ID: 1143316688

View in Genome Browser
Species Human (GRCh38)
Location 17:6038264-6038286
Sequence CAGTGTGGCCAGAGCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 393}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143316678_1143316688 5 Left 1143316678 17:6038236-6038258 CCAGAATGTCTAGGAAGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 181
Right 1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG 0: 1
1: 0
2: 4
3: 58
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143316688 Original CRISPR CAGTGTGGCCAGAGCGGGGA GGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900162995 1:1233236-1233258 CAGTGCTGCCAGAGAAGGGAGGG + Exonic
900290792 1:1922813-1922835 CAGCCTGGTCAGAGCTGGGAGGG - Intronic
900291637 1:1926198-1926220 CAGTGTGGCCAGGGTGGGCCTGG + Intronic
900646955 1:3713337-3713359 CAGTGAGGCCAGGCCTGGGAGGG - Intronic
900689970 1:3974607-3974629 GGGTGTGGCCAGAGCAGGGTGGG + Intergenic
901557898 1:10046089-10046111 CATTCTGGCCAGAGAGGGGAGGG + Intronic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
901989410 1:13100656-13100678 CAGTGTGGCCAGACCTGGGAAGG + Intergenic
901992403 1:13126108-13126130 CAGTGTGGCCAGACCTGGGAAGG - Intergenic
902200462 1:14829763-14829785 TAGTGTGGCCAGAGCATAGAAGG + Intronic
903275607 1:22219410-22219432 CAGCCTGGCTAGAGAGGGGATGG - Intergenic
903710141 1:25317246-25317268 CTGTGAGGCCAGGGCAGGGAAGG + Intronic
903716975 1:25375160-25375182 CTGTGAGGCCAGGGCAGGGAAGG - Intronic
903957815 1:27037047-27037069 CAGCCTGGCCAGGGCGGGCAGGG + Intergenic
904418747 1:30378168-30378190 CGGTGTGGCCAGAGAGGCCAGGG + Intergenic
904466896 1:30713657-30713679 CAGGTTGGCCAGAGCAGGGCAGG + Intronic
904617516 1:31757958-31757980 CAGTCAGGCCAGAGTGGGTAAGG + Intronic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
905348371 1:37327361-37327383 CAGGGTGGCCAGGGCTGGGGTGG + Intergenic
905645587 1:39623089-39623111 CAGTGGAGCCAGAGCTGGGAAGG - Intergenic
906381480 1:45334751-45334773 CTGTGAGGCCAGGGCTGGGATGG + Intronic
906607332 1:47181421-47181443 CAGCCTGGCCAGATCGGGGAGGG - Intergenic
907088475 1:51701788-51701810 TGGGGTGGGCAGAGCGGGGAGGG - Intronic
907278029 1:53327707-53327729 CCGGGAGGCCGGAGCGGGGAGGG - Intronic
907330289 1:53666581-53666603 AAGAGTGGGCAGAGTGGGGATGG - Intronic
907431614 1:54415378-54415400 CTGTGTGCCCAGAGAGGTGAAGG - Intergenic
908000429 1:59673458-59673480 AAGTGGGGCCAGATCTGGGAGGG + Intronic
910107516 1:83647410-83647432 CAGTGTGCCAAGAACGGTGAAGG - Intergenic
910191994 1:84604327-84604349 CATTGTGTACAGAGAGGGGATGG - Intergenic
910283126 1:85523542-85523564 CATTGTAGCCAGAGCTGGGCTGG - Intronic
910835538 1:91505248-91505270 CATTGTGGCTAGAATGGGGAAGG + Intronic
912528729 1:110304693-110304715 CAGTGTGGCCACAGGGGCCATGG - Intergenic
914206888 1:145539447-145539469 CATTGTAGCCAGAGCTGGGCTGG + Intergenic
914935979 1:151980640-151980662 CAATGAGGCCAAAGCGAGGAAGG + Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915123908 1:153649999-153650021 CAGTGTGGACACAGCTGGGTTGG + Intergenic
915786206 1:158615184-158615206 GCGTGTGGCCAGAGCAGGGAGGG - Intronic
918101732 1:181382256-181382278 CAGTGTGGCTAGAGTTGGTAAGG + Intergenic
919845711 1:201640870-201640892 CTGTGTGCACAGAGCTGGGATGG + Intronic
919976306 1:202615299-202615321 CAGTGGGCCCAGAGAGTGGATGG + Intronic
920430997 1:205919055-205919077 TAGTGAGACCAGAGCAGGGATGG + Intronic
921325369 1:213982936-213982958 CCGCGGGGCCAGAGCGAGGAGGG + Intergenic
921988236 1:221335700-221335722 CACTATGGCCAGAAAGGGGAGGG - Intergenic
922966386 1:229694418-229694440 TAGTGTGGCCAGCGAGGGGGAGG - Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923575718 1:235157272-235157294 CAGACTGACCAGAGCAGGGAAGG + Intronic
923851231 1:237797430-237797452 CATTGTGGCCAGAGAGTTGAAGG + Intronic
1063489327 10:6448383-6448405 CAGTGTGGCCTGGCCAGGGAAGG + Intronic
