ID: 1143301956

View in Genome Browser
Species Human (GRCh38)
Location 17:5917083-5917105
Sequence GAGAATTATTTGAATACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69971
Summary {0: 1, 1: 7, 2: 307, 3: 7235, 4: 62421}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143301956_1143301965 30 Left 1143301956 17:5917083-5917105 CCTCCTGTATTCAAATAATTCTC 0: 1
1: 7
2: 307
3: 7235
4: 62421
Right 1143301965 17:5917136-5917158 CAGGCGCATGCCACCACGTCCGG 0: 44
1: 999
2: 10812
3: 48185
4: 110041
1143301956_1143301961 3 Left 1143301956 17:5917083-5917105 CCTCCTGTATTCAAATAATTCTC 0: 1
1: 7
2: 307
3: 7235
4: 62421
Right 1143301961 17:5917109-5917131 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
1143301956_1143301959 2 Left 1143301956 17:5917083-5917105 CCTCCTGTATTCAAATAATTCTC 0: 1
1: 7
2: 307
3: 7235
4: 62421
Right 1143301959 17:5917108-5917130 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
1143301956_1143301963 11 Left 1143301956 17:5917083-5917105 CCTCCTGTATTCAAATAATTCTC 0: 1
1: 7
2: 307
3: 7235
4: 62421
Right 1143301963 17:5917117-5917139 TCCTGAGTAGCTGGGATTACAGG 0: 53511
1: 140483
2: 228049
3: 201895
4: 144651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143301956 Original CRISPR GAGAATTATTTGAATACAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr