCTGAGAACTGAAGGAAGTGGG + Intronic
955661694 3:61306424-61306446 TGGTGAGAATGTGAAGAAATTGG - Intergenic
955977363 3:64491221-64491243 ATGTGAGAAGGTAAGCAAGCAGG + Intergenic
956118279 3:65940572-65940594 ATGTGATGGTGTAAGGAAGTGGG - Intronic
956271586 3:67453530-67453552 AGGTGATGATATTAGGAAGTGGG - Intronic
956330010 3:68096045-68096067 GGGGGAGAATGAAAAGAAGTTGG - Intronic
956330652 3:68103154-68103176 AGGTGAGGATGAGGGGAAGTGGG + Intronic
957543179 3:81602637-81602659 AGGTGATCATATTAGGAAGTGGG - Intronic
957747529 3:84364870-84364892 AGGGGAGAATGGAACCAAGTTGG - Intergenic
958423167 3:93951138-93951160 AGGGGAGAATGCAACCAAGTGGG + Intronic
958842621 3:99226116-99226138 TGGTGAGAATGTCAAGAAATAGG - Intergenic
959045430 3:101468251-101468273 TGGAGAGAATGTAACCAAGTTGG + Intronic
959194555 3:103163023-103163045 ATGTGATAATGTTGGGAAGTGGG - Intergenic
959371199 3:105528208-105528230 AGGTGAGAATGTAGTGAAGACGG - Intronic
959407298 3:105976056-105976078 AGGTGAAAATGAAAGACAGTGGG + Intergenic
960110393 3:113839280-113839302 GGCTGAGAATGAAAGGAAGGGGG - Intronic
960483461 3:118222282-118222304 TGGTGAGAATGTGAAGAAATTGG + Intergenic
960841716 3:121965220-121965242 GGGTGAGAAAGTAAGCAACTTGG + Intergenic
962279127 3:134037181-134037203 AGGTGTCACTGTAAGGAAGAAGG - Intronic
962287577 3:134100662-134100684 CGGGGAGAATGGAAGCAAGTTGG - Intronic
964102254 3:153001327-153001349 AGGTCAGAAAGTAAGGGAGAGGG + Intergenic
964298409 3:155259700-155259722 AGGAAAGAAGGTAAGGGAGTGGG - Intergenic
964696996 3:159520166-159520188 AGGTGAGAATGCAAAGACGGAGG + Intronic
964736066 3:159919204-159919226 TGGTGAGAATGCAGAGAAGTGGG + Intergenic
964995153 3:162869358-162869380 AGGGGAGAATGGAACCAAGTTGG + Intergenic
965161474 3:165138968-165138990 TGGTGAGAATGGAACCAAGTTGG - Intergenic
965292132 3:166897071-166897093 AGGTGAATATGTAACAAAGTTGG - Intergenic
966243271 3:177778021-177778043 AGGTTAGAATGTAAGAATGGTGG - Intergenic
966491848 3:180536459-180536481 TGGTGAGAATGTAAAGAAAAAGG + Intergenic
966491935 3:180537445-180537467 AAGTGAGAATGTAAGATATTTGG + Intergenic
966642205 3:182203900-182203922 AGGTGAGATGGAGAGGAAGTGGG - Intergenic
966893256 3:184423551-184423573 AGATGAGAATCCAAAGAAGTAGG + Intronic
967650302 3:191977559-191977581 TGGTGAGGATGTAGAGAAGTTGG + Intergenic
967751749 3:193123165-193123187 AGGTGATACTATTAGGAAGTAGG - Intergenic
967778625 3:193411673-193411695 ACTCCAGAATGTAAGGAAGTAGG + Intronic
968315208 3:197718224-197718246 GGGAGAGAATGTTAGGATGTGGG - Intronic
969834652 4:9830849-9830871 AGGTGAGCATGAAGGGATGTGGG + Intronic
970161292 4:13192096-13192118 AGGAGGGAAGGGAAGGAAGTGGG + Intergenic
970696164 4:18679970-18679992 AACAGAGAATGTAAAGAAGTTGG - Intergenic
970842709 4:20494142-20494164 AGGAGAGAATGCAAGGCAGAAGG + Intronic
971430372 4:26559254-26559276 TGGTGAGAATGTACAGAAATTGG - Intergenic
971679191 4:29674693-29674715 TGGGGAGAATGGAATGAAGTTGG + Intergenic
971688204 4:29798452-29798474 AAGTGAGAAAGTGATGAAGTTGG - Intergenic
971862043 4:32120625-32120647 ACCTGAGAATGTAATGAAGAAGG + Intergenic
972134415 4:35874101-35874123 AGGTCACAATGCAAGTAAGTAGG - Intergenic
972723432 4:41723964-41723986 GGGTGAGGATGGAAGGAAATGGG - Intergenic
973054629 4:45640663-45640685 AGGTGAGGATGTGAGGACATGGG - Intergenic
