ID: 1143310904

View in Genome Browser
Species Human (GRCh38)
Location 17:5988096-5988118
Sequence CTCAACCAGAAGTAGATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143310896_1143310904 16 Left 1143310896 17:5988057-5988079 CCCCTTTGCCTTCTGTCACGATT 0: 6
1: 89
2: 1152
3: 3063
4: 5177
Right 1143310904 17:5988096-5988118 CTCAACCAGAAGTAGATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 120
1143310895_1143310904 17 Left 1143310895 17:5988056-5988078 CCCCCTTTGCCTTCTGTCACGAT 0: 2
1: 45
2: 538
3: 1164
4: 2293
Right 1143310904 17:5988096-5988118 CTCAACCAGAAGTAGATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 120
1143310897_1143310904 15 Left 1143310897 17:5988058-5988080 CCCTTTGCCTTCTGTCACGATTG 0: 3
1: 97
2: 1131
3: 2302
4: 4796
Right 1143310904 17:5988096-5988118 CTCAACCAGAAGTAGATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 120
1143310894_1143310904 23 Left 1143310894 17:5988050-5988072 CCAGCTCCCCCTTTGCCTTCTGT 0: 8
1: 138
2: 647
3: 1445
4: 2645
Right 1143310904 17:5988096-5988118 CTCAACCAGAAGTAGATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 120
1143310898_1143310904 14 Left 1143310898 17:5988059-5988081 CCTTTGCCTTCTGTCACGATTGG 0: 2
1: 18
2: 262
3: 1710
4: 2898
Right 1143310904 17:5988096-5988118 CTCAACCAGAAGTAGATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 120
1143310900_1143310904 8 Left 1143310900 17:5988065-5988087 CCTTCTGTCACGATTGGAAATTT 0: 1
1: 1
2: 42
3: 672
4: 4656
Right 1143310904 17:5988096-5988118 CTCAACCAGAAGTAGATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143310904 Original CRISPR CTCAACCAGAAGTAGATGCT TGG Intronic
905698334 1:39992663-39992685 CCCAACCAGAAGTAGAGGCATGG + Intergenic
906232077 1:44172414-44172436 CGGGGCCAGAAGTAGATGCTGGG - Intergenic
907002325 1:50873962-50873984 CTCAACTGGATGTAGATACTAGG - Intronic
910076768 1:83289953-83289975 CTCAACCAGAAGTAATTTGTTGG - Intergenic
911085301 1:93972236-93972258 CTCAAGCAGAAGCAAATTCTGGG - Intergenic
911540051 1:99146845-99146867 CTCAGCCAGAAGCAGATAATTGG + Intergenic
912172078 1:107112947-107112969 CTCAACATGAAGTAGCTGGTTGG + Intergenic
913006838 1:114641643-114641665 CCTCACCAGAAGAAGATGCTAGG + Intronic
916010619 1:160702319-160702341 CTGAGACAGAAGTAGAGGCTGGG + Intronic
916909746 1:169334174-169334196 GTCAAACAGAAGCAGATACTTGG - Intronic
918412741 1:184277166-184277188 CCTCACCAGAAGCAGATGCTTGG + Intergenic
919095377 1:193027820-193027842 CCCAATCAAAAGTAGATGTTTGG + Intronic
923145304 1:231193691-231193713 CCTCACCAGAAGCAGATGCTGGG - Intronic
923732344 1:236564416-236564438 CTCAACCAGTAGAAGTAGCTTGG - Intronic
924264128 1:242263898-242263920 CTCAACCAAAAGTTAAAGCTTGG - Intronic
924497525 1:244604568-244604590 CTCTACCAGAAGGAGAAGGTGGG + Intronic
924619079 1:245644917-245644939 CCTCACCAGAAGCAGATGCTGGG - Intronic
1069727731 10:70591967-70591989 CACAACCAGGAGTGGATGCTAGG + Intergenic
1070982792 10:80663147-80663169 CACAACCAAAATTAGAAGCTAGG - Intergenic
1072532352 10:96331410-96331432 CCGCACCAGAAGCAGATGCTTGG - Intronic
1074620049 10:115109179-115109201 CTCAGCAATAAGTAGAGGCTGGG - Intronic
1076214462 10:128681681-128681703 CGCACCCAGCAGTAGGTGCTCGG + Intergenic
1077909240 11:6559505-6559527 GGCAGCCAGAAGCAGATGCTTGG - Intronic
1080055695 11:27904311-27904333 CACATCCAGAAGAAGAAGCTGGG + Intergenic
1081677053 11:44976188-44976210 CTCAACAAGGAGAAAATGCTTGG - Intergenic
1082949099 11:58791182-58791204 CTTTGCCAGAAGGAGATGCTGGG - Intergenic
1084122941 11:67080070-67080092 CTCAAAAAGAAGTAAAGGCTGGG - Intergenic
1084331300 11:68432183-68432205 CTCAATCAGAAGCAGCCGCTGGG - Intronic
1088390486 11:109309029-109309051 CCCAAGCAAAAGAAGATGCTGGG - Intergenic
1088921883 11:114265402-114265424 CTCCAGCAGAAGAAGATGATGGG - Intronic
1091274325 11:134340129-134340151 CGCACCCATAAGTAGATGTTAGG + Intronic
1092751772 12:11725871-11725893 CCTCACCAGAAGCAGATGCTAGG + Intronic
1098987885 12:77031842-77031864 CTCAACCAGAGGCAGCTGATTGG - Intronic
1099924986 12:89006439-89006461 CCCAACCAGCTGTACATGCTGGG + Intergenic
1101331728 12:103762604-103762626 CTCAGCCAGAAGGAGGGGCTTGG - Intronic
1101456603 12:104838194-104838216 CTCATCCAGTAGAACATGCTTGG - Intronic
1106661708 13:31806969-31806991 CTAAACCAGACGTAAATGCACGG + Intergenic
1107405239 13:40106150-40106172 AGCAACCAGCAGCAGATGCTTGG + Intergenic
1108207539 13:48106206-48106228 CCTTACCAGAAGCAGATGCTTGG - Intergenic
1108704222 13:52970720-52970742 TTCAACCAGAGGGAGAAGCTAGG - Intergenic
1110140582 13:72123821-72123843 CTCATCTAGAAGTAGATGAGTGG + Intergenic
1112179348 13:97062296-97062318 CCTCACCAGAAGCAGATGCTGGG - Intergenic
1113936878 13:113999547-113999569 CTCAACCCGAAAGAGAGGCTTGG + Intronic
1114313005 14:21484970-21484992 TTAAACCAGAATTAGAGGCTGGG + Intronic
1117339190 14:54779329-54779351 CTAACCCAAAAGTAGATACTCGG + Intronic
1126908123 15:53389383-53389405 CTCAGCCTGCAGTAGGTGCTAGG - Intergenic
1132474116 16:124212-124234 CTCACACAGAAGTACAGGCTGGG + Intronic
1132735347 16:1383347-1383369 CTCAACCCCAAGCAGATGCAGGG + Intronic
1134031272 16:10994403-10994425 CTCATCCAGAAGGAGGTGATTGG - Intronic
1137765749 16:50976384-50976406 CCCAACATGTAGTAGATGCTAGG + Intergenic
1140692329 16:77496488-77496510 ATCAGCCAGAAGTGAATGCTGGG + Intergenic
1142340293 16:89517540-89517562 CTCATCCATAAGCAGATGCAGGG - Intronic
1143310904 17:5988096-5988118 CTCAACCAGAAGTAGATGCTTGG + Intronic
1144421776 17:15105332-15105354 CTGAGCCTGAAGTCGATGCTGGG - Intergenic
1144824920 17:18100418-18100440 CTCACCTTGAAGTAGATGTTAGG - Exonic
1151415770 17:73961805-73961827 CCTCACCAGAAGCAGATGCTGGG + Intergenic
1156061975 18:33089329-33089351 CTCAAGTAGAGGGAGATGCTGGG - Intronic
1158164518 18:54524743-54524765 CACAATCAGAAGTAATTGCTTGG + Intergenic
1161546219 19:4881969-4881991 TTTAAAAAGAAGTAGATGCTGGG + Intergenic
929662421 2:43800704-43800726 CTCAAACAGAAGTATTTGCTGGG + Intronic
931854464 2:66287508-66287530 CCTCACCAGAAGTAGATGCCAGG - Intergenic
939525274 2:143286244-143286266 CACAACCAGAAATAAATGGTAGG + Intronic
940297064 2:152137372-152137394 AGCAAGCACAAGTAGATGCTTGG - Intronic
942861016 2:180612199-180612221 CTCCTCCAGAAGCACATGCTAGG - Intergenic
948785984 2:240353226-240353248 GCCACCCAGAAGTGGATGCTGGG - Intergenic
1169236109 20:3931116-3931138 CTGAACCATTAGTAGTTGCTAGG - Intronic
1169964663 20:11202940-11202962 ATAAAACAGAAGTAGAAGCTTGG + Intergenic
1172619949 20:36312176-36312198 CTTAACCAGAATTGCATGCTGGG - Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179019998 21:37631175-37631197 CTTAACCATAAGTACTTGCTGGG - Intronic
1179432640 21:41334632-41334654 CTCAAGCAGAAGCTGCTGCTGGG + Intronic
1179796925 21:43790181-43790203 ATGAACAAGAAGTAGATTCTCGG - Intronic
1182310483 22:29401822-29401844 CTGACCCAAAATTAGATGCTGGG - Intronic
1182690795 22:32160515-32160537 CTGACCCAAAATTAGATGCTGGG + Intergenic
949381478 3:3450864-3450886 CTCAACCATAAATAGAGTCTAGG + Intergenic
