ID: 1143325605

View in Genome Browser
Species Human (GRCh38)
Location 17:6096326-6096348
Sequence GCAGATGTGATCGGATCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143325597_1143325605 25 Left 1143325597 17:6096278-6096300 CCATAGTCTGCTGTGGGTTGAAG 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1143325605 17:6096326-6096348 GCAGATGTGATCGGATCTGCAGG 0: 1
1: 0
2: 1
3: 7
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143325605 Original CRISPR GCAGATGTGATCGGATCTGC AGG Intronic