973568918 4:52217744-52217766 TGGGGAGAATGGAATGAAGTTGG - Intergenic
973633015 4:52837168-52837190 AGGTGAGAATTTAAGCCATTTGG - Intergenic
974070043 4:57115006-57115028 AGGTGAGTATGTGGAGAAGTGGG + Intergenic
974764419 4:66323924-66323946 TGATAAGAATGTAAGTAAGTAGG + Intergenic
974841416 4:67303627-67303649 AGGTAAGAATATAAGCAAATTGG - Intergenic
975745301 4:77469346-77469368 AGGTGATGATATAAGGAGGTGGG + Intergenic
976902255 4:90192806-90192828 AGGTGTGAATATAAGGCAGTAGG + Intronic
976955582 4:90894661-90894683 AGGAGAAAATGTGAGGAAGGAGG - Intronic
977017689 4:91713576-91713598 TGGTGAGAATGTAGAGAAATGGG + Intergenic
977056024 4:92191569-92191591 AGCTGATAAAGTAAGAAAGTTGG - Intergenic
977227856 4:94414659-94414681 GGGAGAGAAAGAAAGGAAGTGGG - Intergenic
977242753 4:94592930-94592952 AGGTGAGAATGTATGATTGTGGG - Intronic
977406115 4:96601246-96601268 TGGTGACAATGTAAAGAAATGGG + Intergenic
978040200 4:104051122-104051144 AGGTGTGAATCAAAGGAAGGAGG - Intergenic
978120211 4:105070199-105070221 TGCTGAGAAGGTAAGGCAGTTGG + Intergenic
978137697 4:105282387-105282409 AGGAGAGAATGAAGGGAACTGGG - Intergenic
978171590 4:105677565-105677587 AGGTGAGAATGGAGTGAAATAGG - Intronic
978284471 4:107059602-107059624 AGGATAAAATCTAAGGAAGTTGG + Intronic
978288607 4:107109971-107109993 AGGGGAGAATGGAAAGAGGTTGG - Intronic
978299849 4:107255516-107255538 AGGGGAGATGGTGAGGAAGTGGG + Intronic
979099141 4:116593128-116593150 AGTTGAGAAAGTAAGAAAGGAGG - Intergenic
979196287 4:117923393-117923415 TGGGGAGAATGGAAGCAAGTTGG + Intergenic
980157910 4:129129239-129129261 TGGTGAGAATGTGAGGCAATAGG + Intergenic
980182409 4:129417217-129417239 TGGAGAGGATCTAAGGAAGTGGG + Intergenic
980456667 4:133053316-133053338 AGGTGAAAATGTAAGCCTGTTGG + Intergenic
980663441 4:135897870-135897892 AGGAGAGAAGGTAAGGGAGGTGG + Intergenic
980697094 4:136372601-136372623 TGGTGAGGATGTAAAGAAATTGG - Intergenic
981149717 4:141367298-141367320 CGGTGAGAATGGAACCAAGTTGG - Intergenic
981441937 4:144793120-144793142 AGGGGAGAATGGAACCAAGTTGG + Intergenic
981869547 4:149469516-149469538 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
981932635 4:150207663-150207685 AGGTGAGCATGTAAGAAATAGGG + Intronic
982044946 4:151435248-151435270 AGGAGAGAATGAAGAGAAGTTGG - Intronic
982316783 4:154039990-154040012 AGTTGAGAATGTAAGGAAGGTGG - Intergenic
982801625 4:159714136-159714158 TGGGGAGAATGGAACGAAGTTGG - Intergenic
982980494 4:162128352-162128374 AGGTGATAATATTAGGAGGTGGG + Intronic
983021455 4:162681115-162681137 AGGTGATAGTATGAGGAAGTGGG - Intergenic
983712472 4:170735958-170735980 AGGTGACGATATAAGGAGGTAGG - Intergenic
985510534 5:310771-310793 AAGTGACAATGTCAGGAAATGGG - Intronic
985846833 5:2356029-2356051 AGGTGAGGAGGTAAGGAAGGAGG - Intergenic
986011739 5:3723320-3723342 TGGTGAGAATGGAACAAAGTTGG - Intergenic
986865344 5:11980460-11980482 AGGTGATGATATCAGGAAGTGGG + Intergenic
987547514 5:19331965-19331987 AGGTGTGAATATCAGGAAGTTGG + Intergenic
987596886 5:20012811-20012833 AAGTGAGAATGTGTGGAATTTGG - Intronic
987647863 5:20699074-20699096 TGGTGAGGATGTAGGGAATTTGG - Intergenic
988748475 5:34169786-34169808 TGGTGAGGATGTAGGGAACTTGG + Intergenic
989269712 5:39518067-39518089 AGATGATAATGTTAGGCAGTTGG + Intergenic
