ID: 1143322595

View in Genome Browser
Species Human (GRCh38)
Location 17:6077818-6077840
Sequence CTGTATAACTGAAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143322595_1143322604 29 Left 1143322595 17:6077818-6077840 CCCTCTTCCCTTCAGTTATACAG 0: 1
1: 0
2: 1
3: 24
4: 229
Right 1143322604 17:6077870-6077892 AGCCCCTTTGTGAGCAGACCTGG 0: 1
1: 0
2: 0
3: 13
4: 122
1143322595_1143322600 6 Left 1143322595 17:6077818-6077840 CCCTCTTCCCTTCAGTTATACAG 0: 1
1: 0
2: 1
3: 24
4: 229
Right 1143322600 17:6077847-6077869 TGTGCTCCCTAGTTTGTAACCGG 0: 1
1: 0
2: 1
3: 23
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143322595 Original CRISPR CTGTATAACTGAAGGGAAGA GGG (reversed) Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
902676857 1:18014768-18014790 CTGTCTAACTGAAGAGAAAGAGG - Intergenic
903712513 1:25337040-25337062 CTTTTTAACTGAAGTGAAGGGGG + Intronic
905020814 1:34810096-34810118 TTGTACAACTGATGGGAAGATGG - Intronic
905540668 1:38757925-38757947 CTGAATAAATGAAGGAAGGAAGG + Intergenic
905970189 1:42135979-42136001 TTGTAGAACAGAAAGGAAGAAGG - Intergenic
906265755 1:44428062-44428084 CCATATAACTGAAGCCAAGAAGG - Intronic
906289171 1:44608821-44608843 CTGGATCATAGAAGGGAAGAAGG + Intronic
908796840 1:67838546-67838568 CTGTATATCTGGAGGCTAGATGG - Intergenic
909684795 1:78335735-78335757 CTCTCAAACTGAAGAGAAGATGG - Intronic
910506874 1:87959407-87959429 GTGTGCAACTGAAGGGAGGAGGG + Intergenic
911897253 1:103452327-103452349 CTCTCTCAATGAAGGGAAGAAGG + Intergenic
916251561 1:162743242-162743264 ATGAAGAACTGAAGGCAAGAGGG - Intronic
916664697 1:166955926-166955948 CTGCATAATTGTAGGGAAAAAGG - Intronic
916665865 1:166967021-166967043 TTCTATTACTGAAAGGAAGAAGG - Intronic
918569520 1:185972345-185972367 GTGTATCACTGGATGGAAGAAGG - Intronic
920692899 1:208160191-208160213 TTGTACTAATGAAGGGAAGAAGG - Intronic
923604068 1:235427539-235427561 CTGGAAAAGAGAAGGGAAGATGG - Intronic
924435164 1:244033108-244033130 CTGAATAATTGCATGGAAGAGGG + Intergenic
1064583411 10:16816433-16816455 CAGTGAAACTGAAGGCAAGAGGG + Intronic
1064652241 10:17521157-17521179 CTGACTAACTGAAGAGAATAGGG + Intergenic
1064891650 10:20181812-20181834 CTTTATAACTTATGCGAAGAAGG + Intronic
1065462559 10:25984014-25984036 CTTCATAAATGAAGGAAAGAAGG + Intronic
1066556597 10:36621218-36621240 ATGAAGAAATGAAGGGAAGAAGG - Intergenic
1066782088 10:38962218-38962240 GGGTATTTCTGAAGGGAAGAGGG - Intergenic
1067191050 10:44068719-44068741 CTGACTAACTTTAGGGAAGAAGG + Intergenic
1067357654 10:45545799-45545821 CTGGCTGAGTGAAGGGAAGAAGG - Intronic
1067695911 10:48535560-48535582 CTGTCTTACTGCAGGGAGGATGG + Intronic
1067811829 10:49434431-49434453 CTGTATAACTTCAGTGAAAAAGG + Intergenic
1068711726 10:60142176-60142198 CTGTATAACAGGAGGGAAGGTGG - Intronic
1069055935 10:63844778-63844800 CTGTAGAACTAAAAGGAACAGGG + Intergenic
1069755283 10:70771056-70771078 CTAGAGAACTGAAGGGCAGATGG - Intergenic
1072341041 10:94450211-94450233 CAGTATAACTGCAGGGGACAAGG + Intronic
1073732656 10:106308749-106308771 CTGTATAATAGATGGCAAGATGG + Intergenic
1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG + Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1077368310 11:2170200-2170222 CTGGATTAGTGATGGGAAGAGGG + Intronic
1078965930 11:16342276-16342298 GTGTATAACTTAACAGAAGAGGG + Intronic
1079593738 11:22214546-22214568 CCATAGAACTGAAGGGAATAGGG + Intronic
1079602893 11:22331433-22331455 ATGGATAAATGAATGGAAGAAGG - Intergenic
1079822581 11:25149277-25149299 CTGTACATCTGAAGGGATGCTGG - Intergenic
1080844162 11:36011952-36011974 CTGCATGACTGTGGGGAAGAAGG + Intronic
1081824826 11:46039058-46039080 CTGAATAAAAGTAGGGAAGAAGG + Intronic
1088120227 11:106360553-106360575 CTGGGTAACTGAAAGGATGATGG - Intergenic
1088519740 11:110682725-110682747 TTATATAATGGAAGGGAAGAAGG + Intronic
1088799843 11:113295676-113295698 CTGTTAAAGAGAAGGGAAGATGG - Intergenic
1089098290 11:115938040-115938062 CTGTATCACAGAAGGGTAGTGGG + Intergenic
1092265812 12:6979635-6979657 CTCCATAACTGAAGGTCAGAGGG - Intronic
1092701217 12:11233063-11233085 CTGTATAATGGAAGGGACAAAGG + Intergenic
1093030414 12:14283515-14283537 CTGGAGAAATGAAGGTAAGAGGG + Intergenic
1094114583 12:26896651-26896673 CTCCATAACTGAGGGGAAGGTGG - Intergenic
1094280366 12:28730547-28730569 CTGTATCCCTGAAGAGAAAAGGG - Intergenic
1094775595 12:33723797-33723819 CAGTTAAAGTGAAGGGAAGAGGG - Intergenic
1095311552 12:40703765-40703787 CAATATAAATGAAGGAAAGAAGG - Intronic
1096116248 12:49057170-49057192 TTGAATGACTGAATGGAAGAGGG - Intronic
1096609547 12:52791817-52791839 CTGCAGAACAGAAGGGAAGATGG + Intronic
1102314586 12:111876780-111876802 GTATATATCAGAAGGGAAGAAGG - Intronic
1103501939 12:121409795-121409817 CTGTTTCACTGAAGGGCAGCGGG + Intronic
1105053586 12:133077825-133077847 ATGGTGAACTGAAGGGAAGAAGG - Intergenic
1105286689 13:19009821-19009843 CTAGATAACCGAATGGAAGAAGG - Intergenic
1106167260 13:27259170-27259192 CTGCTTTAATGAAGGGAAGAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106725042 13:32475628-32475650 CTGACAAACAGAAGGGAAGATGG + Intronic
1107023559 13:35776781-35776803 CAGTGAAACTGAAGGAAAGAGGG - Intronic
1110872730 13:80471327-80471349 CTGTGTAGCTTAAGGGAATATGG + Intergenic
1112218207 13:97458414-97458436 GTGAATAAATGAAGGGAAGAAGG + Intronic
1112501136 13:99944176-99944198 CTGCAGAACTGAAGTGGAGATGG - Intergenic
1113842226 13:113366593-113366615 CTGAATTCCTGAAGGGAGGAGGG - Intergenic
1121074481 14:91056403-91056425 CTTTATAACTGAAGCTGAGAAGG + Intronic
1121666852 14:95679057-95679079 CAGTGTAACTGAAAGGAACAAGG - Intergenic
1123772148 15:23539498-23539520 CTGTAACTCTGAAGGGAAAAAGG - Intergenic
1126261797 15:46702137-46702159 CTCTATTACTGAGGGGAAGCCGG - Intergenic
1126347889 15:47716230-47716252 CTGTGTAACCCAAGGAAAGAAGG - Intronic
1126904135 15:53346378-53346400 CTATATAACTGAAGTGAAGTTGG - Intergenic
1127435086 15:58949433-58949455 CTGAAATACTGAAGCGAAGAAGG + Intronic
1130681943 15:86004749-86004771 CTCTGTAACTGAAGCTAAGATGG + Intergenic
1134818310 16:17224699-17224721 GTGTATAACAGAGGGGAAAATGG - Intronic
1138095066 16:54205092-54205114 CTGAATAAGTGAACGGAAAATGG + Intergenic
1138716007 16:59022849-59022871 CTGTCTAACTGACTGTAAGAGGG + Intergenic
1140061609 16:71575376-71575398 CTGTCAAACTGAAGGATAGAAGG - Intronic
1141071724 16:80962560-80962582 CTGTATATCTTAAAGGAAGATGG - Intergenic
1141400285 16:83741348-83741370 CTGTAAAACTGTAGGAAAGAAGG - Intronic
1141932458 16:87215249-87215271 CTGTATAACTGAGGGGAAAAAGG - Intronic
1142782073 17:2189211-2189233 CTGAAAAAGTGACGGGAAGAGGG - Intronic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1143383724 17:6512399-6512421 CTCAGTGACTGAAGGGAAGAGGG + Intronic
1144038546 17:11388358-11388380 CTCTATAGGTGAAGGGAGGATGG + Intronic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146560042 17:33860236-33860258 CTTTCTACCTGGAGGGAAGAAGG - Intronic
1148978559 17:51550727-51550749 CTGAATCACTAAAGGGAGGAAGG + Intergenic
1150593720 17:66585258-66585280 CTGGTTGACAGAAGGGAAGATGG + Intronic
1151484360 17:74389302-74389324 TTGTGTAACTGTAGGGGAGAGGG + Intergenic
1203190713 17_KI270729v1_random:184996-185018 GGGTATTTCTGAAGGGAAGAGGG - Intergenic
1153522900 18:5968843-5968865 CTTTATAAATGAAGCGAAGGTGG + Intronic
1153980896 18:10309535-10309557 CTGTGTAATTGAGGGGAGGAGGG + Intergenic
1156153851 18:34277916-34277938 CTGTCTCACTCAATGGAAGATGG - Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1159680560 18:71346098-71346120 ATGTATAATTGGAGTGAAGATGG - Intergenic
1159925894 18:74268752-74268774 TTGCACAACTGAATGGAAGATGG + Intronic
1163295329 19:16408049-16408071 ATGGATAAGGGAAGGGAAGATGG + Intronic
1163823816 19:19511658-19511680 CTGCAAAACTGAAGGGGACAGGG + Intergenic
1165725892 19:38112682-38112704 CTTTAAAAATGAAGGAAAGAGGG - Intronic
1165874391 19:38995628-38995650 CACTACAACTAAAGGGAAGAAGG + Intronic
1165929157 19:39344845-39344867 CTTGATCTCTGAAGGGAAGAGGG - Intronic
925831739 2:7903103-7903125 CTGCATAAAAGAAAGGAAGATGG + Intergenic
927578197 2:24217962-24217984 CTTTCTCACTGAAGGGGAGATGG - Exonic
928771512 2:34707435-34707457 CTGTAGAAGAGAAGGGCAGAAGG + Intergenic
929176134 2:38978347-38978369 CTATATATCTGAAGGGAATGAGG - Intergenic
929391888 2:41478590-41478612 CTGTAGGATAGAAGGGAAGATGG - Intergenic
930998249 2:57748892-57748914 CTGCTTTAGTGAAGGGAAGATGG - Intergenic
931322602 2:61185768-61185790 CTGAATAATTGGAGGGGAGATGG + Intronic
931918623 2:66987901-66987923 TGGTCTAACAGAAGGGAAGATGG + Intergenic
932582368 2:73000183-73000205 CTGTTTACATGAAGTGAAGAAGG - Intronic
935009787 2:99123086-99123108 CTGAAAAACTGGAGGTAAGAAGG - Intronic
935498910 2:103814295-103814317 ATGTTAAACTCAAGGGAAGAGGG + Intergenic
935980401 2:108620705-108620727 ATTCATAACTGAAAGGAAGATGG - Intronic
936894270 2:117408861-117408883 CTGTACATCTCAAGGGAAGGGGG - Intergenic
937038237 2:118800269-118800291 ATATATATCTGAAGTGAAGAGGG + Intergenic
938246450 2:129781038-129781060 CTGTATAGCAGAGGGGAAGTGGG + Intergenic
940230752 2:151448833-151448855 TTTTATAACTGATCGGAAGAAGG + Intronic
940796644 2:158087730-158087752 CTTCATAAATGAAGGAAAGATGG - Intronic
