ID: 1143315337

View in Genome Browser
Species Human (GRCh38)
Location 17:6027739-6027761
Sequence GAGCCACCTTTGCTGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143315337_1143315344 30 Left 1143315337 17:6027739-6027761 CCTGGCAGCAGCAAAGGTGGCTC 0: 1
1: 0
2: 2
3: 6
4: 228
Right 1143315344 17:6027792-6027814 CGTCAGCGACTGCAGCAGCCAGG 0: 1
1: 0
2: 3
3: 14
4: 233
1143315337_1143315339 -2 Left 1143315337 17:6027739-6027761 CCTGGCAGCAGCAAAGGTGGCTC 0: 1
1: 0
2: 2
3: 6
4: 228
Right 1143315339 17:6027760-6027782 TCCTTAAGCTGCACTACCATGGG 0: 1
1: 0
2: 0
3: 9
4: 70
1143315337_1143315338 -3 Left 1143315337 17:6027739-6027761 CCTGGCAGCAGCAAAGGTGGCTC 0: 1
1: 0
2: 2
3: 6
4: 228
Right 1143315338 17:6027759-6027781 CTCCTTAAGCTGCACTACCATGG 0: 1
1: 0
2: 0
3: 8
4: 69
1143315337_1143315341 4 Left 1143315337 17:6027739-6027761 CCTGGCAGCAGCAAAGGTGGCTC 0: 1
1: 0
2: 2
3: 6
4: 228
Right 1143315341 17:6027766-6027788 AGCTGCACTACCATGGGTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143315337 Original CRISPR GAGCCACCTTTGCTGCTGCC AGG (reversed) Intronic
900544911 1:3223054-3223076 GGGCCACCTTGGCTGCTCCAAGG - Intronic
901361417 1:8703732-8703754 GAGCTGCCTCTGCTTCTGCCAGG + Intronic
902063439 1:13664567-13664589 GTGCCACCTTTGTTGCTCCTTGG - Intergenic
902263893 1:15247467-15247489 GAGCCACCCCTCCTCCTGCCAGG - Intronic
902378618 1:16042171-16042193 GAGCCCCCGCTACTGCTGCCAGG + Intergenic
902671833 1:17980013-17980035 GAGCCACCTGCACAGCTGCCAGG + Intergenic
902712484 1:18249876-18249898 CAGCCTCATTTCCTGCTGCCAGG + Intronic
904237103 1:29122995-29123017 GAGCCTCCTCTCCTGCGGCCTGG - Intronic
904494170 1:30877458-30877480 GCGCCTCAGTTGCTGCTGCCTGG - Intronic
906454030 1:45977933-45977955 GAGCCACCTGTGCTGGCCCCAGG - Intronic
906506664 1:46384864-46384886 GGGCCACCTTTGGAGTTGCCAGG - Intergenic
906535664 1:46549723-46549745 CAGGCACCTTTGCTGCAGGCTGG + Intronic
910525429 1:88172604-88172626 AATCCACCTCTTCTGCTGCCAGG + Intergenic
910711345 1:90185577-90185599 GAGCCATTTTTGCTTCTGCAAGG - Intergenic
911062379 1:93759430-93759452 GTGCCACCTCTGGTGCTGTCTGG - Intronic
911218751 1:95224637-95224659 AAGCCATCTTGTCTGCTGCCTGG + Intronic
912153605 1:106888429-106888451 AAGCTACCTATGCTGCTGCAAGG + Intergenic
912470410 1:109902795-109902817 GAGGCACATCTGGTGCTGCCTGG - Intergenic
915561389 1:156690151-156690173 GAGCCAGCATTGTTCCTGCCTGG - Intergenic
917789206 1:178488561-178488583 GAGGCAACTCTGCTGATGCCCGG + Intergenic
919463268 1:197903005-197903027 CAGCAACCTTTGCCTCTGCCGGG - Intronic
921100235 1:211922517-211922539 GTGCCAGCTTTGCCGCTGGCTGG - Intergenic
921436393 1:215128402-215128424 GTGCTACTTCTGCTGCTGCCAGG + Intronic
922766637 1:228159492-228159514 GAGCCCCATTTGCTGTTGCAGGG - Exonic
923000857 1:230005254-230005276 GAGCGCTCTTTACTGCTGCCAGG - Intergenic
924941228 1:248813460-248813482 TACTCAGCTTTGCTGCTGCCAGG + Intronic
1064009448 10:11723987-11724009 TAGCCACATATGCTGCTACCTGG - Intergenic
1064315414 10:14250924-14250946 GAGGCAGCTTTGCTTCTTCCTGG - Intronic
1064428848 10:15254266-15254288 CACCCACCTATGCTGCAGCCAGG - Intronic
1064993148 10:21273935-21273957 GAGCCATCTTAGAGGCTGCCTGG - Intergenic
1065917291 10:30364657-30364679 GAGCCTCCCCTGCTCCTGCCTGG + Intronic
1065989448 10:30993414-30993436 GAGCCACACTTGCTGCTACTTGG - Intronic
1069015111 10:63420669-63420691 GAGCCATCTTTGCCCCAGCCTGG + Intronic
1072819511 10:98542187-98542209 CAGCCACCTCTGCTGATACCCGG + Intronic
1074044109 10:109820805-109820827 GAGCCACCTCTGTTACTGCTGGG - Intergenic
1074882474 10:117669609-117669631 GAGCCACGCTTGCTGGGGCCTGG - Intergenic
1075400030 10:122154241-122154263 GAGCCAAACTTGCTGCTGCTCGG + Intronic
1075613100 10:123869253-123869275 GAGCCCGCTTTCCTGCAGCCTGG - Intronic
1076329447 10:129653935-129653957 GAGCCACCTTTGGGGATGCGGGG + Intronic
1077145713 11:1043362-1043384 GTGCCACCTGGGCTTCTGCCAGG - Intergenic
1078564646 11:12404065-12404087 GAGCCAACTGGGCAGCTGCCTGG - Intronic
1083940073 11:65891014-65891036 GCGCGACCTCTGCTGCTTCCTGG + Exonic
1084316973 11:68351282-68351304 TAGCCACCCCTGCAGCTGCCGGG + Intronic
1084790489 11:71472674-71472696 GAGCCACCCTGGCTGCTGTCTGG - Intronic
1086556199 11:88113965-88113987 TAGGCACCTTTGCTGGTGTCTGG - Exonic
1086878798 11:92130108-92130130 GAGCCACCTTTGTAGCTCTCAGG - Intergenic
1088648178 11:111934470-111934492 GAACCACTTCTGCTGCTGCAGGG - Intronic
1088972633 11:114787226-114787248 GAGCCTCCCTTGGTGCTGCAAGG + Intergenic
1089160286 11:116432133-116432155 GTGCCAACCCTGCTGCTGCCAGG + Intergenic
1090974591 11:131670804-131670826 AAACCACCTCTGATGCTGCCCGG + Intronic
1090977376 11:131689242-131689264 GGGCCACCTGTGTTCCTGCCTGG - Intronic
1091397163 12:161023-161045 CAGCCTCCTTGGCTGCTGCATGG + Intronic
1093006466 12:14057061-14057083 GTGCAACCTTTGCTCCTGCTAGG + Intergenic
1093761304 12:22914658-22914680 GAGCCGCCTTTTCAGCTTCCAGG + Intergenic
1094718828 12:33040710-33040732 GAGCCACCGTGCCTGGTGCCTGG + Intergenic
1096157269 12:49347656-49347678 GAGCGTCCCTTGCTCCTGCCAGG + Exonic
1102379710 12:112454171-112454193 GAGCCAACTGTGCTTCAGCCTGG - Intronic
1102462618 12:113109501-113109523 GAGTCACCTCTGCTGGTGCTGGG - Intronic
1103558416 12:121779557-121779579 GAGCCACCTTGGCGGCCTCCCGG + Exonic
1103591889 12:121997462-121997484 GAGGCAGCTGTGCTGCAGCCTGG + Intronic
1104475713 12:129068885-129068907 GAGCATCATTTGCTGCTGCAAGG + Intergenic
1105753243 13:23441213-23441235 GAGCCACTATCGCTGCCGCCTGG + Intergenic
1108684419 13:52806452-52806474 GAGCCACCTTTGCCTCTAACTGG - Intergenic
1111788665 13:92824404-92824426 CAGTCATCTTTGCTGCTCCCAGG + Intronic
1112729834 13:102348592-102348614 TAACCACCTTTGCTGCTATCTGG - Intronic
1113809630 13:113130400-113130422 CAGGCACCTTTCCTGATGCCTGG - Intronic
1113858592 13:113465561-113465583 GGGCCACCTGTGCTCCTGACAGG - Intronic
1115649707 14:35394287-35394309 GAGCCTCCATCGCGGCTGCCAGG - Intergenic
1117131840 14:52695226-52695248 GAGACTCCGGTGCTGCTGCCCGG - Intronic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1121326013 14:93019977-93019999 GAGACACCCTTGCTCCTGCTGGG - Intronic
1122101262 14:99412216-99412238 GCTTCACCTATGCTGCTGCCCGG + Intronic
1122854083 14:104551844-104551866 GAGCGTCCTTGGCTGCTGTCTGG - Intronic
1123972922 15:25525865-25525887 GAGGCAACATTGCTTCTGCCTGG + Intergenic
1124012122 15:25847281-25847303 GGGCCACCTGTTCTGCTCCCAGG + Intronic
1124401786 15:29354916-29354938 CATACACCTTTACTGCTGCCTGG + Intronic
1129380517 15:75162499-75162521 GAGCCACCGTGGCTGGGGCCAGG - Intergenic
1129773325 15:78216729-78216751 GCTCCACCTTGGCTCCTGCCTGG + Intronic
1130327068 15:82889679-82889701 TAGCAACTGTTGCTGCTGCCTGG - Intronic
1131006422 15:88982402-88982424 GAGCCAGCTTATCTGATGCCAGG - Intergenic
1131597524 15:93813335-93813357 GGGCCACCTGCCCTGCTGCCTGG - Intergenic
1132232629 15:100195197-100195219 GGGCCACCCTTGCTGCTGCCTGG - Intronic
1132344505 15:101100246-101100268 GAGCCATCTCTGAAGCTGCCGGG + Intergenic
1135037317 16:19089159-19089181 GAGCCACCTTTGCTTCTAATAGG + Intergenic
1139373458 16:66482083-66482105 GAGCCAGCCTTTCTGCAGCCAGG - Intronic
1139376704 16:66503210-66503232 GAGCCACCCTGGCTTCTGCAAGG + Intronic
1140933904 16:79653208-79653230 GCTCCATCTTGGCTGCTGCCAGG + Intergenic
1142207665 16:88791655-88791677 GTGCCCCCTTTGCTGCTGGTAGG - Intergenic
1142997368 17:3768907-3768929 GAGCCCCCTCAGCTGTTGCCTGG - Intronic
1143315337 17:6027739-6027761 GAGCCACCTTTGCTGCTGCCAGG - Intronic
1147807863 17:43144933-43144955 CACCCACCTTCCCTGCTGCCAGG + Intergenic
1149509583 17:57228998-57229020 GATTCACTTTTGCTTCTGCCAGG + Intergenic
1151756157 17:76076393-76076415 GGCACACCTTTCCTGCTGCCGGG + Intronic
1152245068 17:79181272-79181294 GAGCTACGCTTCCTGCTGCCTGG + Intronic
1153046652 18:861622-861644 GAGCTTCATTTCCTGCTGCCTGG - Intergenic
1153285971 18:3454004-3454026 AAACCACGTTTGCTGCTGTCAGG - Intronic
1156300392 18:35831357-35831379 GATTCACCTTGCCTGCTGCCTGG - Intergenic
1156524131 18:37750393-37750415 GAGCCTTCTTTGCTGTTGCCAGG - Intergenic
1157031333 18:43912084-43912106 GAGTCACCTTGGATGCTGCAAGG - Intergenic
1160046844 18:75394032-75394054 GAGCCACCTTTGCTAGTGTGAGG + Intergenic
1160449649 18:78953639-78953661 CAACCACACTTGCTGCTGCCTGG + Intergenic
1160463958 18:79059964-79059986 GAGCCATCTTTGGTGTTGCTGGG - Intergenic
1160506652 18:79430953-79430975 CAGCCGCCTTTCCTTCTGCCTGG + Intronic
1160737729 19:671782-671804 GAGTCCCCTTTGCTGCTTGCTGG - Intergenic
1160856501 19:1220298-1220320 GGGTCCCCTTTGCAGCTGCCTGG - Intronic
1161427619 19:4212578-4212600 GAGCCTCCACTGCTGCTCCCAGG + Exonic
1162138303 19:8569719-8569741 CAGCCACCACTGATGCTGCCTGG - Intronic
1162553912 19:11374756-11374778 GGACCGCCTTTGCTGCTGCTCGG + Exonic
1164761760 19:30733448-30733470 GGCCCACCTTTGCTCCTCCCTGG + Intergenic
1165031624 19:33002019-33002041 GAGGCACCTTTAATTCTGCCTGG - Intronic
1165678154 19:37746377-37746399 GAGCCAGTTTTCCTGCTGTCAGG + Intronic
1166142084 19:40810650-40810672 AAGCCACCATTGCTTCGGCCTGG - Intronic
1166185436 19:41136144-41136166 AAGCCACCATTGCTTCGGCCTGG + Intergenic
1168709333 19:58489600-58489622 GGTTCACCTTTCCTGCTGCCTGG - Intronic
925858167 2:8150393-8150415 CAGCCACCTTTGCTGGTCTCTGG - Intergenic
926636165 2:15181993-15182015 GAGCTCCCATTGCTGTTGCCTGG + Intronic
926796512 2:16623913-16623935 GAACCAGCTTAGCTGCTGTCTGG + Exonic
926846601 2:17147843-17147865 GACCCACAAGTGCTGCTGCCCGG + Intergenic
927992757 2:27459815-27459837 GAGCCAGCTCTACCGCTGCCAGG + Exonic
929456375 2:42068988-42069010 GGGCCATATGTGCTGCTGCCTGG - Intergenic
931134606 2:59383625-59383647 GAGCCTCTTTTTCTGCTGCCTGG + Intergenic
932334713 2:70923552-70923574 GAGCCACCTGTGCTTCTGAATGG + Intronic
933181837 2:79235884-79235906 GAGTCACCTTCCCTGCTGTCTGG + Intronic
935205772 2:100895558-100895580 CAGCCACCCCTGCTGCTGGCAGG - Intronic
935726500 2:106028537-106028559 GGGCCACCTCTGTGGCTGCCTGG - Intergenic
936800686 2:116261302-116261324 GAGGCACCTATGTTACTGCCTGG - Intergenic
937012052 2:118571821-118571843 GAGCCGCCTTTGGTTCTTCCAGG + Intergenic
940478809 2:154202091-154202113 GAGCAACCTTGCCTGCAGCCAGG - Intronic
944430547 2:199628979-199629001 GAACCACCTTTGCAGGTCCCAGG - Intergenic