1064735457 10:18377711-18377733 CTGTGTGGTTAGAGCGGGGAAGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1067020721 10:42794904-42794926 TGGGGTGGGCAGAGCGGGGAGGG - Intronic
1067204054 10:44198666-44198688 GTGTGTGGGCAGAGTGGGGAGGG + Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067431267 10:46247643-46247665 CAGTGTGGTGAGATAGGGGATGG - Intergenic
1067442139 10:46314556-46314578 CAGTGTGGTGAGACAGGGGATGG + Intronic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1069032909 10:63617054-63617076 CAGTGTGGCAAGGAAGGGGATGG - Intronic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1070425866 10:76286505-76286527 CTGAGTGACCAGAGAGGGGATGG + Intronic
1071295735 10:84217948-84217970 AAGTGTGATCAGAGCTGGGAAGG + Intronic
1071526089 10:86359384-86359406 CAGTGTGGCCAGTGAGGGGCAGG + Intronic
1071564083 10:86662626-86662648 CACTAGGGCCAGAGCGGGGATGG + Intronic
1072091082 10:92127786-92127808 CAGTGTGGCCATAGTGGGTAAGG + Intronic
1073099868 10:101000732-101000754 GAGTGGGCCCAGAGAGGGGAGGG + Exonic
1073186924 10:101620562-101620584 CAGGCTGGCCAGAGCGGGCAGGG + Intronic
1075725140 10:124607134-124607156 CAGTGGGTACAGAGCGGAGAGGG - Intronic
1075801807 10:125159291-125159313 AAGTGCGGCCCGGGCGGGGAAGG + Intronic
1076562158 10:131374034-131374056 CAGTGGGGCCTGGGCAGGGAGGG - Intergenic
1076571915 10:131438697-131438719 CAGTGTCCTCAGAGCGGGGCTGG + Intergenic
1076622786 10:131803235-131803257 GAGTGGGGCCGGAGCGGGGCCGG + Intergenic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1076764704 10:132626831-132626853 CAGTGGGGCATGAGCTGGGAGGG - Intronic
1077194707 11:1273595-1273617 CAGAGAGGCCAGACCGGCGATGG + Intergenic
1077307378 11:1874266-1874288 CAGTGGGGGCAGGCCGGGGACGG + Intronic
1077474851 11:2781515-2781537 CAGTGGGGCCAGAGGGGGAGTGG - Intronic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078480802 11:11673602-11673624 CAGTGTGGTCAGAGCTGTGTGGG - Intergenic
1078673642 11:13388866-13388888 CACTGTTGCCAGAAGGGGGATGG + Exonic
1078758350 11:14232541-14232563 CAGAGTTGCCAGAGTGGGGAGGG - Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1079458951 11:20662747-20662769 CATTCTGGCCAGGGCGGGGGTGG + Intergenic
1080706749 11:34702189-34702211 CAATGTGGCAAGCGAGGGGAAGG - Intergenic
1081390874 11:42527181-42527203 CAGTATGGACAGAGCAGAGAAGG + Intergenic
1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG + Intergenic
1081735058 11:45397000-45397022 CAGTGTGCCCAGAGAGGGCATGG - Intergenic
1083179065 11:60972601-60972623 CAAGCTGGCCAGAGCGGGGCAGG + Intronic
1083388800 11:62333198-62333220 CAGCGAGGCCAGAAGGGGGATGG + Intergenic
1083479415 11:62934056-62934078 CAGAGTGGCCAGAGTGGGGTGGG - Intergenic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1084459159 11:69286643-69286665 CAGCGTGACGAGAGTGGGGATGG + Intergenic
1085295150 11:75427331-75427353 CAGGGTGGCCAGACATGGGAAGG - Intronic
1085528280 11:77176543-77176565 CTGTGTGGGCAAAGTGGGGAAGG + Intronic
1085532811 11:77201908-77201930 CAGTGGGGGCACAGCTGGGAAGG + Intronic
1088747237 11:112814358-112814380 CAGTATGGCCAGGGCTGGGGAGG + Intergenic
1089494030 11:118899540-118899562 CGGTGTGCCCAGCTCGGGGAGGG + Intronic
1089778769 11:120858177-120858199 CAGTGTGGCTGGGGCGGGGTTGG + Intronic
1090773022 11:129938511-129938533 CAGGGTGGCAAAAGCGGGGATGG - Intronic
1091330013 11:134724938-134724960 AAGTGTGGCCCGAGCGGAGACGG + Intergenic
1091671652 12:2456516-2456538 CAGTGTGGCTGGAGCAGGGCAGG - Intronic
1091759525 12:3077596-3077618 CAGTGTGGGCAGGGCGGCGGTGG + Intronic
1099888564 12:88561743-88561765 CAGTGTGGCTAGAGCATGGTGGG - Intronic
1100023914 12:90104483-90104505 CAGTGTGCACAAAGCTGGGAAGG + Intergenic
1101364365 12:104058070-104058092 CAGAGTTTCCAGAGCTGGGATGG + Intronic
1101777128 12:107805758-107805780 CAGCCTGGCCAGAGCTGGGGAGG + Intergenic