941589245 2:167398364-167398386 CACTATCAATGAAGGGAAGAAGG - Intergenic
942624609 2:177886524-177886546 CTTTATATTTGAAGGGAATAAGG - Intronic
942730977 2:179060544-179060566 TTGGATAGATGAAGGGAAGAGGG - Intergenic
942785234 2:179693328-179693350 CTGAATGACTGAAGGGAGAAGGG + Intronic
943225737 2:185173006-185173028 CTGTTAAACTCAAGGGAAGCAGG - Intergenic
944691694 2:202164488-202164510 TTGTATGACTCAAGGAAAGAAGG + Intronic
945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG + Intronic
1169948599 20:11016166-11016188 TAGTATAACAGAAGGGAAGAAGG - Intergenic
1172230747 20:33334037-33334059 CTGAAGATCTGATGGGAAGATGG - Intergenic
1172629015 20:36365965-36365987 CTGTAAAATTGGAGGGGAGAGGG + Intronic
1174964705 20:55199362-55199384 AGTTAGAACTGAAGGGAAGATGG + Intergenic
1175262282 20:57682128-57682150 CTGGATAAATGAACAGAAGATGG + Intronic
1175653756 20:60751005-60751027 ATATTTAACAGAAGGGAAGAAGG + Intergenic
1176996182 21:15558056-15558078 CTGGCAAAGTGAAGGGAAGATGG - Intergenic
1177127900 21:17218556-17218578 CTGCATAAATGAAGGAAAAATGG + Intergenic
1179138020 21:38697664-38697686 CTGTATGACTCAGGGAAAGATGG + Intergenic
1179159699 21:38884122-38884144 CTTCATAGCAGAAGGGAAGATGG - Intergenic
1181339308 22:22165672-22165694 CTGTGTAAGTGAGGGGCAGAAGG + Intergenic
1182750490 22:32637973-32637995 CTGAACTACTAAAGGGAAGAGGG - Intronic
949759566 3:7454470-7454492 TTGTGTAACTGAAGTGAAGGAGG + Intronic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
951202244 3:19888640-19888662 CTGTATAACAGAAGGGAGATGGG - Exonic
955855895 3:63273138-63273160 CTGTAGAACTGAAGTAAAGATGG - Intronic
957794823 3:84990542-84990564 CTATATCACTGAAGGGCAAAAGG - Intronic
958136883 3:89505250-89505272 CTGTTTGAATGAAGGTAAGATGG + Intergenic
960366836 3:116783105-116783127 TTGGCTGACTGAAGGGAAGAAGG - Intronic
960540420 3:118855422-118855444 CTGTATAATGGAAGAGAAGAAGG - Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962409934 3:135132309-135132331 GTGTAGAACTCAAGGGTAGAAGG - Intronic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
963292896 3:143511368-143511390 CTGCATAACTGAGAGGAAGCTGG - Intronic
963470827 3:145739832-145739854 CTGAAATTCTGAAGGGAAGAAGG + Intergenic
965885683 3:173444295-173444317 CTGTATAACAGAAGGACAGCAGG + Intronic
967970693 3:194996930-194996952 CTGAATAAATGAAGGGAGGACGG + Intergenic
968704236 4:2070583-2070605 CTGCGTAATTGAAGGGAAGAAGG + Intergenic
969495091 4:7521953-7521975 CTGTGCCACTGAAGGGAAGCCGG - Intronic
969620829 4:8278009-8278031 CTGCACAACTGCAGGGAAGCTGG + Intronic
970265087 4:14273824-14273846 CTGTCTAAGTGATGGCAAGAAGG - Intergenic
970417132 4:15870285-15870307 CTGACAAACAGAAGGGAAGATGG - Intergenic
970463817 4:16303643-16303665 CTGTATATAAGAAGTGAAGATGG - Intergenic
972020845 4:34311395-34311417 CTCAAGAACTGAAAGGAAGAAGG - Intergenic
975108412 4:70595668-70595690 TGGTATAACTGAAGGAAAGACGG + Intronic
975316175 4:72955804-72955826 CTGTAGAACAGATGAGAAGAAGG - Intergenic
978468324 4:109032946-109032968 TTGTATAAATGAAAGGAAGTAGG + Intronic