989270148 5:39523126-39523148 AGGTGAGAGTTTAAGAAAGAAGG + Intergenic
989493092 5:42079688-42079710 AGGGGAGAATGGAACCAAGTTGG + Intergenic
989949601 5:50281620-50281642 ACGGGAGAATGGAAGCAAGTTGG + Intergenic
991119800 5:62998776-62998798 AGTTCAGTATGTAAGGAAATTGG - Intergenic
991154191 5:63411186-63411208 TGGTGAGGATGTGAGGGAGTTGG - Intergenic
991545944 5:67781552-67781574 AGGAGAGAATGGAACCAAGTTGG + Intergenic
992093748 5:73341485-73341507 ATGTGAGGATGCAAAGAAGTTGG - Intergenic
992146636 5:73856763-73856785 AGGTGAGAATTTTAGGGGGTAGG + Intronic
992292240 5:75291735-75291757 AGGTGAGAATGTGAGGACTTGGG + Intergenic
992368555 5:76118591-76118613 AGGTGAGAATCTAAGGAAATAGG + Intronic
992598659 5:78373084-78373106 AGGGGAGAAGGTAAGAAGGTGGG - Intronic
992650229 5:78852655-78852677 CGGGGAGAATGGAAGCAAGTTGG - Intronic
992926537 5:81593384-81593406 AGGGGAGAATGGAACCAAGTTGG + Intronic
993663461 5:90667209-90667231 TGGGGAGAATGGAAGCAAGTTGG - Intronic
993735267 5:91468899-91468921 AGGTAAGACTGAAAGGCAGTTGG + Intergenic
993956920 5:94245490-94245512 AGGAGAGAAAGCAAGCAAGTAGG - Intronic
994287970 5:97992846-97992868 AGGGGAGAATGGAACCAAGTTGG + Intergenic
994528384 5:100934685-100934707 CGGGGAGAATGTAACCAAGTTGG - Intergenic
994855133 5:105110975-105110997 AGAGGAGGATTTAAGGAAGTGGG - Intergenic
994973688 5:106775578-106775600 AGGGGAGAATGGAACCAAGTTGG - Intergenic
995202882 5:109446215-109446237 AGGGGAGAATGGAACCAAGTTGG - Intergenic
995204063 5:109458783-109458805 AGGGGAGAATGGAACCAAGTTGG + Intergenic
995522885 5:113027485-113027507 AGGTGGGAATGAAGGGAAATTGG + Intronic
995634627 5:114172414-114172436 AGGTGAGAAAATACGTAAGTTGG - Intergenic
995785751 5:115825758-115825780 TGGGGAGAATGTAACCAAGTTGG - Intergenic
995979789 5:118087742-118087764 AGGTATGAATGTCAGGAATTGGG + Intergenic
996515032 5:124359782-124359804 AGGGGAGAATGGAACCAAGTTGG + Intergenic
996770917 5:127084507-127084529 AGGTCTGAATGTTAGAAAGTGGG + Intergenic
996910721 5:128654566-128654588 TGGGGAGAATGGAAGCAAGTTGG - Intronic
997505887 5:134416527-134416549 TGGCAAGAATGTGAGGAAGTTGG - Intergenic
997512682 5:134464312-134464334 AGGTCAAAAGGGAAGGAAGTGGG + Intergenic
998324267 5:141265368-141265390 AGGTGAGAATCTTAGTAAGTGGG + Intergenic
998426578 5:142033935-142033957 AGGTGAGAGGGGAAGGAAGGAGG + Intergenic
998585551 5:143422900-143422922 AGGTGAGAAAGTAAGAGAGAAGG - Intronic
999288487 5:150408201-150408223 AGGAGAAAAGGTAAGGAAGTGGG + Intronic
999418854 5:151423141-151423163 TGGTGAGAATGTAAAGCAGCAGG + Intergenic
999551345 5:152690517-152690539 AGGTGATAATGTCACAAAGTTGG + Intergenic
999622892 5:153490448-153490470 AGGTGAGGATGGGAGGAAGGGGG + Intronic
1000354777 5:160383964-160383986 AGGGGAGAATGCAGAGAAGTTGG + Intergenic
1000565880 5:162846808-162846830 AGGCGAGAATGGAACCAAGTTGG + Intergenic
1000775441 5:165414078-165414100 TGGGGAGAATGGAAGCAAGTTGG + Intergenic
1001545966 5:172570757-172570779 AGGGAAGAATGGAAGGAAGAAGG + Intergenic
1002065939 5:176651657-176651679 GGGTGAGAAGGTAAGGCAGCGGG + Exonic
1002413409 5:179102472-179102494 AGGGGAGAATGGAACCAAGTTGG + Intergenic
1002757589 6:177049-177071 GGGTTAAAATATAAGGAAGTCGG + Intergenic
1003077548 6:2996563-2996585 GCGTGAGAATGTAGAGAAGTTGG + Intronic