1101937482 12:109069962-109069984 CAGGGAGGCCAGGGCGGGGAGGG + Intronic
1102001642 12:109561257-109561279 CAGAGTGGGCAGGGCTGGGAGGG + Intronic
1102141982 12:110622663-110622685 CAGTGTGGCCAGAAGAGGGGTGG + Intronic
1102672671 12:114633288-114633310 CAGTCTAGCCAAAGCAGGGAGGG + Intergenic
1103476456 12:121222342-121222364 CAGTAGGGCAAGAGCTGGGATGG - Intronic
1103713392 12:122929351-122929373 GAGTCTGGCCAGGGCGGGTAGGG - Exonic
1103937508 12:124484388-124484410 CAGTGTGCCTAGAGAGGGCATGG + Intronic
1103982059 12:124742962-124742984 CTGTGTGGGCAGAGCTGGGCGGG - Intergenic
1104436988 12:128764547-128764569 CTGTGTGGCCAGTGCTGGGCTGG + Intergenic
1104461816 12:128962492-128962514 CAGTGTGGCCTGTGCTGGGCAGG + Intronic
1104904977 12:132208293-132208315 TAGTGTGGCCAGGAAGGGGAGGG - Intronic
1107528990 13:41263774-41263796 GCGTGAGCCCAGAGCGGGGATGG + Intergenic
1107734795 13:43387454-43387476 CAGTGTGGACAGAGCCTGGTGGG + Intronic
1108408108 13:50124641-50124663 CAGCGGTGCCGGAGCGGGGAGGG - Intronic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1109554591 13:63955511-63955533 CAGTGTGGCAACAGCTGTGAAGG - Intergenic
1112030787 13:95454527-95454549 CAGGGTGGGGAGAGAGGGGAGGG - Intronic
1112179400 13:97062616-97062638 AAGTATTGCCAGAGTGGGGATGG + Intergenic
1113808196 13:113122125-113122147 CAGTGTGGCCAGTGGTGGGCAGG + Intergenic
1114664247 14:24368860-24368882 CATTGCGGCCAGACGGGGGAGGG - Intronic
1117090757 14:52247736-52247758 CAGTGTGGCCAGAGAAGTCAGGG + Intergenic
1118107253 14:62673910-62673932 CAGTGGGGTCAGAGAAGGGATGG - Intergenic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1119399034 14:74349360-74349382 TGGTGTGGCCAGGGCAGGGAGGG + Intronic
1119850705 14:77864556-77864578 CAGGTTGGCCAGAGCTGGGCTGG + Intronic
1121093697 14:91201084-91201106 CATTATGGCAAGGGCGGGGAGGG + Intronic
1121230672 14:92355277-92355299 GAGTGTGGCTGGAGCGGGGTGGG + Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121465265 14:94111718-94111740 CAGTGTGGCCAAAGTGGTCAGGG + Exonic
1121662501 14:95645998-95646020 CTGTGGGGCCAGAACTGGGAAGG - Intergenic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122136866 14:99638463-99638485 CAGTCTGGCCAGAGAGGCGCTGG + Intergenic
1122362896 14:101177884-101177906 CACTGAGGCCAGAGAGGGGCAGG + Intergenic
1123043954 14:105502494-105502516 CAGTGTGGACTGAGCGGTCAGGG - Intergenic
1124491953 15:30163650-30163672 CAGTGGGCCCAGAGAGTGGATGG + Intergenic
1124582952 15:30978040-30978062 CACTGTGGGCAGAGCAGTGAGGG - Intronic
1124751584 15:32374667-32374689 CAGTGGGCCCAGAGAGTGGATGG - Intergenic
1125310650 15:38374892-38374914 CAGTGTGGCCAGAGCTCTGAAGG - Intergenic
1125521896 15:40352722-40352744 CAGTGTGCCCAGTGCAGGGACGG - Intronic
1128300639 15:66564511-66564533 CAGTGCAGCCAGAGGGGGCAGGG - Intronic
1128336177 15:66787094-66787116 CAGTGTGGTCAGAGCCTGGATGG - Intergenic
1129108432 15:73323973-73323995 CACTCAGGGCAGAGCGGGGAAGG + Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1129328976 15:74816996-74817018 CATTGAGCCCAGAGAGGGGAAGG + Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1130159722 15:81386506-81386528 CAGTGTGGCCAGAGCAGGGTAGG - Intergenic
1130959489 15:88650287-88650309 CTGTGTGACCAGAGCAGGGCAGG + Intronic
1131166556 15:90145850-90145872 CAGAGAGGCAAGAGAGGGGATGG + Intergenic
1131956327 15:97740127-97740149 CAGTGTGACCAGAGCAGCCATGG + Intergenic
1132336964 15:101053875-101053897 CAGAGTGGCCAGAGGGTGAAAGG + Intronic
1132466091 16:78036-78058 CTGCGAGGCGAGAGCGGGGAAGG - Intronic
1132574360 16:657748-657770 CCGTGTGGCCACAGCGGACATGG + Exonic
1132683458 16:1153034-1153056 CAGCGTGGCCGGGGCGGGGCCGG - Intergenic
1133412653 16:5581012-5581034 CAGTGTGCACAGACCTGGGATGG + Intergenic
1133431379 16:5739989-5740011 CAGTGTGGCCAGCAGTGGGAGGG + Intergenic
1133692634 16:8231278-8231300 CAGTGGGGCCAGTCAGGGGATGG - Intergenic
