ID: 1143330425

View in Genome Browser
Species Human (GRCh38)
Location 17:6130958-6130980
Sequence TGCCTACTATATTCCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143330423_1143330425 -1 Left 1143330423 17:6130936-6130958 CCTGTGGAGCGATTTTCATGGCT No data
Right 1143330425 17:6130958-6130980 TGCCTACTATATTCCCATGGAGG No data
1143330420_1143330425 15 Left 1143330420 17:6130920-6130942 CCTGGGAGGCAGGAAACCTGTGG No data
Right 1143330425 17:6130958-6130980 TGCCTACTATATTCCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143330425 Original CRISPR TGCCTACTATATTCCCATGG AGG Intergenic
No off target data available for this crispr