ID: 1143302308

View in Genome Browser
Species Human (GRCh38)
Location 17:5919614-5919636
Sequence TGTAATTTATGTACACCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143302308 Original CRISPR TGTAATTTATGTACACCTCT GGG (reversed) Intronic
903074139 1:20749141-20749163 TGTAATTTAGATAAATCTCTAGG - Intronic
906153591 1:43601551-43601573 TGTAATGTATGATCACATCTGGG + Intronic
909590152 1:77339435-77339457 TGAAATTTATGAAGACCTTTGGG + Intronic
910840234 1:91554375-91554397 TTTGAATTATGTAAACCTCTGGG - Intergenic
911222557 1:95264424-95264446 TTTAATTTATGGTCACTTCTTGG + Intergenic
912920139 1:113858573-113858595 TGTAATTTCTGTTCCCCTTTAGG - Exonic
914094595 1:144533943-144533965 TGTTATTTCTGTAAACCACTGGG - Intergenic
914303925 1:146399938-146399960 TGTTATTTCTGTAAACCACTGGG + Intergenic
914515816 1:148373246-148373268 TGTTATTTCTGTAAACCACTGGG - Intergenic
917083633 1:171283137-171283159 GGTAACTTATTTACACCTGTAGG - Exonic
917384238 1:174452021-174452043 AGTATTTTATATACAACTCTAGG + Intronic
922817560 1:228460807-228460829 TGAAATTTAAGCATACCTCTGGG + Intergenic
924043320 1:240005139-240005161 TGTAATTTATGTACAAGTTATGG - Intergenic
924459629 1:244247550-244247572 TGAAAATTATGTTCAGCTCTTGG + Intergenic
1063567854 10:7187591-7187613 TGTCATTTTTGAACAGCTCTGGG - Intronic
1064090058 10:12375603-12375625 TGTCATTTATGTTCAGCTTTGGG - Intronic
1064239823 10:13616286-13616308 TGTAATTTTCGTCCACCTTTTGG - Intronic
1069469471 10:68674833-68674855 AGTAATTTGTCTGCACCTCTCGG - Intronic
1070512157 10:77171235-77171257 TGTAATTTAACCAGACCTCTAGG + Intronic
1072556937 10:96525530-96525552 TGACATTTATGGACACCTTTGGG - Intronic
1073373930 10:103016606-103016628 TGTAATTTAATCACACCGCTTGG - Intronic
1073658503 10:105445623-105445645 TGGAAGTTTTGTTCACCTCTAGG - Intergenic
1074128947 10:110556087-110556109 TGTAATTTGGGAACATCTCTGGG + Intergenic
1079500011 11:21092593-21092615 TGCATTTTAGGTACAGCTCTAGG + Intronic
1080379300 11:31751095-31751117 TGTATTGTATGTACTTCTCTAGG - Intronic
1080698504 11:34623982-34624004 TGTGATTTACGAAGACCTCTGGG + Intronic
1081254702 11:40877931-40877953 TGTAATTTAAGTAGGCCTCTTGG + Intronic
1087390588 11:97527249-97527271 TGTAATAAATGTACCACTCTGGG - Intergenic
1091870061 12:3882113-3882135 TGTAATTTCTTGACACCCCTGGG - Intergenic
1095360615 12:41334073-41334095 TTTTATTTATGCACGCCTCTTGG + Intronic
1095502557 12:42856379-42856401 TGGAAGTTAAGTACAGCTCTTGG - Intergenic
1095659160 12:44709100-44709122 TGTAATTTCTGTATAGCCCTTGG + Intronic
1098339128 12:69433641-69433663 GGTAATTTATGTTTACTTCTGGG - Intergenic
1099813439 12:87615657-87615679 TGTCATTTATGGACAGTTCTAGG - Intergenic
1102276252 12:111584466-111584488 TGTAATTTTTGGCCAACTCTGGG - Intronic
1106623520 13:31394892-31394914 TGTAATTTAAGTAGAAGTCTTGG + Intergenic
1106655297 13:31737384-31737406 TGTAATTTTTGTGTACATCTTGG - Intergenic
1108103315 13:46981713-46981735 TGTAAGTTGTTTCCACCTCTTGG - Intergenic
1108931772 13:55833600-55833622 TGTATTTTATGTACATGTGTTGG - Intergenic
1110410746 13:75201631-75201653 TTTCCTTTATGTATACCTCTTGG - Intergenic
1111379597 13:87430549-87430571 TGTGGTTTTTGTACACTTCTAGG - Intergenic
1112689311 13:101871919-101871941 TCTAATATATGTAGATCTCTGGG - Intronic
1112806209 13:103166206-103166228 TGTAACATATGTACACATTTTGG + Intergenic
1115700282 14:35946636-35946658 TCTAATTTATCTTCACATCTCGG + Intergenic
1116131781 14:40863907-40863929 AGTAATTTATTTACAAATCTAGG + Intergenic
1119975435 14:79019633-79019655 TGTAATTCTTCTACACCTTTTGG - Intronic
1122874115 14:104655330-104655352 TTTTATTTATTTCCACCTCTTGG - Intergenic
1124207197 15:27731665-27731687 GGTAATTTAAGTACACCCCCAGG - Intergenic
1127002130 15:54521567-54521589 TGTATTTTCTTTAGACCTCTAGG + Intronic
1132754821 16:1478306-1478328 AGTAATTTGTCTGCACCTCTTGG - Intergenic
1135511358 16:23086838-23086860 TGTAATTTATCTACAGTCCTAGG + Intronic
1139198119 16:64944664-64944686 AGTAGTTTATTTGCACCTCTTGG - Exonic
1139274065 16:65711090-65711112 AATAATATATGTAGACCTCTTGG - Intergenic
1141530337 16:84642044-84642066 AGTAAGTTACGTACAACTCTGGG - Intergenic
1143302308 17:5919614-5919636 TGTAATTTATGTACACCTCTGGG - Intronic
1144337281 17:14282706-14282728 TGAAATGTATGTAGACCTTTGGG + Intergenic
1148994411 17:51697020-51697042 TTTAATTTATGTACACAGGTAGG + Intronic
1151004483 17:70418119-70418141 TGTATTTGATGTACTCCTTTTGG + Intergenic
1154066576 18:11112170-11112192 TCTAATTTAAGTAATCCTCTAGG + Intronic
1156682529 18:39608490-39608512 TGTTATTTATGTGCACCTGCTGG + Intergenic
1158777148 18:60596859-60596881 TTTTATTTATATACACCTGTTGG - Intergenic
1159009334 18:63043335-63043357 TGTAATTTATTTCCAGCCCTTGG + Intergenic
1159792420 18:72798814-72798836 TGTAATTTAAGTAGGACTCTTGG - Intronic
1160128966 18:76207003-76207025 TGTAATTAATGGACAACTGTGGG - Intergenic
1160478438 18:79216005-79216027 TCTAATGTATGTACAGTTCTAGG + Intronic
1160659123 19:290354-290376 TGTTATTTATGTAAACATTTAGG - Intronic
1162887687 19:13708326-13708348 TTTAATATATGTAAACCTCTAGG - Intergenic
1165510821 19:36265836-36265858 TGAAATTTGTGGAAACCTCTCGG + Intergenic
1165511323 19:36268255-36268277 TGAAATTTGTGGAAACCTCTCGG + Intergenic
925083924 2:1092854-1092876 TTTAATTAATGTTCACATCTTGG - Intronic
926386429 2:12339973-12339995 GGTAATGTATGTAGACCACTAGG + Intergenic
931125506 2:59271817-59271839 TGTAATTTGTGTATCACTCTAGG - Intergenic
931413256 2:62055416-62055438 TGTAATTTAAGTAGAACTCTTGG - Intronic
933480650 2:82853053-82853075 TGTAATTTAAGTAGGACTCTTGG + Intergenic
933889238 2:86751402-86751424 AGTGGTTTATCTACACCTCTGGG - Intronic
936689797 2:114872864-114872886 TGTAATTTATGTAGGACCCTTGG - Intronic
939245258 2:139615388-139615410 TGCAAATTCTGTTCACCTCTTGG - Intergenic
939379635 2:141417630-141417652 TTTAAGTTATTTCCACCTCTTGG + Intronic
944250024 2:197572528-197572550 GGTATGTTATGTACACATCTCGG + Intronic
944663014 2:201936880-201936902 TGCAATTTATGCACACCTTCAGG - Intergenic
1169065209 20:2691341-2691363 TGTAATGTGTGTACAGGTCTTGG + Intergenic
1172725891 20:37041272-37041294 TGTAATTTGTGCACAACTCTGGG + Intronic
1173969907 20:47144640-47144662 TCTAATCTATGTAAGCCTCTTGG + Intronic
1176518607 21:7807128-7807150 TGTAAATTTTGTGCAACTCTTGG - Intergenic
1176786663 21:13264725-13264747 TCTAATTTCTGTACAACTGTAGG - Intergenic
1178652635 21:34437141-34437163 TGTAAATTTTGTGCAACTCTTGG - Intergenic
1180990079 22:19930457-19930479 TGTCATCTCTGGACACCTCTGGG + Intronic
1182283253 22:29229978-29230000 TGGACTTTGTGTACACCTCCAGG + Intronic
949572160 3:5303949-5303971 TGTAATTTATGAACACATTAAGG - Intergenic
950048034 3:9962748-9962770 TGCAAATTATATTCACCTCTTGG + Exonic
953147013 3:40287723-40287745 TGAAATTTATGTACAGTTTTGGG + Intergenic
953462335 3:43091626-43091648 TGTAATTAATATGCACCTCATGG - Intronic
956870548 3:73413065-73413087 TGTAATTAAAGTAAAGCTCTTGG + Intronic
958171557 3:89945772-89945794 TTTATTTTATTTACACCTTTAGG - Intergenic
958443290 3:94182497-94182519 TGTTATTTCTGTAAACCTGTCGG + Intergenic
958584149 3:96064249-96064271 TGTAATATATGTACATATTTAGG + Intergenic
958776502 3:98489207-98489229 GATATTTTATGTACACCTCATGG + Intergenic
959512671 3:107232157-107232179 GGGAATTTATGTAGACCTATAGG - Intergenic
959882353 3:111458747-111458769 TGTAACTTTGGTACAACTCTTGG - Intronic
963148457 3:142018896-142018918 TGAAAATTATGTCCACCTATTGG + Intronic
963537607 3:146547399-146547421 TGTAATTTAAGTAGGACTCTTGG + Intergenic
964091048 3:152875951-152875973 TTTAATATATGTAAAGCTCTTGG - Intergenic
965706112 3:171509858-171509880 TGTCATTTATGAACACCTTAAGG + Intergenic
967270931 3:187731810-187731832 TGGACTTCATGTACACATCTCGG - Exonic
970935135 4:21560811-21560833 TTTAATTTCTGTAACCCTCTAGG + Intronic
974516072 4:62912871-62912893 TGTAATGTATGTATATATCTGGG - Intergenic
975625227 4:76338985-76339007 TGTAATTTAAGTAGGACTCTTGG - Intronic
976180072 4:82390633-82390655 TGTAATTTAAGTAGGACTCTTGG - Intergenic
978316093 4:107439087-107439109 TGTAATTTAAGTAAGACTCTTGG + Intergenic
978920818 4:114181270-114181292 TGTAGTTAATCTATACCTCTAGG - Intergenic
978930612 4:114306859-114306881 TGTCATTTATATAAAGCTCTAGG - Intergenic
979687786 4:123529612-123529634 TGTAATTTACCTACCCCTATAGG + Intergenic
979829104 4:125278600-125278622 TGTAATTTAAGTAGAACTCTTGG - Intergenic