1134541668 16:15071960-15071982 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1135056688 16:19237868-19237890 CACTATGGCCAGAGCAGGGTTGG + Intronic
1135359652 16:21801552-21801574 CAGTGTGTCCAGAGACCGGAAGG - Intergenic
1135437118 16:22436527-22436549 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1136073344 16:27802134-27802156 CTGTGTGGCCAGAGCTTGAAAGG - Intronic
1136263144 16:29095400-29095422 CAGTGTGTCCAGAGACCGGAAGG + Intergenic
1136403472 16:30030655-30030677 CAAAGGGGCCAGGGCGGGGACGG + Exonic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137574660 16:49590849-49590871 CAGAGTGGCCAGAGTGGTGGTGG - Intronic
1138206000 16:55125493-55125515 CAGTGTGGCCAGAACAGGGTAGG + Intergenic
1138339684 16:56280567-56280589 CAGAGTGGACAGGGCAGGGAGGG + Intronic
1138598378 16:58041418-58041440 CAGTGTGGGGAGATCGAGGAGGG + Intronic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1139607890 16:68032940-68032962 CAGGGTGGCCAGGGCCGAGAGGG + Intronic
1141497515 16:84420165-84420187 CAGGGTGTACAGAGCAGGGAGGG - Intronic
1141636171 16:85315099-85315121 CACTGTGTCCAGGGCGGGCAGGG - Intergenic
1141742499 16:85903206-85903228 CACTGTGCCCACAGTGGGGAAGG - Intronic
1142187471 16:88701359-88701381 CAGAGTGGGCACAGCGGGGATGG + Exonic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143345339 17:6244984-6245006 AAGTCTCTCCAGAGCGGGGAAGG + Intergenic
1143389009 17:6549205-6549227 CCGTGTGGCCAGGGCTGGCAAGG - Intronic
1143514227 17:7411395-7411417 CAGTGTGGGCAAAGCAGGGAAGG - Intronic
1143571310 17:7760377-7760399 CAGGGGGGCCAGACTGGGGAAGG + Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1144520388 17:15948768-15948790 CAATGTGGCAAGAGCAGAGAGGG - Intronic
1144944701 17:18963942-18963964 CAGTGTGGCTGGAGCGGGTGGGG - Intronic
1147057601 17:37846250-37846272 CAATGTGGCCAGAGCAGGATGGG + Intergenic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1148127420 17:45244024-45244046 CGGTGTGGGCGGAGCGGGCAGGG + Exonic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148689104 17:49516468-49516490 CAGTGGGGCCTCAGCGGGGAGGG + Intergenic
1148798584 17:50209576-50209598 CCATGTGGCCAGAGGGGGAAGGG + Intergenic
1148860266 17:50600940-50600962 CAGGGTGGCCTCAGCTGGGAGGG + Intronic
1148939274 17:51193972-51193994 CAGTGTTTCTAGAGAGGGGAGGG - Intronic
1150136212 17:62696746-62696768 CCAGGTGGCCAGAGCGGGGCGGG - Intergenic
1151318265 17:73337201-73337223 CCGCCTGGCCAGGGCGGGGAGGG - Exonic
1151493064 17:74443987-74444009 CCATGTGGCCAGAGCTGGGTTGG + Intronic
1151625759 17:75274545-75274567 CAGTTTGGCCAGAGGTGGGAAGG - Intronic
1152214511 17:79024551-79024573 CCTGGTGGCCAGGGCGGGGATGG + Intronic
1152771427 17:82172039-82172061 CACTCTGGCCAGTGAGGGGAGGG - Intronic
1153329883 18:3862897-3862919 CTGTGTGCCCAAAGCGGGGCAGG - Intronic
1153436117 18:5069575-5069597 CAGTGTCCCCAGAGCAGGAATGG - Intergenic
1153756900 18:8293379-8293401 CTGTGTGTCCAGAGAGGGCAGGG + Intronic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1153888907 18:9494322-9494344 TAGTGTAGCCAGAGAGGGCACGG + Intronic
1153971817 18:10234060-10234082 CAGTGTGGCCTGAGTCAGGATGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156485927 18:37465601-37465623 CTGTGTGCCCAGAGCTGGGATGG + Intronic
1156729480 18:40173983-40174005 CAGTTTGGAAAGAGGGGGGAAGG - Intergenic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1159703935 18:71663532-71663554 CAGTGTGGCCATGGAGGTGATGG + Intergenic
1160665756 19:327396-327418 CAGCGTGGGGGGAGCGGGGATGG + Intronic
1161055364 19:2188297-2188319 CAGGGTGGCCAGGGCAGGGCAGG + Intronic
1161445817 19:4318573-4318595 CAGTGTGGTCAGAGTTGGGGTGG + Intronic
1161581063 19:5081398-5081420 GAGTGTCCCCAGAGTGGGGAGGG + Intronic
1161608601 19:5228816-5228838 CAGCGGGGCCAGAGTGGGGAAGG - Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1162765322 19:12915843-12915865 AAGTGTGGGCAGGGTGGGGAAGG - Intronic
