ID: 1143331296

View in Genome Browser
Species Human (GRCh38)
Location 17:6137863-6137885
Sequence CCAGGTGCAATGTAGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143331287_1143331296 28 Left 1143331287 17:6137812-6137834 CCAGTATCAGAGAGCTGTACAGG No data
Right 1143331296 17:6137863-6137885 CCAGGTGCAATGTAGGAAACAGG No data
1143331286_1143331296 29 Left 1143331286 17:6137811-6137833 CCCAGTATCAGAGAGCTGTACAG No data
Right 1143331296 17:6137863-6137885 CCAGGTGCAATGTAGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143331296 Original CRISPR CCAGGTGCAATGTAGGAAAC AGG Intergenic
No off target data available for this crispr