981329022 4:143486680-143486702 TTCAATGTATGTACACATCTAGG + Intergenic
983395711 4:167193313-167193335 GGTATTTTATGTAAACCTCATGG - Intronic
983573222 4:169232557-169232579 TGTACTTTATTTTAACCTCTAGG - Intronic
985242426 4:187944813-187944835 TGTAATATATGTACAGGGCTTGG + Intergenic
986185497 5:5432439-5432461 TTTAATTTATGTTCACTTTTTGG + Intronic
987522850 5:19009349-19009371 TGTAATTTATGAATACTTGTAGG + Intergenic
993598166 5:89885800-89885822 TGTCATTTATGAGAACCTCTGGG + Intergenic
994312068 5:98284955-98284977 TTTAATTTATGTAGATCTTTTGG - Intergenic
994979271 5:106852394-106852416 TGTAATGTAGGGATACCTCTGGG + Intergenic
995352247 5:111192472-111192494 TGTAATTTGTCTGCACCTCTGGG + Intergenic
996254928 5:121388239-121388261 TGAATTTTATGTACACCTGAAGG + Intergenic
996299201 5:121961235-121961257 GCTAATTTATGTAAAGCTCTTGG + Intergenic
997900547 5:137759855-137759877 TGTAATTTAAGTAGGACTCTTGG + Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999017778 5:148127391-148127413 TGTAATTTTAGCATACCTCTTGG + Intronic
999521438 5:152354706-152354728 TGTAAATCATGTTCCCCTCTAGG - Intergenic
1000807753 5:165817812-165817834 TTTAATTTTTGTTCACCTCATGG + Intergenic
1001759647 5:174196778-174196800 TGTAATTTCTGGACACATCCGGG + Intronic
1003173821 6:3740243-3740265 TTTAATTAATGTGCAGCTCTTGG + Intronic
1004778352 6:18874423-18874445 TTTAATTTATGTACACATTGTGG + Intergenic
1005699074 6:28381928-28381950 TGTTATTTAGGTGCATCTCTGGG - Exonic
1006622419 6:35375106-35375128 AGTAATTTATGTACATTTTTGGG + Intronic
1007814181 6:44508683-44508705 TATAATTTTTGTTCATCTCTTGG + Intergenic
1008186961 6:48405254-48405276 TACAATTTATGTATACCTTTTGG + Intergenic
1009939679 6:70276291-70276313 TGTAAATTTTATAAACCTCTGGG + Intronic
1010848393 6:80741478-80741500 GATAATTTTTGTACACCTCTTGG - Intergenic
1012668383 6:102008493-102008515 TGTAATTTGTGCTTACCTCTTGG - Intronic
1015729824 6:136335950-136335972 TGTAGTTTCTGTGAACCTCTGGG + Intergenic
1018471739 6:164103470-164103492 TCTAATTTATGCTCACCTCCAGG + Intergenic
1018664660 6:166124497-166124519 TGTAATTTAAGTAGGACTCTTGG + Intergenic
1020130955 7:5558313-5558335 TGTTATTTTTGAACACCTGTGGG + Intronic
1020997672 7:15284045-15284067 TGTAATTTATCAAAACCTCTGGG + Intronic
1021760620 7:23900150-23900172 TATAATTAATGGACACCTCTTGG - Intergenic
1021911497 7:25389886-25389908 TGTAAATCATGTACTCCTCATGG + Intergenic
1022802246 7:33787741-33787763 AGTAATTTAGGAAAACCTCTTGG + Intergenic
1023076998 7:36494044-36494066 TGTAACTTATGTACAGTTCTTGG + Intergenic
1023827268 7:44018043-44018065 GGTAATTTGTGTAAAACTCTTGG - Intergenic
1027919956 7:84380486-84380508 TGGAATTTATGAGCACATCTTGG + Intronic
1028654695 7:93191422-93191444 AGTAATTCATGCACACTTCTGGG - Intronic