1163007386 19:14405607-14405629 AAGTGTGGCCAGATCTAGGAGGG + Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1165139434 19:33689961-33689983 CAGGGAGGCCAGAGCAGGAAGGG + Intronic
1165723185 19:38093940-38093962 CACTGGGGACAGAGTGGGGATGG + Intronic
1165792425 19:38500225-38500247 CAGAGTGGTCAGGGCTGGGATGG + Intronic
1166200139 19:41232098-41232120 CAGAGTGGCCAGGGCTGGGATGG - Intronic
1166299106 19:41904150-41904172 CAGTGAGCCAAGGGCGGGGAGGG + Intronic
1166645788 19:44530715-44530737 CAGAGTGGGCAGGGCTGGGATGG + Intergenic
1166658020 19:44626504-44626526 CAGAGTGGGCAGGGCTGGGATGG + Intronic
1166704988 19:44903549-44903571 CAGGGTGGACTGACCGGGGATGG - Exonic
1166868177 19:45853772-45853794 CAGTGTGGGCAGGGCTGGGATGG - Intronic
1166944732 19:46390004-46390026 CAGTGTGGTCAGGGCTGGGTGGG - Intronic
1167008789 19:46792638-46792660 CAGAGTGGGCAGGGCTGGGATGG + Intergenic
1167154331 19:47729161-47729183 CAGTGTGGTCAGAGCTGGGGCGG + Intronic
1167211777 19:48138022-48138044 GAGTGTGGACAGAGCAGAGAAGG + Intronic
1167381065 19:49138355-49138377 TTGAGTGGCCAGAGCTGGGAGGG - Exonic
925565808 2:5253035-5253057 CTGTGAGGGCAGAGCTGGGAGGG + Intergenic
926131524 2:10305760-10305782 CCCTGTGGCCAGAAAGGGGACGG - Intronic
927515786 2:23670874-23670896 CAGAGTGGGCAGAGAAGGGAGGG + Intronic
928214744 2:29351941-29351963 CACTGTGGCCAGAGCTGAGAAGG - Intronic
929120020 2:38476801-38476823 CAGTGTGGAGAGGGAGGGGATGG - Intergenic
929349265 2:40928990-40929012 CAGTGTGGTCAGAGCAGAAATGG + Intergenic
929797171 2:45069056-45069078 CTGTGTGGTGAGAGCGGGGGTGG - Intergenic
930036110 2:47086146-47086168 CAGTGTGGCCTGAGCCTGGGAGG - Intronic
932400260 2:71475602-71475624 CAGAGTGGGCACAGAGGGGAGGG + Intronic
934502344 2:94870781-94870803 CAGGCTGGGCACAGCGGGGAGGG - Intergenic
934851749 2:97706337-97706359 GAGTGTGTCCTGAGAGGGGATGG + Intergenic
934904513 2:98187077-98187099 GAGTGTGGCCATAGCGAGGCTGG - Intronic
935671361 2:105559754-105559776 CAGTGAGGGAAGAGAGGGGAGGG - Intergenic
937149058 2:119673469-119673491 CAGTGGGGACAGAGTAGGGAGGG - Intergenic
937216425 2:120316361-120316383 CAGGGTGGCCAGAGCCAGGGAGG + Intergenic
940005574 2:149006812-149006834 CAGGGAGGCTAGAGAGGGGAGGG + Intronic
940259565 2:151765944-151765966 GAGTGTGGCCTGAGCACGGAGGG - Intergenic
941631017 2:167884280-167884302 CAGTATGGCCAGAGCACAGAGGG - Intergenic
941927224 2:170908294-170908316 GAGTGGGGGAAGAGCGGGGAGGG + Intergenic
942944279 2:181656637-181656659 CAGTGAGGCGAGCACGGGGAGGG + Intronic
943097529 2:183448448-183448470 TGGTGTGGGGAGAGCGGGGAGGG - Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1170693742 20:18638583-18638605 CAGTGTGGCTGGAGCTTGGAGGG + Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1172096457 20:32462976-32462998 CAGTGGGGCCCGGGCAGGGATGG + Intronic
1173869451 20:46332386-46332408 CAGTTGGGCCAGTGAGGGGAAGG - Intergenic
1174126308 20:48309445-48309467 CAGTGTGGCCACAGCAGAGTGGG - Intergenic
1174317321 20:49713263-49713285 CAGCGAGGCAAGAGCGGGAAGGG + Intronic
1174363591 20:50043241-50043263 AAGTGTGGCCAAAACAGGGAGGG - Intergenic
1174400818 20:50274950-50274972 CAGTTGGGCCAGGGAGGGGAAGG + Intergenic
1175695285 20:61098766-61098788 CAGTGTAGCCAGACCTGGGAGGG - Intergenic
1175727940 20:61332241-61332263 CAGGGTGGGCGGAGCGGTGACGG + Intronic
1175743339 20:61435969-61435991 AAGTGTGGCCAGACTGGAGAAGG - Intronic
1176046722 20:63096775-63096797 CTGAGTGGCCACAGTGGGGATGG + Intergenic
1176146350 20:63567224-63567246 CAGTGTGGCCAGGGCCCGGGCGG - Exonic
1176294792 21:5065704-5065726 CAGTGACGCCAGAGTCGGGACGG - Intergenic
1176623670 21:9074383-9074405 CAGGCTGGGCACAGCGGGGAGGG + Intergenic
1176781214 21:13196476-13196498 GAGCGTGGCCAGAGCGGACATGG + Intergenic
1178403030 21:32303526-32303548 CAGTGTGGACCCAGAGGGGAAGG + Intronic