1003500148 6:6696517-6696539 AGGCCAGAGTGCAAGGAAGTGGG + Intergenic
1003872554 6:10413828-10413850 AGCTGAGAATGTTAGGCAGGAGG - Intronic
1004642225 6:17526525-17526547 AACTGAGAATGAAAGGCAGTGGG - Intronic
1004807739 6:19222370-19222392 CGGTGAGAATGGAACCAAGTTGG + Intergenic
1005036296 6:21558136-21558158 ATGTGATGATGTTAGGAAGTGGG + Intergenic
1005259596 6:24043550-24043572 AGGTGGGAGTCTAAGGAAGATGG - Intergenic
1005593466 6:27352734-27352756 AGGTGAGGACGTGAGGACGTGGG - Intergenic
1005680376 6:28201038-28201060 TGGTGAGAATGTAGGGAAATTGG - Intergenic
1005968832 6:30745177-30745199 AAGTGAGAATGTATGGTATTTGG + Intergenic
1006339243 6:33437587-33437609 AGGAGAGACAGTAAGAAAGTGGG - Intronic
1006740881 6:36307791-36307813 AGAGGAGAGTGTAAGGGAGTAGG + Intronic
1006784769 6:36658930-36658952 ATGTGATAGTGTAAGGAGGTGGG + Intergenic
1006924643 6:37647769-37647791 AGGGGAGAAGGGAAGGAGGTGGG + Intronic
1006965327 6:37977872-37977894 AGGAGAGAAAGGAAGGAAGAAGG - Intronic
1007272050 6:40645307-40645329 CGGTGAGAATGAAAGGAGCTTGG + Intergenic
1007470250 6:42085456-42085478 AGGTGATAATGTTAGGAGGTGGG + Intronic
1008480355 6:51979454-51979476 AGAGGAGAATGAAAGGATGTGGG - Intronic
1008529883 6:52447160-52447182 TGGGGAGAATGTAACCAAGTTGG - Intronic
1008796574 6:55310709-55310731 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009016759 6:57913675-57913697 TGGTGAGGATGTAGGGAATTTGG + Intergenic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009481791 6:64168304-64168326 GGGTGAGAATGTAGAGAAGTGGG + Intronic
1009570342 6:65375922-65375944 TGGGGAGAATGGAAGCAAGTTGG + Intronic
1009653785 6:66512709-66512731 TGGTGAGAATGTATAGAAGAGGG + Intergenic
1009877996 6:69530244-69530266 AGGTGAGAGAGTAAGGATGTGGG + Intergenic
1010615502 6:78007080-78007102 CGGGGAGAATGGAAGGAAGTTGG + Intergenic
1010633301 6:78226691-78226713 AGGGGAGAATGGAACCAAGTTGG + Intergenic
1011726324 6:90213845-90213867 AGGAGAGAATGAAAGGAAATAGG - Intronic
1012020913 6:93917998-93918020 TGGTGAGAATGTGAAGAAATGGG + Intergenic
1012677052 6:102128147-102128169 AGGTGAGAATACCAGGGAGTAGG + Intergenic
1012799186 6:103803393-103803415 CGGTGAGAATGGAACCAAGTTGG + Intergenic
1013528736 6:110999558-110999580 AGTTGAAAATGTAAGAAAGTGGG + Intronic
1013578174 6:111506313-111506335 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
1013773651 6:113654472-113654494 AAGGGAGGAGGTAAGGAAGTTGG - Intergenic
1013911505 6:115281164-115281186 AGGTGATAATGTTAGGAGGTGGG - Intergenic
1013988749 6:116228733-116228755 AATAGAGAATGTAATGAAGTAGG - Intronic
1014413758 6:121158091-121158113 AGGAGAGAGTGTAAGTAACTTGG - Intronic
1014937087 6:127397660-127397682 AGGTGAGGACGTGAGGACGTGGG - Intergenic
1014937094 6:127397690-127397712 TGGTGAGGATGTGAGGATGTGGG - Intergenic
1015047053 6:128788575-128788597 CGGTGAGAATGGAACCAAGTTGG + Intergenic
1015390946 6:132681074-132681096 AGTTGAGAATATCAGGAGGTGGG - Intergenic
1015721573 6:136248121-136248143 ATATGAGATTGTAAGGAAGACGG - Intronic
1016088929 6:139951482-139951504 AGGTGAGAACATATGGCAGTTGG - Intergenic
1016285577 6:142468964-142468986 AGGTGACAATATCAGGAGGTGGG - Intergenic
1016753371 6:147656719-147656741 TGGAGAGGATGTAAGGAAATAGG + Intronic
1017047210 6:150357784-150357806 AGGTGGGAATGTAAGGAGTGAGG + Intergenic