979439083 4:120729785-120729807 AGGTATAAGTGAAGGGAAAATGG + Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
979835693 4:125364690-125364712 CTGTATAACTGAAGGAAGTGAGG + Intronic
981207519 4:142060828-142060850 CTGTACAACTGGAAGGAAAAAGG + Intronic
984123901 4:175781298-175781320 CTGAAGAAATGAAGGGAAGGGGG + Intronic
984381509 4:178998240-178998262 CTCTAAAAGTGGAGGGAAGATGG - Intergenic
984472734 4:180197060-180197082 CTGTATACCTGTAAGAAAGATGG + Intergenic
985991936 5:3569563-3569585 CTGGATAATTGAAGGAGAGAAGG + Intergenic
988625962 5:32874879-32874901 CTTTATAGCTGAGGGGCAGAAGG - Intergenic
989149280 5:38282747-38282769 CTGTATATATCATGGGAAGAAGG + Intronic
990575021 5:57115875-57115897 CTGAAGAACAGAAGTGAAGAAGG + Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992869661 5:80993677-80993699 CTGTAGGCCTGAAGGCAAGAGGG + Intronic
993549433 5:89255737-89255759 CTGCATAACAGAAGAGAAGGTGG - Intergenic
993912581 5:93702612-93702634 CTGAATAAATGAAGGAAAGAAGG + Intronic
994183907 5:96798022-96798044 CTGTATAACTGAAAGTAACCTGG + Intronic
994235755 5:97359883-97359905 CTGTATAAATGAAGCCTAGAAGG - Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
997415948 5:133728791-133728813 ATGTATATCAGAAGGAAAGAAGG + Intergenic
999179081 5:149656172-149656194 CTCAGTAATTGAAGGGAAGAGGG - Intergenic
999665202 5:153905573-153905595 TTGTTTCCCTGAAGGGAAGAAGG + Intergenic
999839091 5:155404773-155404795 CTTCATAAATGAAGGAAAGAAGG + Intergenic
1000208659 5:159088753-159088775 GTGTTTATCTGAAGTGAAGATGG + Intronic
1001048207 5:168391983-168392005 AAGTAAGACTGAAGGGAAGAGGG + Intronic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001285259 5:170418447-170418469 CTGGAGAAATGATGGGAAGAGGG - Intronic
1001697486 5:173682799-173682821 TTGCACAACTCAAGGGAAGAAGG - Intergenic
1003340032 6:5211688-5211710 CTGAAAAGCTGATGGGAAGATGG + Intronic
1003459662 6:6318455-6318477 ATGTTTACCTGCAGGGAAGAGGG + Intronic
1003738812 6:8910424-8910446 CAATACAACTGTAGGGAAGAAGG + Intergenic
1006611166 6:35295387-35295409 CTGCCTAACTGAAGGGAATGGGG + Exonic
1008330837 6:50241789-50241811 GAGTATCACTGAATGGAAGAAGG - Intergenic
1008402448 6:51079414-51079436 CTGTATAAGTGAAGAGAAGTGGG + Intergenic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1009413586 6:63393478-63393500 CTGTACAGAAGAAGGGAAGATGG - Intergenic
1009553081 6:65125206-65125228 TTGAATAAATGAAGGGAAAAAGG - Intronic
1011772805 6:90693754-90693776 CTGTATAACTGAGGTGAATCTGG + Intergenic
1013299209 6:108787416-108787438 TTTTATAAATGAAGTGAAGAGGG - Intergenic
1013299528 6:108790976-108790998 TTTTATAAATGAAGTGAAGAGGG + Intergenic
1014450690 6:121578037-121578059 TTTTATTGCTGAAGGGAAGATGG + Intergenic
1014989734 6:128058938-128058960 AGGTAAAACTGTAGGGAAGAGGG - Intronic
1015281761 6:131442131-131442153 CTGTATATCTGAAGGGAATGAGG - Intergenic
1016104536 6:140145900-140145922 CTGACAAACAGAAGGGAAGAGGG + Intergenic
1016196892 6:141354742-141354764 CTGTATAAATGAATGAAATAAGG - Intergenic
1018138986 6:160807745-160807767 CTGAATTACAAAAGGGAAGATGG - Intergenic