1178950400 21:36980863-36980885 CCGTGTGGCCAGAGGTGGCAGGG - Intronic
1179306144 21:40155486-40155508 CAGTGTGGCCAAGGAGGGCAGGG + Intronic
1179607758 21:42528502-42528524 CTGTGTGTCCAGAGAGGGGTGGG - Intronic
1179775175 21:43657796-43657818 CAGTGGCGCCAAAGCGGGCATGG - Intronic
1179993120 21:44958831-44958853 CCCTGGGGCCAGAGCCGGGAAGG + Intronic
1180012193 21:45058566-45058588 CAGTGGGGGCAGAGTGGGGAGGG + Intergenic
1181990587 22:26833820-26833842 CAGGGTGGCAAGAGGTGGGAAGG + Intergenic
1182431692 22:30302589-30302611 CAGTATGGCCACAGCTGAGATGG + Intronic
1183458203 22:37934087-37934109 CCCTGTGGCCAGAGCGGGCACGG + Intronic
1184289130 22:43489009-43489031 CAGTGTGGGCAGTGAGGGGTGGG + Intronic
1184486544 22:44783317-44783339 CTGTGTGGACAGCTCGGGGATGG - Intronic
1184510187 22:44928886-44928908 CAGTGGGGCCTCAGCGGTGAGGG - Intronic
1184860702 22:47171779-47171801 CACTGAGGCCACAACGGGGAAGG - Intronic
949898084 3:8785168-8785190 CAGTGTGTCTAGAGAAGGGATGG + Intronic
949929736 3:9069354-9069376 CAGTGTGCCCAGGGCTGGGAAGG + Intronic
950101466 3:10359426-10359448 AACTGAGGCCAGAGAGGGGAAGG + Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950475015 3:13209623-13209645 CAGTGTGGTCCGAGAGGGCACGG - Intergenic
950499546 3:13354945-13354967 CTATGTGGCCAGAGAAGGGAGGG - Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
951405828 3:22296288-22296310 CTGTGTGGCATTAGCGGGGATGG + Intronic
951585358 3:24209675-24209697 TAGGGTGGGCGGAGCGGGGAGGG + Intronic
954591857 3:51789743-51789765 AGGTGTGGCCAGACAGGGGATGG + Intergenic
957970317 3:87375201-87375223 AAGTGTGGCCAGAGCGGGCGCGG - Intergenic
960581034 3:119279171-119279193 CTGTGTGCCCAGAGCTGGGGAGG + Intergenic
961204299 3:125068618-125068640 CAGTGGGGCAAGAGGGGTGAAGG + Intergenic
961473278 3:127131854-127131876 AAGGGTGCCCAGAGCAGGGAGGG + Intergenic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964943045 3:162185123-162185145 CTGTGAGGCCATAGTGGGGATGG - Intergenic
965722603 3:171678069-171678091 CAGAGTGGGAAGGGCGGGGAGGG + Intronic
966182260 3:177197743-177197765 CAGTGCCGCCAGAGCGGGCCGGG - Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968073374 3:195801997-195802019 CAGGGTGGCCAGAGAGGGAGGGG - Intronic
968317652 3:197737544-197737566 CTGGGTAGCCAGAGCTGGGAAGG + Intronic
968635475 4:1676253-1676275 GAGTGATGCCAGAGCCGGGAGGG - Intronic
968947083 4:3670778-3670800 CAGTGTGTCCGGAGCGTGCAGGG + Intergenic
970173014 4:13308050-13308072 CAGTGTGGCTAGAGTGCGGTGGG - Intergenic
972169407 4:36326820-36326842 CACTGTGGCAAGACCTGGGAGGG + Intronic
974712694 4:65621308-65621330 CACTGTGGCCAGAAGTGGGATGG + Intronic
975485616 4:74932121-74932143 AAGTGTAGCAAGAGCAGGGAGGG + Intergenic
977941990 4:102869031-102869053 CAGCTTGGCCAGAGCGGAGGGGG + Exonic
980901017 4:138905267-138905289 AAGTGTGGGGAGAGAGGGGAGGG + Intergenic
980905442 4:138944144-138944166 CCGTGTAGCCAGAGCATGGAAGG + Intergenic
981012399 4:139938987-139939009 CACAGTGCGCAGAGCGGGGAAGG - Intronic
981419985 4:144538295-144538317 CACTGAGGCCAGAATGGGGATGG + Intergenic
981658290 4:147137192-147137214 CAGGATGGCCACAGTGGGGATGG - Intergenic
982166456 4:152617875-152617897 CAGTGTGGCCTGAGAGTGCAAGG - Intergenic
983523439 4:168735250-168735272 CAGTGGGGCGAGAGCAGTGAGGG - Intronic
983981758 4:174006146-174006168 CTGTGTTGCCAGAACGGGCAAGG + Intergenic
985789080 5:1915767-1915789 CAGTGGGGGCAGAGTGGGGTGGG + Intergenic
985882437 5:2648855-2648877 CGGTGTGGACAGAGCAGGAAGGG - Intergenic
986734702 5:10660355-10660377 CAGTGTGGCCTGGGCAGGGGTGG + Intergenic
988939655 5:36130037-36130059 TAGGGTGGCGGGAGCGGGGAGGG + Intronic
996191660 5:120550791-120550813 CAGTGTGCCTAAAGCAGGGAAGG + Intronic
996700495 5:126445882-126445904 CAGTATAGCCAGAGCAGGAAGGG + Intronic
997472109 5:134122864-134122886 CAGGGAGGCCAGATCAGGGAAGG + Intronic
998380049 5:141717852-141717874 CAGTATGGCCAGGGTGGTGATGG + Intergenic