1017557804 6:155591274-155591296 AGGTGGGAATGAAGAGAAGTTGG - Intergenic
1019124778 6:169830870-169830892 AGGTGACAGTGTTAGGAGGTGGG - Intergenic
1020604994 7:10326137-10326159 TGGTCAGAATCAAAGGAAGTAGG + Intergenic
1021330451 7:19332037-19332059 TGGTGAGGATGTAAAGAAATTGG - Intergenic
1021389051 7:20069326-20069348 AGGGGAGAATGGAACCAAGTTGG + Intergenic
1021485257 7:21160858-21160880 AGGGGAGAAAGAAAGGAAATTGG + Intergenic
1021652426 7:22845036-22845058 AGGACAGAGTGTCAGGAAGTAGG + Intergenic
1022104768 7:27189840-27189862 AGGTGAGAATGGCTGGAAGGAGG - Intergenic
1022448264 7:30488368-30488390 AGGTGAGTATGCCATGAAGTTGG - Intergenic
1023622879 7:42090856-42090878 ACATGACAATCTAAGGAAGTAGG + Intronic
1023714881 7:43033757-43033779 CAGTGAGAATGTAAAGAAATTGG + Intergenic
1024377069 7:48652274-48652296 AGGTAATAATTTTAGGAAGTGGG + Intergenic
1024795175 7:53011598-53011620 TGGTGAGAATGGAATCAAGTTGG - Intergenic
1026277708 7:68894659-68894681 AGGTGATGGTGTTAGGAAGTGGG + Intergenic
1026736794 7:72954127-72954149 AGCGGAGACAGTAAGGAAGTCGG - Intergenic
1026739650 7:72970704-72970726 AGGAAAGAATGTAAGGAAAATGG - Intergenic
1026787012 7:73308193-73308215 GGCGGAGACTGTAAGGAAGTCGG - Intronic
1027104083 7:75394366-75394388 AGGAAAGAATGTAAGGAAAATGG + Intergenic
1027106940 7:75410936-75410958 AGCGGAGACAGTAAGGAAGTCGG + Intronic
1027589736 7:80102612-80102634 CGGTGAGAATGTAGAGAAATTGG - Intergenic
1027672389 7:81118061-81118083 AGGTGAGAGTATTAGGAGGTGGG - Intergenic
1027869774 7:83692779-83692801 AGGAGAGAAGGTATGGAATTTGG + Intergenic
1027871691 7:83715990-83716012 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
1028518198 7:91700430-91700452 TGGGGAGAATGGAAGCAAGTTGG + Intronic
1028787514 7:94812670-94812692 AGGAGAGAATGAAGAGAAGTGGG + Intergenic
1029313305 7:99687564-99687586 TGGGGAGAATGGAAGCAAGTTGG + Intronic
1029562301 7:101310573-101310595 ACGTGAAAAAGCAAGGAAGTGGG + Intergenic
1029795343 7:102888650-102888672 AGTTGAGTAGGTAAGGAAGGAGG + Intronic
1029850032 7:103452450-103452472 AGGGGAGAATGGAACCAAGTTGG - Intergenic
1030068889 7:105681409-105681431 TGGTGAGGATGTGGGGAAGTTGG + Intronic
1030179302 7:106688975-106688997 CGGGGAGAATGTAACCAAGTTGG - Intergenic
1030949763 7:115775369-115775391 AGGGCAAAGTGTAAGGAAGTAGG + Intergenic
1031096993 7:117432155-117432177 TGGTGAGAATGGAACCAAGTTGG - Intergenic
1031461951 7:122062383-122062405 AGGTGATAATATTAGGAAGTAGG + Intergenic
1031573637 7:123389172-123389194 AGAGGAGAATGTCAGGAAGTGGG - Intergenic
1031802379 7:126264444-126264466 AGGGGAGAAAGTAAGGTAGAAGG + Intergenic
1032491966 7:132330544-132330566 ATGTGAAAATGTAAAGAAGTTGG + Intronic
1033856044 7:145562310-145562332 AGGGGAGAATGGAACCAAGTTGG + Intergenic
1033891463 7:146018164-146018186 AGGGGAGAATGCAACCAAGTTGG - Intergenic
1034180281 7:149132170-149132192 GAGAGAGAATATAAGGAAGTCGG - Intronic
1034337538 7:150333185-150333207 GGGTGAGGATGAAAGGAAGAGGG + Intronic
1034354310 7:150440024-150440046 AGGTGAGAATGTGGAGAAATTGG - Intergenic
1034922190 7:155092601-155092623 AGGTGATATTGCCAGGAAGTGGG + Intergenic
1035971966 8:4258564-4258586 AGGGAAGAATGGAAGGAAGGAGG + Intronic
1036755414 8:11467801-11467823 AGGTCAGAAAGGAAGGGAGTAGG - Intronic
