ID: 1143330538

View in Genome Browser
Species Human (GRCh38)
Location 17:6131767-6131789
Sequence CAGGAGCCTGCACCAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143330538_1143330542 -1 Left 1143330538 17:6131767-6131789 CCTGGACCTGGTGCAGGCTCCTG No data
Right 1143330542 17:6131789-6131811 GCCTGTCTGAGTGCTGAGCAGGG No data
1143330538_1143330546 30 Left 1143330538 17:6131767-6131789 CCTGGACCTGGTGCAGGCTCCTG No data
Right 1143330546 17:6131820-6131842 AACCTCAGCTCCCCAGCTAATGG No data
1143330538_1143330541 -2 Left 1143330538 17:6131767-6131789 CCTGGACCTGGTGCAGGCTCCTG No data
Right 1143330541 17:6131788-6131810 TGCCTGTCTGAGTGCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143330538 Original CRISPR CAGGAGCCTGCACCAGGTCC AGG (reversed) Intergenic
No off target data available for this crispr