1000494764 5:161967975-161967997 CAGTGTGGCAAGAACGAGGATGG - Intergenic
1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG + Intergenic
1002569126 5:180130055-180130077 CTGTGTGCCCAGAGCAGGGCTGG + Intronic
1002872526 6:1179669-1179691 CAGTGTGGCTGGAGCAGGGGAGG - Intergenic
1003302090 6:4893054-4893076 CAGTGTGGCAAGTGAGGAGAAGG - Intronic
1003948179 6:11094076-11094098 CGGGGTGGCCAGAGCGCGGGAGG - Exonic
1004513671 6:16303437-16303459 CATTCTGGCCAGAGCAGGGCTGG - Exonic
1006451938 6:34110429-34110451 CAGTGTGGCCAGGTCGGGTGGGG - Intronic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1007628404 6:43259406-43259428 CAGCGAGGCTAGTGCGGGGAGGG - Intronic
1007710560 6:43820826-43820848 GAGTGTGGCCAGCCCAGGGAGGG + Intergenic
1007849773 6:44791947-44791969 CAGAGTGGGTAGAGCAGGGAGGG - Intergenic
1008598744 6:53068087-53068109 CAGGGCGGCCAGGGGGGGGAGGG - Intronic
1009690873 6:67030962-67030984 CAGTGTGGCCAGAGCGGACGAGG - Intergenic
1009939986 6:70280483-70280505 CACTGGGGCCAGAGGGGGTACGG - Intronic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1011854325 6:91669761-91669783 CAGTGGGGAAAGAGAGGGGAGGG + Intergenic
1012132840 6:95518910-95518932 CAGTGTGGCGAGAGGCGGGTGGG + Intergenic
1012503746 6:99920577-99920599 CAGTGAGGCCACAGTGTGGAGGG + Exonic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1014402835 6:121012326-121012348 TGGGGTGGGCAGAGCGGGGAGGG + Intergenic
1015120073 6:129691874-129691896 CAGTGTGGGCTGAGCAGGAACGG - Intronic
1017086821 6:150720783-150720805 AACTGTGGCCAGAGCCAGGAAGG + Intronic
1018012648 6:159685688-159685710 CACTGAGGACAGAGCAGGGAGGG - Intronic
1018345346 6:162893320-162893342 CAGTGTGGACAGACAGGGCAGGG + Intronic
1018469793 6:164085265-164085287 CAGTTTGGCCTGCGCGGGGCTGG - Intergenic
1018834338 6:167471786-167471808 CACTGTGGGCAGAGCCGGGGAGG - Intergenic
1019178698 6:170174441-170174463 CCGTCTGGCCCTAGCGGGGAGGG - Intergenic
1019419582 7:944835-944857 CAGGGTGGGTAGAGTGGGGATGG - Intronic
1019420343 7:947904-947926 CAGTGTGCCCAGAGCCAGGGCGG - Intronic
1019505247 7:1387282-1387304 CAGTTTGGCCAGGACAGGGAGGG + Intergenic
1020257336 7:6509424-6509446 CACTGTGCCCAGAGAGGGAAAGG - Intronic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020847617 7:13306909-13306931 CAGTGGGGCCAGTTGGGGGATGG + Intergenic
1021877879 7:25065215-25065237 TGGTGTGCCCAGAGAGGGGATGG + Intergenic
1021890380 7:25180668-25180690 CAGTGTGGCCAGATAGAGGGTGG + Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1023435316 7:40135282-40135304 CTGGGCGGCCAGAGCGGGGCAGG - Intronic
1025078797 7:55964829-55964851 CAGTGGGGCCGGAGCTGGGGTGG + Intronic
1025109629 7:56203205-56203227 CAGTGTGGCTATAGGTGGGATGG + Intergenic
1025697880 7:63789610-63789632 CAGGCGGGCCAGCGCGGGGAGGG - Intergenic
1027224221 7:76233954-76233976 CTCTGAGGCCAGAGAGGGGAGGG + Intronic
1028474600 7:91239493-91239515 CAGTGAAGCCAGAGAGGGAAGGG - Intergenic
1034276718 7:149827069-149827091 CAGTGTGGACAGACAGGGGAGGG - Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1035048276 7:155983356-155983378 CAGGGTGGGCAGAGCTGGGGAGG + Intergenic
1035136491 7:156708738-156708760 CAGTGTGGGCAGATGGGGAAGGG + Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1037441694 8:18922883-18922905 CGGTGTGTCCAGAGAGGGCATGG - Intronic
1037709324 8:21342985-21343007 CAGTGTGGCCACAGGAGGAAAGG - Intergenic
1038660097 8:29489898-29489920 CAAGGGGGCCAGAGTGGGGAAGG - Intergenic
1039474670 8:37833386-37833408 CACTGAGGCCACAGTGGGGAAGG + Intronic
1039557162 8:38484779-38484801 AAGTGTGGCCTGGGCTGGGAGGG + Intergenic
1039560752 8:38510633-38510655 CAGTTTGTGCAGAGCAGGGAGGG + Intergenic
1040312965 8:46246224-46246246 CAGGGTGGCCTGGGCGGGCAGGG + Intergenic
1040986129 8:53296208-53296230 GAGGGTGGCCAGAGAGGGCATGG - Intergenic