1037764771 8:21765866-21765888 AGGTGGGGTTGAAAGGAAGTGGG - Intronic
1038443348 8:27586595-27586617 AGGTGGGAATATTAGGAAGAAGG + Intergenic
1038496919 8:28010022-28010044 AGGTGTGATTCTAAGGAAATGGG + Intergenic
1038603593 8:28974735-28974757 AGGTGAAAATGTATGGGAATAGG + Intronic
1038919134 8:32063195-32063217 AGGTGAGAATGGAATTATGTAGG + Intronic
1038922415 8:32099437-32099459 TGGTGACCATCTAAGGAAGTTGG + Intronic
1039594115 8:38775647-38775669 ATGTGAGAATATTAAGAAGTGGG - Intronic
1039639501 8:39204230-39204252 TGGTGAGAATGGAACCAAGTTGG - Intronic
1040659547 8:49554831-49554853 AGGTGATGATCTGAGGAAGTGGG - Intergenic
1041021242 8:53641311-53641333 TGGGGAGAATGGAAGCAAGTTGG - Intergenic
1041206377 8:55502352-55502374 TGGTGAGAATGTGAAGAAATAGG - Intronic
1042238864 8:66642069-66642091 AGGCGAGAATGTAGAGAAATTGG - Intronic
1042467716 8:69147278-69147300 AGGTGAGAGGCTGAGGAAGTTGG - Intergenic
1042628651 8:70791028-70791050 AGGTGATGGTGTTAGGAAGTAGG - Intergenic
1043337213 8:79191281-79191303 ACGTGGGAATGTAAAGAAGCAGG - Intergenic
1043604004 8:81977243-81977265 AGGTGATAGTGTTAGGAGGTGGG + Intergenic
1043611965 8:82076006-82076028 TGGTGAGAATGTATAGAAATTGG - Intergenic
1043887022 8:85612673-85612695 AGATGAGACATTAAGGAAGTTGG + Intergenic
1044313973 8:90727964-90727986 TGGGGAGAATGTAAGTAACTTGG + Intronic
1045087618 8:98703597-98703619 AAGAGAGAGTGTAAGGAAATGGG - Intronic
1045142015 8:99296652-99296674 ATGTGATAATATTAGGAAGTGGG + Intronic
1046085454 8:109428452-109428474 AGTGGAGAAGATAAGGAAGTGGG + Intronic
1046213307 8:111108337-111108359 TGATGAGGATGTAAGGAAATTGG + Intergenic
1046524963 8:115371866-115371888 CGGGGAGAATGGAAGAAAGTTGG + Intergenic
1046913275 8:119652285-119652307 AGGTGATGATATAAGGAGGTGGG - Intronic
1047353478 8:124097910-124097932 AGGTGAGGAGGGAAGGAAATGGG - Intronic
1047381466 8:124368143-124368165 AGGTGTGAATACAAGGGAGTGGG - Intronic
1047381492 8:124368426-124368448 AGGTGTGAATACAAGGGAGTGGG - Intronic
1047508285 8:125496879-125496901 AGGTGAGAAGATTAGGAAGGTGG + Intergenic
1047951459 8:129939346-129939368 AGGTGCCAATGGAAGGAAGGGGG + Intronic
1048363141 8:133715262-133715284 AGGTAAGAAAGGAAGGAAGGAGG - Intergenic
1049692554 8:143968860-143968882 TGGTGAGGATGTGAGGAAATTGG + Intronic
1050092047 9:2025178-2025200 AGTTGTGAATGTAGGAAAGTGGG + Intronic
1050278019 9:4020120-4020142 AGGTGAGAGAGTCAGAAAGTGGG + Intronic
1050289892 9:4143012-4143034 AGGTGAGTATGTCAGAGAGTAGG - Intronic
1050404637 9:5294538-5294560 AGGGGAGAATGGAACCAAGTTGG + Intergenic
1050422069 9:5476417-5476439 TGGTGAGAATGGAACCAAGTTGG - Intergenic
1050441076 9:5664709-5664731 TGGGGAGAATGGAACGAAGTTGG - Intronic
1050700033 9:8328627-8328649 AGGGGAGAATGGAACCAAGTTGG - Intronic
1050708559 9:8432433-8432455 AGGTCAGAATACGAGGAAGTAGG - Intronic
1051234800 9:14988167-14988189 TGGTGAGAATGTAAGAAAAAGGG + Intergenic
1051348200 9:16171731-16171753 AAGTGGGATTGTAAGGAGGTGGG + Intergenic
1051524701 9:18030758-18030780 AGGAGAGAAAGTAAGCAACTTGG - Intergenic
1051830996 9:21276293-21276315 AGGGGAGAATGGAACCAAGTTGG - Intergenic
1051945923 9:22570003-22570025 CGGTGAGAATGGAACCAAGTTGG + Intergenic
1052064968 9:24007002-24007024 AGTAGAGAATGGATGGAAGTAGG + Intergenic
1052383574 9:27798744-27798766 AGTTGAAAATCAAAGGAAGTGGG - Intergenic