944681690 2:202083409-202083431 GAGCCAGCCTTGGGGCTGCCAGG - Intronic
947712136 2:232322290-232322312 GAGCTCCCTGTGCTCCTGCCAGG + Intronic
947829768 2:233130714-233130736 GAGCGACCTCTGCCTCTGCCTGG + Intronic
948132557 2:235611225-235611247 AGACCACCTTTGCAGCTGCCTGG - Intronic
948707364 2:239803373-239803395 CTGCCTCCATTGCTGCTGCCTGG + Intergenic
948733349 2:239981068-239981090 AAGGACCCTTTGCTGCTGCCAGG - Intronic
1169278494 20:4248890-4248912 GAGCCCCCTGCGCTGCTGTCCGG + Exonic
1171097439 20:22345087-22345109 AGGCCACATTTGCAGCTGCCTGG + Intergenic
1173565458 20:44035318-44035340 AAGCCACCTTGGGTCCTGCCAGG + Intronic
1173604831 20:44324579-44324601 TAGCCACCTCTCCTTCTGCCAGG + Intergenic
1174543806 20:51309825-51309847 GAAGCACCTCTGCAGCTGCCTGG + Intergenic
1174708325 20:52679385-52679407 GAGCTACCTGTATTGCTGCCAGG - Intergenic
1175705245 20:61171908-61171930 GGACCACCTCTCCTGCTGCCAGG + Intergenic
1176422417 21:6526849-6526871 AAGCAACCTTTGGTTCTGCCAGG - Intergenic
1178310991 21:31529940-31529962 TTGCCACCTTTGCTGGAGCCAGG + Intronic
1178626001 21:34219402-34219424 AAGCTTCCTTTACTGCTGCCTGG + Intergenic
1178720138 21:35000877-35000899 GAGCCACTTCTTCTGGTGCCAGG + Intronic
1179697908 21:43135165-43135187 AAGCAACCTTTGGTTCTGCCAGG - Intergenic
1180057220 21:45365165-45365187 GAGCCCCCTTTGCTCCAGCCGGG - Intergenic
1181111707 22:20606348-20606370 GAGCCAACTTAGCTGCCACCTGG - Intergenic
1181277238 22:21694736-21694758 GAGCCCCCTTTGCTGCTAGGAGG + Exonic
1183605474 22:38865007-38865029 GAGCCTCCTTTGCTTCAGGCAGG + Exonic
1184024930 22:41848513-41848535 GCCCCACCCTTGCTGCAGCCAGG - Intronic
1184205251 22:42998268-42998290 GAACCTTCTTTGCTGCTGCAGGG + Intronic
1185280438 22:49967541-49967563 AAGCCACCTGTGCAGCTGCGGGG - Intergenic
950543021 3:13623350-13623372 GAACCCACTTTGCAGCTGCCTGG - Intronic
950768533 3:15292327-15292349 GAGCCCCCCTTGGTGCTGCTGGG - Intronic
951919839 3:27842289-27842311 CAGCCACCATTGCTGCTGTTGGG + Intergenic
953511683 3:43547470-43547492 GAGCCTTCTTTGATGCTTCCTGG + Intronic
953590057 3:44242350-44242372 CAGCCTCCTTTGCTGCTTCTAGG - Exonic
953807653 3:46085356-46085378 AAGCCAGCTTTGATGCTCCCTGG - Intergenic
953891992 3:46757474-46757496 GAGCCTGCTTTCCTGCAGCCTGG + Intronic
954379809 3:50213439-50213461 GAGGGCCCTTTGCTGCAGCCAGG + Intronic
957527407 3:81394872-81394894 GAGCCACATTGGAGGCTGCCAGG - Intergenic
959386550 3:105715752-105715774 GAGCCACCGTGCCTGGTGCCTGG - Intronic
960539084 3:118844681-118844703 AGGCCACCTTAGCTGCGGCCCGG + Intergenic
961440018 3:126947179-126947201 GTGCCACCCATGCTTCTGCCAGG + Intronic
962264129 3:133933788-133933810 AAGCCACCTCATCTGCTGCCAGG + Exonic
966515890 3:180820814-180820836 GAGCACCCTGTGCTGCTGACTGG + Intronic
968811011 4:2799704-2799726 GAGCCACCCTTGCGGCAGGCAGG + Intronic
973368124 4:49224171-49224193 CAGCTATCTTTGCTGCAGCCTGG + Intergenic
973392924 4:49571255-49571277 CAGCTATCTTTGCTGCAGCCTGG - Intergenic
981027895 4:140095019-140095041 GAGGCACCTCTGCTGCAGTCAGG - Intronic
983940241 4:173529421-173529443 CAGCCCCCTCTGCGGCTGCCGGG - Exonic
985726280 5:1517470-1517492 GAGCCACGTTCTCCGCTGCCTGG + Intronic
986737811 5:10681130-10681152 GAGCCACCTGCGCAGCCGCCGGG + Exonic
989536684 5:42572336-42572358 GAGCCACATTGCCTGCTGCTTGG - Intronic
991305299 5:65170556-65170578 GACCCACCTTTACTGTTCCCAGG - Intronic
993854849 5:93061661-93061683 GAGCTACCTCTGCTGGTGTCAGG - Intergenic
999152655 5:149436616-149436638 GTGCCATCCTTGCTCCTGCCTGG - Intergenic
1001102164 5:168823361-168823383 GTGCCTCCCCTGCTGCTGCCTGG - Intronic
1001790146 5:174449336-174449358 GAGCCACTGTGCCTGCTGCCTGG - Intergenic
1002198153 5:177512284-177512306 GCGCCACCTTAGCTGTTCCCTGG - Intronic
1002305592 5:178280812-178280834 GAGGTACCTGGGCTGCTGCCAGG + Intronic
1002928925 6:1620351-1620373 GGGACCCCTTTGCTGCTGCGGGG - Intergenic
1002964320 6:1947493-1947515 AACCCACCTTTCTTGCTGCCAGG + Intronic
1005923202 6:30418486-30418508 GGGCCATCCTTGCTCCTGCCTGG - Intergenic
1010974325 6:82295622-82295644 CAGCCAGTTTGGCTGCTGCCAGG - Intergenic
1017073296 6:150595765-150595787 GGGCCTCCTTTGCAGGTGCCGGG + Intergenic
1019594125 7:1850566-1850588 GAGTCACCTGTGCAGCTCCCCGG - Intronic
1019611168 7:1937379-1937401 GAGCCACCCACGCTGATGCCAGG - Intronic
1020459573 7:8413264-8413286 GAGCCACCATTTGTGCTGCCTGG - Intergenic
1023904587 7:44513266-44513288 GAGCCATCAGTGGTGCTGCCTGG + Exonic
1024259895 7:47566239-47566261 GAGCCACCCAAGCAGCTGCCCGG + Intronic
1024936216 7:54714556-54714578 CAGCCTCCTTTGCTGCCTCCTGG - Intergenic
1026108989 7:67443775-67443797 GAGCTAACATTGCTGCAGCCTGG - Intergenic
1028502828 7:91538046-91538068 GAGCCAGCTCTGAGGCTGCCTGG - Intergenic
1030192762 7:106825835-106825857 GATCCACCTTTGATGTGGCCAGG + Intergenic
1031817877 7:126461536-126461558 TATTCACCTTTGCTGCTTCCAGG + Intronic
1034348040 7:150398936-150398958 GAACCACCCTTGCTGAAGCCCGG + Intronic
1036406669 8:8461452-8461474 GAGCCGCATTTGCTGCTTCCAGG + Intergenic
1037744603 8:21632725-21632747 CAGCCATCTTTGCTGCTGTGAGG - Intergenic