1043372701 8:79612234-79612256 CAATGAGGCCAGCGTGGGGAGGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047745195 8:127839811-127839833 CAGTGTTGCCAGGGCTGGGGAGG + Intergenic
1048871932 8:138806371-138806393 CAGTGGGGGCAAAGCAGGGAAGG + Intronic
1049215064 8:141404020-141404042 GAGTGTGCCCCGAGAGGGGATGG - Intronic
1049476617 8:142799867-142799889 AGGTGTGGCCAGAGTGGGGAGGG + Intergenic
1049488293 8:142877653-142877675 CACTGTGCCCAGGGCAGGGAAGG - Intronic
1049493182 8:142915677-142915699 CACTGTGCCCAGGGCGGGGAAGG - Intronic
1049780531 8:144426669-144426691 CGGTGTGGCCAGAACGGTGGGGG - Intronic
1049855745 8:144860726-144860748 CAGTGCTGGCAGAGAGGGGAGGG + Intergenic
1050010521 9:1181490-1181512 CAGAGTGGGTAGAGCGGAGATGG - Intergenic
1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG + Intergenic
1050814624 9:9794468-9794490 CAATGTGGCTAGAGCAGAGAAGG + Intronic
1051275096 9:15391108-15391130 CAGTGAGGGCTGAGAGGGGAAGG + Intergenic
1051278454 9:15418950-15418972 CACTGTGGCCAGATTGGGAATGG + Intergenic
1052820656 9:33135688-33135710 CAGTGGAGTCAGAGCGGGGAGGG - Intronic
1053474387 9:38371473-38371495 TGGTGGGGCCAGAGCGTGGAAGG + Intergenic
1053477459 9:38392733-38392755 CCATGTGGACAGAGCTGGGAGGG + Exonic
1055144155 9:72912671-72912693 CAGTGGGACCAGAACTGGGAAGG - Intronic
1057367555 9:94437339-94437361 CAGGGTGGGGAGAGCAGGGATGG - Intronic
1057594990 9:96408062-96408084 CGGGGTGGCGGGAGCGGGGAGGG + Intronic
1057655773 9:96950714-96950736 CAGGGTGGGGAGAGCAGGGATGG + Intronic
1057740671 9:97708772-97708794 CTATGTGGCCAGGACGGGGAGGG + Intergenic
1057925350 9:99142088-99142110 CAGTGTGGCCACAGTGGGAATGG - Intronic
1058906638 9:109487319-109487341 CACTGTGGCAAGAGCAGGGAGGG + Intronic
1058944897 9:109847003-109847025 CAATGTGGCCAGTGGGGAGATGG + Intronic
1059466206 9:114470387-114470409 CTGTATGGCCAGAGCGTGGCAGG + Intronic
1059476559 9:114552173-114552195 CAGAGTGGCCAGACTAGGGAAGG - Intergenic
1059684865 9:116625448-116625470 CAATGGGGCCAGAGTGGGGAGGG - Intronic
1060765420 9:126292121-126292143 CAGTGGGGCCAGACCGTGGAAGG - Intergenic
1060984611 9:127812917-127812939 CAATGAGGCCAGAGTGGGGAAGG + Intronic
1061222215 9:129258718-129258740 CCGCGTGGCCCGGGCGGGGATGG + Intergenic
1061263054 9:129490535-129490557 CTGTGTGGCCAGAGCGTGTGAGG - Intergenic
1061457956 9:130712903-130712925 CAGTGGGACCAGAGCCGGGAGGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061923895 9:133796730-133796752 CAGTGTGGCCAGTGCAGACACGG - Intronic
1062043917 9:134416518-134416540 CTGTGTGGCCAGGGTGGGGCCGG + Intronic
1062094108 9:134694296-134694318 CTGTGCGGCCTGGGCGGGGACGG - Intronic
1062237982 9:135521775-135521797 CAGAGTGGGCAGGGCTGGGAGGG + Intronic
1062407331 9:136403183-136403205 GAGGGTTTCCAGAGCGGGGAGGG + Intronic
1062427444 9:136512498-136512520 CTGTTTGGGCTGAGCGGGGAGGG - Intronic
1062460285 9:136660060-136660082 CAGAGCGGCCAGGGCAGGGAAGG + Intronic
1062586630 9:137252584-137252606 CAGTGGGGCCAAAGGGGGGCTGG + Intronic
1203746854 Un_GL000218v1:44811-44833 CAGGCTGGGCACAGCGGGGAGGG + Intergenic
1186723219 X:12328408-12328430 TAGTGTGGCCTCAGCTGGGATGG - Intronic
1188529617 X:31125320-31125342 CAGTGGGGCCAGGGAGGGAATGG - Intronic
1191053978 X:56223030-56223052 AAGTGCGGCCAGAGTGGGCACGG + Intergenic
1192638431 X:72842735-72842757 CTTTGTGGCAAGAGCGGGAAGGG + Intronic
1192643283 X:72878073-72878095 CTTTGTGGCAAGAGCGGGAAGGG - Intronic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1197765477 X:130057073-130057095 CAGGGAGGCCAGAACGGGGTGGG - Exonic
1198024526 X:132692331-132692353 CAGTGTGGTCAGTGCAGTGATGG + Intronic
1198073535 X:133172717-133172739 CAGTATGGCTAGAACAGGGATGG + Intergenic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1199472961 X:148215244-148215266 CAGTGGGGCCTGAGATGGGATGG + Intergenic
1200855738 Y:7936287-7936309 GAATGTGGCCACAGCTGGGATGG - Intergenic