ID: 1143320299

View in Genome Browser
Species Human (GRCh38)
Location 17:6064232-6064254
Sequence GTGCACCAGCCAGTAGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143320299_1143320302 -9 Left 1143320299 17:6064232-6064254 CCTGTGTCTACTGGCTGGTGCAC 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1143320302 17:6064246-6064268 CTGGTGCACCCCAGGTAGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 145
1143320299_1143320308 6 Left 1143320299 17:6064232-6064254 CCTGTGTCTACTGGCTGGTGCAC 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1143320308 17:6064261-6064283 TAGGCAGGAGGAGCAAAGCAGGG 0: 1
1: 0
2: 5
3: 107
4: 3918
1143320299_1143320307 5 Left 1143320299 17:6064232-6064254 CCTGTGTCTACTGGCTGGTGCAC 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1143320307 17:6064260-6064282 GTAGGCAGGAGGAGCAAAGCAGG 0: 1
1: 0
2: 2
3: 40
4: 428
1143320299_1143320303 -6 Left 1143320299 17:6064232-6064254 CCTGTGTCTACTGGCTGGTGCAC 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1143320303 17:6064249-6064271 GTGCACCCCAGGTAGGCAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143320299 Original CRISPR GTGCACCAGCCAGTAGACAC AGG (reversed) Intronic
905751405 1:40467843-40467865 GGACACCAGACAGTAGAGACTGG + Intergenic
911274601 1:95846038-95846060 GTTCTCCATCCACTAGACACTGG + Intergenic
911357927 1:96844354-96844376 GAGCTCCAGCCAGGAGACCCTGG + Intergenic
913547758 1:119886311-119886333 GTGCATCATCCAGAAGACACAGG - Intergenic
914490474 1:148147837-148147859 GTGGCCCAGGCAGTAGAGACAGG - Intronic
916496466 1:165352670-165352692 GAGAACCAGCAAGGAGACACGGG + Intronic
918103976 1:181400673-181400695 CTGCACCACTCAGGAGACACAGG + Intergenic
919482155 1:198103537-198103559 ATTCACCTGCCAGTATACACAGG - Intergenic
921390056 1:214607380-214607402 GTGGCCCAGGCAGTAGAGACAGG + Intronic
922556025 1:226532705-226532727 GTGCACCAGCCAGTGGGAAGAGG - Intergenic
1062861111 10:810464-810486 GTGCATTAGCCAGTCGCCACTGG - Exonic
1067130188 10:43557052-43557074 ATCCACCAGCGAGTACACACAGG - Exonic
1068082090 10:52331815-52331837 GTGCAACTGCCAGTTGACACGGG + Intergenic
1068156767 10:53208967-53208989 GGCCACCAGTCATTAGACACTGG - Intergenic
1071680637 10:87702300-87702322 GTCCCACAGCCAGAAGACACAGG - Intronic
1076356395 10:129856697-129856719 GGGCAACAGCTAGTGGACACGGG + Intronic
1076357242 10:129862044-129862066 GGACACCCGCCAGGAGACACGGG + Intronic
1079094466 11:17501739-17501761 GTGCACCATACAGTTCACACTGG + Intronic
1084374209 11:68764766-68764788 GTGCATCAGCCAGCAGAAAAAGG + Intronic
1089670961 11:120056703-120056725 GTGCTCCAGCCAGTCCTCACAGG - Intergenic
1090645300 11:128762397-128762419 ATGCAGCAGCCACTAGCCACAGG + Intronic
1091357047 11:134945120-134945142 GGGCCACAGCCTGTAGACACCGG - Intergenic
1091360729 11:134976929-134976951 GTGTAGCAGCCACTAGCCACAGG + Intergenic
1097994862 12:65877260-65877282 CTGCAGCAGCCAGCAGACGCAGG - Intronic
1102976534 12:117210767-117210789 GACCCCCAGCCAGTAGACATTGG - Exonic
1104126629 12:125853025-125853047 GTTCACAATCCTGTAGACACTGG - Intergenic
1107703739 13:43077578-43077600 GTCAACCAGTCAGTAGATACAGG + Intronic
1109257770 13:60104336-60104358 CTGTACTATCCAGTAGACACTGG + Intronic
1118181358 14:63496329-63496351 GTGCCTCAGCCTGTAGAGACAGG - Intronic
1118602895 14:67482765-67482787 GTGCACCAGCCAGTGGCTACAGG - Intronic
1119967613 14:78934566-78934588 GTGCCTCAGCCAGTAGCAACAGG + Intronic
1122152832 14:99734058-99734080 CAGCTCCAGCCAGTGGACACTGG + Intergenic
1122199626 14:100114562-100114584 CTGCACCAGCCAGGCGACAGAGG + Intronic
1122769250 14:104090577-104090599 TTGCAGCAGCCACCAGACACTGG - Intronic
1123492374 15:20791936-20791958 GTGCAGTAGCCAATAGCCACAGG - Intergenic
1123548876 15:21361023-21361045 GTGCAGTAGCCAATAGCCACAGG - Intergenic
1125902474 15:43361541-43361563 GTGCACGACTCATTAGACACCGG - Exonic
1202957212 15_KI270727v1_random:88257-88279 GTGCAGTAGCCAATAGCCACAGG - Intergenic
1132539310 16:501051-501073 GTGCACCAGCTGGAACACACCGG - Intronic
1134641935 16:15836307-15836329 GTACACCAGCCACTAGCCACAGG + Intronic
1136707299 16:32201006-32201028 GTGCCCCGGGCAGTAGAGACAGG - Intergenic
1136760612 16:32728411-32728433 GTGCCCCGGGCAGTAGAGACAGG + Intergenic
1136807491 16:33141975-33141997 GTGCCCCGGGCAGTAGAGACAGG - Intergenic
1139237171 16:65352006-65352028 ATGCTCCAGCCAGTAAAGACTGG - Intergenic
1140202555 16:72906258-72906280 TTTCACCAGCCAGTCCACACTGG + Intronic
1203062764 16_KI270728v1_random:988726-988748 GTGCCCCGGGCAGTAGAGACAGG + Intergenic
1143320299 17:6064232-6064254 GTGCACCAGCCAGTAGACACAGG - Intronic
1144685105 17:17221033-17221055 GTGCACCAGCCTGGAAGCACTGG - Intronic
1145191065 17:20842439-20842461 GTGGCCCAGGCAGTAGAGACAGG - Intronic
1148411748 17:47473159-47473181 GTGCAGCAGCCGCTAGCCACAGG - Intergenic
1153762938 18:8349175-8349197 GTGCAACAGCCACCAGACCCAGG + Intronic
1154022212 18:10674154-10674176 GTGAACCACCCAGAACACACAGG + Intronic
1154449917 18:14466493-14466515 GTGCAGTAGCCAATAGCCACAGG - Intergenic
1154497629 18:14974179-14974201 GGGCCACAGCCTGTAGACACTGG + Intergenic
1160908754 19:1465142-1465164 GAGCACCTGCCTGTAGGCACAGG - Exonic
1160995136 19:1878984-1879006 GTGGCCCAGGCAGTAGAGACAGG + Intronic
1161688756 19:5718529-5718551 GGGCAGCAGCCAGTAGAGAGGGG - Intronic
1163270018 19:16247507-16247529 GTGCACCAGACAGAAGGCACTGG - Intergenic
1165610956 19:37152010-37152032 GTGCATCAGCCAGTTCACACAGG - Exonic
1165614324 19:37185648-37185670 GTGCATCAGCCAGTTCACACAGG - Exonic
1167468202 19:49661253-49661275 GTGCAGCAGCCACTAGCCACAGG - Intronic
1167536926 19:50059644-50059666 GAGCACCAGCGAGTCCACACTGG - Intergenic
1168419189 19:56190095-56190117 GTTCACCAGCGAGTCCACACTGG - Exonic
1168722653 19:58562751-58562773 GAGCACCAGGCGGTACACACGGG - Exonic
925337369 2:3108180-3108202 GGGCAGCAGCCACTAGACCCAGG + Intergenic
927680036 2:25132983-25133005 CTGCACCAGGCGGTGGACACAGG + Exonic
927960465 2:27237916-27237938 GCCCACAAGCCAGGAGACACTGG - Intronic
929091040 2:38217636-38217658 CTGCACCAGCCAGCAGACACTGG + Intergenic
930663498 2:54079266-54079288 GTGTACCAGCCAGGAGACTTGGG + Intronic
933772196 2:85751707-85751729 GAGCACCAGCCTTTAGAGACAGG + Intronic
934168473 2:89319205-89319227 GTGAAGCAGCCACTAGAGACAGG - Intergenic
934198814 2:89863377-89863399 GTGAAGCAGCCACTAGAGACAGG + Intergenic
934674179 2:96238007-96238029 CTGCACCACCCAGAAGATACTGG + Intergenic
936380730 2:111983591-111983613 GTGCATCAGCCAGGTGGCACAGG + Intronic
936636942 2:114269782-114269804 GTACACCAGCCAGCAGACTTTGG + Intergenic
939651206 2:144764567-144764589 GAGTACCAGTCAGTGGACACAGG + Intergenic
941658246 2:168167627-168167649 GTGGACCAGCTACCAGACACAGG + Intronic
942348916 2:175032128-175032150 GTTCACCTGCCGGTGGACACTGG - Intergenic
945104583 2:206298341-206298363 GTGCACCAGTTAGTAGAAAAAGG + Intronic
946190428 2:218004959-218004981 GTGCTCCAGCCAGGGGAGACGGG - Intergenic
947421169 2:229942642-229942664 GTGGAGCAGCAAGTAGGCACTGG - Intronic
948369777 2:237481302-237481324 CTGCACAACCCAGTTGACACTGG + Intergenic
948634261 2:239324554-239324576 GTGCAGCAGCCAGCACACTCAGG + Intronic