950405869 3:12804109-12804131 CTCAGACAGATGTAAATGCTGGG + Intronic
953057808 3:39402246-39402268 CTCAGCCAGAAGTATATGGAAGG - Intergenic
955518290 3:59749757-59749779 GTTAACAAGAATTAGATGCTGGG - Intronic
957292335 3:78293753-78293775 ATCAAGGAGAAGTTGATGCTGGG + Intergenic
960724007 3:120651868-120651890 ATCTCCCTGAAGTAGATGCTTGG - Intronic
966055800 3:175687912-175687934 CCTCACCAGAAGCAGATGCTGGG + Intronic
969046288 4:4339110-4339132 CTGAACAGGAAGTAGAAGCTGGG + Intergenic
970556122 4:17234029-17234051 TTTAATCAGAAGTAGATCCTTGG - Intergenic
970761228 4:19490741-19490763 CCCAACCAGAAACAGAAGCTAGG - Intergenic
974743917 4:66045032-66045054 CCTCACCAGAAGCAGATGCTGGG - Intergenic
980805762 4:137811501-137811523 CTCACCCAGAATTAGATTTTAGG - Intergenic
981655561 4:147108545-147108567 CTCAACAAAAAGTAGAACCTTGG - Intergenic
985751787 5:1683719-1683741 ATCAACAACAAGTAGCTGCTGGG + Intergenic
988427067 5:31076126-31076148 CTCAACCACACGTAGATTCATGG - Intergenic
989981740 5:50654053-50654075 TTTCACCAGAAGCAGATGCTTGG - Intergenic
992828791 5:80573957-80573979 AACAAGTAGAAGTAGATGCTTGG + Intergenic
996767579 5:127049752-127049774 GTAAACCAGAAGTCTATGCTTGG + Intronic
999160846 5:149497512-149497534 CTCCACCACAAGTAGACCCTAGG + Intronic
999275530 5:150327493-150327515 CTCACCCTGAAGTAGAAACTGGG + Intronic
1002717629 5:181238094-181238116 CTCACCCAGATCTTGATGCTGGG + Exonic
1002828675 6:798413-798435 GTCAACCAGGAGAAGATCCTTGG + Intergenic
1003472208 6:6447580-6447602 CGCAACCAGACGTAGCTGCAAGG - Intergenic
1006181440 6:32155467-32155489 CTGAGCCCGAATTAGATGCTGGG - Intronic
1009725604 6:67532660-67532682 CTAAAGCAGAAGGAGATCCTGGG + Intergenic
1011098492 6:83694467-83694489 CTCAACCAGAACTACATTGTTGG - Intronic
1012652054 6:101767014-101767036 GTCAACCAGAAGTAGGAGTTAGG - Intronic
1015127930 6:129775020-129775042 CTCATCCAGAAGCTGCTGCTAGG + Intergenic
1021539553 7:21742331-21742353 CCTCACCAGAAGCAGATGCTGGG - Intronic
1025849681 7:65235821-65235843 CTCAACCAGATGGTGGTGCTGGG - Intergenic
1026280007 7:68913852-68913874 CCTGACCAGAAGCAGATGCTGGG + Intergenic
1026316172 7:69229548-69229570 CCCAACCACAAGTTGATTCTTGG + Intergenic
1029410518 7:100406884-100406906 TTCACCCAGAAGGAGGTGCTGGG + Intronic
1030569893 7:111210075-111210097 CTCAACCAAAAGGAGATACAAGG - Intronic
1033499895 7:141937118-141937140 CTCAAGCAGAAGAATGTGCTGGG - Intronic
1039986088 8:42449235-42449257 CTCAGCCAAAAGTAGCTGCCAGG + Intronic
1041926819 8:63245517-63245539 CTCACTCATAAGTAGAAGCTAGG - Intergenic
1044280866 8:90354502-90354524 GGAAATCAGAAGTAGATGCTTGG + Intergenic
1045191265 8:99886608-99886630 TTCATCCATCAGTAGATGCTTGG - Intronic
1046762746 8:118038432-118038454 CTTAACCAGAGTCAGATGCTTGG - Intronic
1055057397 9:72036474-72036496 CCCAAACAGAACTACATGCTGGG + Intergenic
1057114282 9:92505872-92505894 TTCAACCAGAACTAAATGCATGG + Intronic
1059557114 9:115292725-115292747 CTCAACCAGATGGGGATGGTGGG - Intronic
1060463250 9:123878527-123878549 CTAATCTAGAAGGAGATGCTTGG - Intronic
1061058836 9:128240191-128240213 CTCTGCCTGAAGTAGGTGCTTGG - Intronic
1062060386 9:134492347-134492369 CTTAATCAGCAGCAGATGCTGGG - Intergenic
1186257055 X:7733243-7733265 CACAACAAGAAGTAAATACTTGG + Intergenic
1186372223 X:8959080-8959102 CTGTACCCGTAGTAGATGCTGGG + Intergenic
1190279675 X:48921510-48921532 CTCTACAACAAATAGATGCTTGG + Intergenic
1191740825 X:64433986-64434008 GTCCACCAGTAGCAGATGCTTGG - Intergenic
1201350919 Y:13040332-13040354 CTCCACCAGAAGCAGATCCTGGG - Intergenic