1052395515 9:27933541-27933563 ATGTGAAAATATAAGGAATTTGG + Intergenic
1052458696 9:28734457-28734479 AGGTGAAACTGTAGGTAAGTAGG + Intergenic
1052598502 9:30594067-30594089 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
1052612139 9:30789650-30789672 CGGGGAGAATGGAAGCAAGTTGG - Intergenic
1052671908 9:31568753-31568775 AGGTCATGATATAAGGAAGTGGG + Intergenic
1055383056 9:75730116-75730138 TGGTGAGAAAGTGGGGAAGTGGG + Intergenic
1055497089 9:76866724-76866746 AGGAGAGGAAGGAAGGAAGTGGG + Intronic
1056133751 9:83610182-83610204 GGGTGTGAATGTCAGGAAGTAGG - Intergenic
1056693052 9:88824167-88824189 AGGTGACAGTATAAGGAGGTGGG + Intergenic
1057056258 9:91963585-91963607 ATGTGATAGTGTTAGGAAGTGGG + Intergenic
1057122491 9:92588759-92588781 AGGTGAGAATGTAAAGAAGGTGG + Intronic
1057122593 9:92589618-92589640 AGGTAAAAATGTAAAGAAGGTGG - Intronic
1058021342 9:100092852-100092874 TGATGAGAGTGTGAGGAAGTGGG + Intronic
1058718130 9:107740146-107740168 GGGAGAGATAGTAAGGAAGTAGG + Intergenic
1058940267 9:109806954-109806976 AGCTGAGTTAGTAAGGAAGTGGG + Intronic
1059113269 9:111577318-111577340 TGGTGAGTATGTAGAGAAGTTGG + Intronic
1059900068 9:118914471-118914493 AGGTGAGAAAGAAGGAAAGTGGG - Intergenic
1060298614 9:122360586-122360608 AGGTGAGAAGATAAGGGAGTGGG + Intergenic
1060326697 9:122623234-122623256 AGGTGATAGTGTTAGGAGGTGGG - Intergenic
1060595753 9:124847647-124847669 TGGTGAGGATGTGGGGAAGTAGG - Intergenic
1061045500 9:128162878-128162900 AGGAGAGAAGGGAAGGAAGATGG + Intronic
1061318362 9:129812178-129812200 AGCTGAGAAAATAAGGGAGTGGG - Intergenic
1061732938 9:132630730-132630752 AGGTGAAAATGTAGGCAGGTGGG + Intronic
1203628100 Un_KI270750v1:44519-44541 AGTTGAGAAAGTATTGAAGTGGG + Intergenic
1185986268 X:4837942-4837964 AGGTGATAATGTAAGCAATGGGG - Intergenic
1186408731 X:9327031-9327053 AGGTGAGAGTATTAGGAGGTGGG + Intergenic
1186493805 X:9996085-9996107 TGGCGAGAATGTGAGGAAATGGG - Intergenic
1186605648 X:11087676-11087698 AAGTGAGAATATATGGAATTTGG + Intergenic
1186912408 X:14182588-14182610 AGGTCAGACTGAAAGGAAGCTGG - Intergenic
1187251816 X:17605711-17605733 AGGAGAAGATGCAAGGAAGTTGG - Intronic
1187841071 X:23488881-23488903 AGGTGAGGAGGGAAGGAAATGGG + Intergenic
1188600625 X:31959246-31959268 AGGGTAGAATATAAGGATGTTGG - Intronic
1188921762 X:35986203-35986225 CGGGGAGAATGGAACGAAGTTGG - Intronic
1189144452 X:38641566-38641588 AGGGGAGAGTGAAAGGAAGGAGG - Intronic
1190324764 X:49199817-49199839 AGGGGAGAGTGGAAGGAAGATGG - Intronic
1190490516 X:50978346-50978368 AGGTGGGCATGTAAGGGAGAGGG + Intergenic
1191094201 X:56657747-56657769 TGGTGAGAATGGAAGCAAATTGG - Intergenic
1191102475 X:56746764-56746786 AGATGACAATCTAAGGAATTTGG - Intergenic
1191122355 X:56919729-56919751 TGGGGAGAATGGAAGCAAGTTGG - Intergenic
1191170575 X:57443209-57443231 CGGTGAGAATGGAATCAAGTTGG - Intronic
1191579438 X:62743703-62743725 TGGGGAGAATGTAAACAAGTTGG + Intergenic
1191673972 X:63775936-63775958 AGAAGATAATGTAAGGAAATAGG - Intronic
1191744932 X:64476549-64476571 AGGAGAGAATGGAACCAAGTTGG - Intergenic
1191751534 X:64548384-64548406 AGGGGAGAATGGAAGCAAGTTGG - Intergenic
1191754133 X:64575923-64575945 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