1172787726 20:37480245-37480267 TGCCACCAGCCAGTAGACCCAGG + Intergenic
1173050218 20:39552125-39552147 GGGCAGCAGCCTGTAGACAAGGG + Intergenic
1176446257 21:6823864-6823886 GTGCAGTAGCCAATAGCCACAGG + Intergenic
1176824426 21:13688894-13688916 GTGCAGTAGCCAATAGCCACAGG + Intergenic
1180223387 21:46374375-46374397 GTGAGCCAGCCAGAAGAGACTGG - Intronic
1181168344 22:20995005-20995027 TTGGACCAGCCAGTGGACATTGG + Exonic
1181334161 22:22116547-22116569 GTGGCCCAGGCAGTAGAGACAGG + Intergenic
1182502707 22:30759024-30759046 GTGTGCCAGCCAGTGGCCACAGG - Intronic
1183038099 22:35155456-35155478 CTGCACAAGCTACTAGACACAGG + Intergenic
1183292592 22:37012088-37012110 GTGCAGCAGCCAATACACAGTGG - Intronic
1183709504 22:39494604-39494626 TTTCCTCAGCCAGTAGACACAGG - Intergenic
1185161575 22:49233045-49233067 GGGCACCAGCCTGCAGCCACTGG - Intergenic
953616921 3:44499305-44499327 GTGCACCAGAGAGTCCACACTGG - Exonic
963898735 3:150712831-150712853 GTCTACCAGTCAGGAGACACAGG - Intergenic
964334230 3:155637932-155637954 GTGCACTAGCCAGTGCACAAAGG + Intronic
966912360 3:184566551-184566573 GTGTGCCAGCCTGTACACACAGG - Intronic
972974422 4:44616223-44616245 GTGCACCATCCAAGAGAGACTGG + Intergenic
979808111 4:125000556-125000578 GGGCAACAGGCAGTAGAGACAGG + Intergenic
983559902 4:169090555-169090577 TGGCTCCAGCCAGTGGACACAGG - Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
999077946 5:148815019-148815041 GTGGAGCATCCAGGAGACACAGG - Intergenic
1000366641 5:160497436-160497458 TTGCTGGAGCCAGTAGACACAGG + Intergenic
1005410172 6:25536672-25536694 GTGCTACAGCAAGTAGACATGGG + Intronic
1005524967 6:26637766-26637788 GTGCACCAGAGAGTCCACACAGG - Exonic
1006582921 6:35086992-35087014 GTCCACAACCCAGGAGACACTGG - Exonic
1008087290 6:47258447-47258469 TTGCACCACCTAATAGACACTGG + Intronic
1016428432 6:143958120-143958142 GTGCACCTGGCAGGGGACACTGG + Intronic
1020884420 7:13804095-13804117 GTGTCCCAGTCAGGAGACACGGG - Intergenic
1024265877 7:47606136-47606158 CTGCACCAGCCAGTCCACCCAGG - Intergenic
1024775142 7:52776003-52776025 GAGTACCAGCCAGTTGACCCAGG + Intergenic
1025024773 7:55507238-55507260 GTGTCCCAGCCAGCAGGCACGGG - Intronic
1033318174 7:140315731-140315753 GTGGACCAGCCAAGAGGCACGGG + Intronic
1035425475 7:158769300-158769322 GGGCTTCAGCCAGCAGACACTGG + Intronic
1036093885 8:5702187-5702209 ATGTACCAGACAGTAGAAACTGG + Intergenic
1036397671 8:8382840-8382862 TTGGACCAGCCCATAGACACGGG + Intronic
1036527854 8:9551933-9551955 GAGCAGCAGCCAGAAGACCCTGG + Intergenic
1039707624 8:40023463-40023485 GTGCCCCAGCTGGAAGACACTGG - Intergenic
1048319203 8:133385389-133385411 GTGCAGCAGCCAGGGGTCACAGG + Intergenic
1048795478 8:138145587-138145609 GTGCACCATGCAGTACACAGAGG - Intronic
1049079995 8:140435116-140435138 CTGAAGCAGCCAATAGACACCGG - Exonic
1049206874 8:141367621-141367643 CTGCACCATCCAGGAGACAGTGG + Intergenic
1049400468 8:142424508-142424530 GGACACCAGCCTGTGGACACCGG + Intergenic
1057230738 9:93319938-93319960 GTGGACCGGGCAGGAGACACTGG - Intronic
1057682158 9:97198724-97198746 GTGCACCAGAGAGTCCACACAGG - Intergenic
1061627101 9:131847267-131847289 GTGAACCAGCCAGGAAACCCTGG + Intergenic
1203522933 Un_GL000213v1:60666-60688 GTGCAGTAGCCAATAGCCACAGG - Intergenic
1189230231 X:39446335-39446357 GGGTACCAGCCAGTAAAAACGGG - Intergenic
1190217241 X:48488128-48488150 GTGGACCCACCAGTAGTCACTGG - Intergenic
1192202163 X:69073299-69073321 GGCCACCAGCCAGCAGACTCTGG - Intergenic
1193060085 X:77196908-77196930 GTCCCCCAGTCAGGAGACACCGG + Intergenic
1196029103 X:111075878-111075900 GTCCACCAGCCAGGGCACACTGG - Intronic