1029738425 7:102477789-102477811 GGTAATTTGTGTAAAACTCTTGG - Intronic
1029755555 7:102571447-102571469 GGTAATTTGTGTAAAACTCTTGG - Intronic
1029773504 7:102670527-102670549 GGTAATTTGTGTAAAACTCTTGG - Intronic
1031287600 7:119890122-119890144 TGTAAATTATTTAAACCTATAGG - Intergenic
1031330927 7:120463468-120463490 TGTAATTTTTCTACACATTTGGG + Intronic
1034929513 7:155150547-155150569 TGCAATTGATGGACACCTCCGGG + Intergenic
1035088332 7:156280774-156280796 TGTAATATATCAACACCTGTAGG - Intergenic
1036016071 8:4786040-4786062 TATAATTTATGTACAAATGTTGG - Intronic
1037031805 8:14116702-14116724 TGTAATTCATGTATACCGATAGG + Intronic
1037531396 8:19777667-19777689 TGTATATTATGTACACATTTAGG - Intergenic
1037875012 8:22540105-22540127 TTTAACTTATGTACAGCTCCTGG + Intronic
1038208105 8:25488328-25488350 GGTAATATATGTATACTTCTGGG + Intronic
1039728218 8:40245106-40245128 AGTAATTTTTATACACCTGTTGG - Intergenic
1039781135 8:40786995-40787017 ATTAATTTATGTACCACTCTTGG - Intronic
1040714077 8:50225959-50225981 TGTTAATTATGTACACATATAGG + Intronic
1047229771 8:122986700-122986722 TTAAATTTATGTACTACTCTTGG - Intergenic
1047562213 8:125999580-125999602 TGTATTTTAGGTACTCTTCTAGG + Intergenic
1048569595 8:135640583-135640605 TGGAATTGATGTAAACCTCTGGG + Intronic
1050615500 9:7397841-7397863 TTTAGTTTCTGTACACATCTGGG + Intergenic
1050777754 9:9288053-9288075 TTTAATTTATCTACCACTCTTGG + Intronic
1052429030 9:28342705-28342727 TGTAAGTTTTTTACTCCTCTAGG - Intronic
1052616395 9:30847446-30847468 TGTAATTGATGTACTTCTATGGG + Intergenic
1054361425 9:64124419-64124441 TGTAATTTAAGAAAACTTCTTGG + Intergenic
1055004175 9:71486628-71486650 ATTAATTTATTTGCACCTCTTGG + Intergenic
1056104275 9:83331625-83331647 TGTAATACATGTACCACTCTAGG + Intronic
1056976739 9:91264173-91264195 TGTAATTTTAGTATACCTCTTGG - Intronic
1057018694 9:91678910-91678932 GGTAAATTATGTCCACCTCCTGG + Intronic
1057775641 9:98006586-98006608 TGTAATTTAAGTAGCACTCTTGG - Intronic
1060304658 9:122399636-122399658 GGTCATATATCTACACCTCTAGG + Intergenic
1185829254 X:3283833-3283855 TGTAGTGCATGCACACCTCTGGG + Intronic
1186488085 X:9949554-9949576 TGTAATTTATTTACACTAGTCGG + Intergenic
1190092406 X:47451017-47451039 TCTAATTTTGGTATACCTCTAGG + Intronic
1194013858 X:88595424-88595446 TGTAATTTAGTTAAACTTCTGGG + Intergenic
1195525052 X:105878240-105878262 TCAAATTTATTTACATCTCTGGG - Intronic
1198222054 X:134611631-134611653 TTTAATTCAGTTACACCTCTTGG - Intronic
1199041454 X:143119624-143119646 TGTAAGTTCTGTGCACCTGTAGG + Intergenic
1199143756 X:144340093-144340115 TGTCTTTTATGTAAACCTCAGGG + Intergenic
1200856670 Y:7946175-7946197 GGGTATTTTTGTACACCTCTGGG - Intergenic
1201736708 Y:17270949-17270971 TGTAAATAATGTACCACTCTGGG - Intergenic