1191969042 X:66793634-66793656 CGGGGAGAATGGAATGAAGTTGG - Intergenic
1191984985 X:66970002-66970024 CGGTGAGAATGGAACAAAGTTGG + Intergenic
1192020720 X:67387791-67387813 CGGTGAGAATGGAAACAAGTTGG + Intergenic
1192132366 X:68564397-68564419 TGGGGAGAATGTAACCAAGTTGG - Intergenic
1192707570 X:73542432-73542454 TGGTGAGAATGGAACCAAGTTGG + Intergenic
1192910667 X:75601096-75601118 CGGTGAGAATGGAAACAAGTTGG - Intergenic
1193024011 X:76824431-76824453 TGGTGAGGATGTGAGGAAATTGG - Intergenic
1193030966 X:76897731-76897753 CGGGGAGAATGGAACGAAGTTGG + Intergenic
1193177342 X:78410161-78410183 TGGGGAGAATGGAACGAAGTTGG + Intergenic
1193369136 X:80672376-80672398 AGGTGAGGAAGGAAGGAAGGAGG + Exonic
1193886600 X:86989612-86989634 TGGTTAGAATGTAAGGAAAAAGG + Intergenic
1194152982 X:90349192-90349214 TGGCGAAAATGTGAGGAAGTAGG + Intergenic
1194184623 X:90759549-90759571 TGGTGAGGATGTGAGGAAATGGG + Intergenic
1194191111 X:90837752-90837774 AGGGGAGAATGGAACCAAGTTGG + Intergenic
1194314423 X:92357451-92357473 AGGTGATAGTATTAGGAAGTGGG + Intronic
1194364182 X:92994442-92994464 AAGTGAGAATGTACGGTATTTGG - Intergenic
1194545291 X:95226224-95226246 AGGGGAGAATGGAACCAAGTTGG + Intergenic
1194907979 X:99602602-99602624 AGGGGAGGATGAAAAGAAGTGGG + Intergenic
1195045526 X:101051582-101051604 AGGACAGAAAGTAAGGGAGTGGG + Exonic
1195204257 X:102579794-102579816 TGGAGAGAATGTGGGGAAGTAGG + Intergenic
1195204805 X:102587229-102587251 TGGAGAGAATGTGGGGAAGTAGG - Intergenic
1195367870 X:104143646-104143668 CGGGGAGAATGGAACGAAGTTGG + Intronic
1195388721 X:104338880-104338902 AGGTGAAAAAATAAGTAAGTGGG - Intergenic
1195392915 X:104381738-104381760 TGCTGAAAGTGTAAGGAAGTAGG - Intergenic
1195890164 X:109684830-109684852 AGGTGGGAATGAAAGGACTTTGG + Intronic
1196164744 X:112526422-112526444 GGGTGAGGGTTTAAGGAAGTGGG + Intergenic
1196872498 X:120126005-120126027 GAGTAAGAATGTAAGGGAGTAGG - Intergenic
1197078377 X:122379979-122380001 TGGTGAGAATGCAGGGAAGAGGG - Intergenic
1197582089 X:128295660-128295682 AGGAGAGAAAGGAAGGAAGAAGG + Intergenic
1197711689 X:129676152-129676174 AGGTGACAGTGTTAGGAAGTGGG - Intergenic
1197797714 X:130316034-130316056 TGGGGAGAATGTAAAGAAATTGG - Intergenic
1197916723 X:131543720-131543742 ACGTGAGAAAGTCAGGAAGATGG + Intergenic
1198660229 X:138960607-138960629 CGGGGAGAATGGAACGAAGTTGG - Intronic
1198678803 X:139158870-139158892 TGGGGAGAATGGAAGCAAGTTGG + Intronic
1198731280 X:139732391-139732413 AAATGAGAATGCAAGCAAGTTGG + Intronic
1199524754 X:148780345-148780367 AGGAGAGAATGGAACCAAGTTGG - Intronic
1199877706 X:151947908-151947930 ATGTGAGAATATTTGGAAGTGGG + Intergenic
1200499326 Y:3925994-3926016 TGGCGAAAATGTGAGGAAGTAGG + Intergenic
1200531220 Y:4341551-4341573 TGGTGAGGATGTGAGGAAATGGG + Intergenic
1200564928 Y:4753398-4753420 CGGGGAGAATGGAACGAAGTTGG + Intergenic
1200622481 Y:5468981-5469003 AGGTGATAGTATTAGGAAGTGGG + Intronic
1201245720 Y:12002055-12002077 AGGGGAGAATGGAACCAAGTTGG - Intergenic
1201251124 Y:12058580-12058602 AGGGGAGAATGGAATCAAGTTGG + Intergenic
1201465051 Y:14271131-14271153 AGGGGAGAATGGAACCAAGTTGG + Intergenic
1202374688 Y:24223415-24223437 CGGGGAGAATGGAAGCAAGTTGG + Intergenic
1202496092 Y:25446705-25446727 CGGGGAGAATGGAAGCAAGTTGG - Intergenic