1018251120 6:161871616-161871638 CTGTCCAACTGCAAGGAAGAGGG - Intronic
1020904616 7:14049745-14049767 TTATATAACTGAATGGGAGAAGG - Intergenic
1022525208 7:31032715-31032737 ATGTGTAAGGGAAGGGAAGAAGG + Intergenic
1022777237 7:33540086-33540108 ATATATAATTGAGGGGAAGAGGG - Intronic
1022880997 7:34587256-34587278 CTGTTGATCTGAAGGGAACATGG - Intergenic
1023263234 7:38379278-38379300 GTGTATAGCTGAGGGGGAGAAGG + Intergenic
1024001109 7:45189855-45189877 TGGGGTAACTGAAGGGAAGAAGG + Intergenic
1024191603 7:47017175-47017197 CTGAATAACAAAAGGGAAGATGG + Intergenic
1024298192 7:47863119-47863141 CTTTATAAGTGAATGGATGAGGG + Intronic
1024752112 7:52478593-52478615 CTGTTAAAGAGAAGGGAAGATGG + Intergenic
1024807227 7:53157245-53157267 AGGTATTTCTGAAGGGAAGAAGG + Intergenic
1026645964 7:72169124-72169146 ATGTGTAAATGTAGGGAAGAAGG - Intronic
1028366192 7:90035631-90035653 GTGTATAAATGAAAAGAAGATGG + Intergenic
1031303295 7:120090965-120090987 CTGTTTAAATGAAAGGAGGAAGG - Intergenic
1031414349 7:121477907-121477929 ATCTATAACTGAAGGGAAAAGGG - Intergenic
1031580365 7:123467402-123467424 CTGTCTATCTGTAGGCAAGATGG - Intronic
1032794716 7:135268483-135268505 CTGCAGAACTGAAGGGAATCTGG + Intergenic
1032878602 7:136064887-136064909 TTGAACAACTTAAGGGAAGAAGG + Intergenic
1034407984 7:150918577-150918599 CTGAATCACAGAGGGGAAGAAGG - Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037588044 8:20291396-20291418 CTTTGGAACTGAGGGGAAGAGGG + Intronic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1047228649 8:122977393-122977415 CTCTGTATCTGAAAGGAAGAAGG + Intergenic
1047253421 8:123197687-123197709 TTGCATCACTAAAGGGAAGAAGG + Intronic
1047960871 8:130010790-130010812 CTGAATGAATGAAGGGGAGAGGG + Intronic
1051802230 9:20948703-20948725 CTGTATAACTGAACCAAAAATGG - Intronic
1052599717 9:30610008-30610030 CTGGATAAAAGAAGGGAAGAAGG + Intergenic
1056628444 9:88273307-88273329 CTGGTTCACTGTAGGGAAGAGGG + Intergenic
1060578834 9:124725062-124725084 CTGTAAAACTCAAGAGAACAAGG - Intronic
1060694383 9:125694378-125694400 CTTCATAACTGTAGGGAAAAAGG + Intronic
1061218792 9:129236998-129237020 CTCAATATCTGAAGGGGAGAGGG - Intergenic
1185830533 X:3298127-3298149 ATGTTTAAGTGAAGGGCAGAGGG + Intergenic
1187330493 X:18334873-18334895 GTGTATAACTGAAGGTAATCTGG + Intronic
1188368574 X:29340714-29340736 CTGTATTTCAGAAAGGAAGAAGG - Intronic
1191152248 X:57232104-57232126 CTGTATAGATGGAGGGATGAAGG + Intergenic
1193887853 X:87005983-87006005 CTGTAAAACTGAAAGCAAGTTGG + Intergenic
1197150304 X:123213420-123213442 TTGTACAGATGAAGGGAAGAAGG + Intronic
1197496244 X:127185224-127185246 CTGTAACACTGAAGGAAAAAAGG - Intergenic
1197550474 X:127886664-127886686 CTGCAACACTGAAGGGAATAAGG + Intergenic
1197883187 X:131190800-131190822 TTCAATAACTGAAGGGAAGCTGG - Intergenic
1202270176 Y:23063980-23064002 CTGTAAAACTGAATGCTAGATGG + Intergenic
1202295851 Y:23356702-23356724 CTGTAAAACTGAATGCTAGATGG - Intergenic
1202423170 Y:24697725-24697747 CTGTAAAACTGAATGCTAGATGG + Intergenic
1202447619 Y:24972361-24972383 CTGTAAAACTGAATGCTAGATGG - Intergenic