1038252444 8:25917834-25917856 CAGAGCCCTTTGCTGCTGCCTGG + Intronic
1040817916 8:51528186-51528208 GAGTCACCTTCTCAGCTGCCAGG - Intronic
1041320806 8:56610732-56610754 GAGACACCTATGCTGCCTCCAGG + Intergenic
1043931456 8:86095997-86096019 GAGACATTTTTGCTTCTGCCAGG + Intronic
1044797974 8:95923336-95923358 GAGCCACCCTGGCTGCTTCGTGG - Intergenic
1045501511 8:102747616-102747638 GCCGCACCTTTCCTGCTGCCTGG + Intergenic
1047230888 8:122996820-122996842 GCGCCACTGATGCTGCTGCCAGG + Intergenic
1047770581 8:128027249-128027271 GAGCCACTGTTAGTGCTGCCGGG - Intergenic
1049183796 8:141238103-141238125 GGGCCACCTGTGCTGCTCCGTGG + Intronic
1049613917 8:143568141-143568163 GAGCCACCTCTGCTGCCGCCTGG - Exonic
1052693992 9:31853517-31853539 GAGCCATCTTGGCTCCTTCCTGG - Intergenic
1053515132 9:38723971-38723993 GGGCCACAGTTGCTGCTCCCAGG - Intergenic
1056063187 9:82906326-82906348 GGTCCACCTGTGCTGCTGACTGG + Intergenic
1056081265 9:83096422-83096444 GACCCACCTTTGCTGGGGTCTGG + Intergenic
1057179181 9:93020685-93020707 GAGCCTCCTGTGCTGCTGTGTGG + Intronic
1057825789 9:98371184-98371206 GTGCCACCTATGCTGGGGCCTGG - Intronic
1059647614 9:116283094-116283116 GGACCACCATGGCTGCTGCCTGG - Intronic
1061402499 9:130376061-130376083 GAGCCACCCTTGGTGCTCCAGGG + Intronic
1061924742 9:133800442-133800464 GAGCCATGTCTGCTGCTGCTGGG + Intronic
1062190219 9:135244179-135244201 GAGTCCCCTGTTCTGCTGCCTGG + Intergenic
1062212004 9:135370069-135370091 CAGTGACCTGTGCTGCTGCCTGG - Intergenic
1062534834 9:137016819-137016841 GAGCCACCCGTGCTGCATCCAGG + Intronic
1062572474 9:137191962-137191984 GAGGCACCCTAGCTGCTTCCAGG + Exonic
1062580220 9:137226084-137226106 GAGCCACATTTGCTGAAGTCTGG - Exonic
1062707584 9:137953925-137953947 AACCCACCTATGCTCCTGCCAGG - Intronic
1187907641 X:24082504-24082526 GAGCTACCTTTGATTCAGCCTGG + Intergenic
1188127404 X:26386284-26386306 GAGGCAGGTTTTCTGCTGCCTGG - Intergenic
1188278604 X:28234880-28234902 CAACCACTTTTCCTGCTGCCAGG + Intergenic
1188614900 X:32145474-32145496 CAGACACATTTGCTGCTGCAAGG - Intronic
1189803291 X:44711531-44711553 CGGCCACCTTTGCTAATGCCAGG - Intergenic
1194108266 X:89798662-89798684 GAGCCACGCTGGCTGCTGCTTGG + Intergenic
1194245888 X:91511466-91511488 CAGCCTCCGTTGCTGATGCCAGG + Intergenic
1199903951 X:152206184-152206206 GGCCCACCCTTGCTGCTGCAGGG - Intronic
1201365662 Y:13204226-13204248 GCTCCAACCTTGCTGCTGCCAGG + Intergenic
1202357255 Y:24064449-24064471 GATCCACAAATGCTGCTGCCTGG - Intergenic
1202513522 Y:25605665-25605687 GATCCACAAATGCTGCTGCCTGG + Intergenic