ID: 1143325605 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:6096326-6096348 |
| Sequence | GCAGATGTGATCGGATCTGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 80 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 7, 4: 71} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1143325597_1143325605 | 25 | Left | 1143325597 | 17:6096278-6096300 | CCATAGTCTGCTGTGGGTTGAAG | 0: 1 1: 0 2: 0 3: 10 4: 95 |
||
| Right | 1143325605 | 17:6096326-6096348 | GCAGATGTGATCGGATCTGCAGG | 0: 1 1: 0 2: 1 3: 7 4: 71 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1143325605 | Original CRISPR | GCAGATGTGATCGGATCTGC AGG | Intronic | ||