ID: 1143334671

View in Genome Browser
Species Human (GRCh38)
Location 17:6163267-6163289
Sequence CTGCAAAAATGGGCAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143334671_1143334676 8 Left 1143334671 17:6163267-6163289 CCCTCCTCTGCCCATTTTTGCAG No data
Right 1143334676 17:6163298-6163320 GAACGATGTGAGCCACACATAGG No data
1143334671_1143334677 17 Left 1143334671 17:6163267-6163289 CCCTCCTCTGCCCATTTTTGCAG No data
Right 1143334677 17:6163307-6163329 GAGCCACACATAGGATTGACTGG No data
1143334671_1143334679 27 Left 1143334671 17:6163267-6163289 CCCTCCTCTGCCCATTTTTGCAG No data
Right 1143334679 17:6163317-6163339 TAGGATTGACTGGAATTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143334671 Original CRISPR CTGCAAAAATGGGCAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr