ID: 1143334679

View in Genome Browser
Species Human (GRCh38)
Location 17:6163317-6163339
Sequence TAGGATTGACTGGAATTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143334673_1143334679 23 Left 1143334673 17:6163271-6163293 CCTCTGCCCATTTTTGCAGAAGT No data
Right 1143334679 17:6163317-6163339 TAGGATTGACTGGAATTACTAGG No data
1143334670_1143334679 28 Left 1143334670 17:6163266-6163288 CCCCTCCTCTGCCCATTTTTGCA No data
Right 1143334679 17:6163317-6163339 TAGGATTGACTGGAATTACTAGG No data
1143334674_1143334679 17 Left 1143334674 17:6163277-6163299 CCCATTTTTGCAGAAGTGATTGA No data
Right 1143334679 17:6163317-6163339 TAGGATTGACTGGAATTACTAGG No data
1143334675_1143334679 16 Left 1143334675 17:6163278-6163300 CCATTTTTGCAGAAGTGATTGAA No data
Right 1143334679 17:6163317-6163339 TAGGATTGACTGGAATTACTAGG No data
1143334672_1143334679 26 Left 1143334672 17:6163268-6163290 CCTCCTCTGCCCATTTTTGCAGA No data
Right 1143334679 17:6163317-6163339 TAGGATTGACTGGAATTACTAGG No data
1143334671_1143334679 27 Left 1143334671 17:6163267-6163289 CCCTCCTCTGCCCATTTTTGCAG No data
Right 1143334679 17:6163317-6163339 TAGGATTGACTGGAATTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143334679 Original CRISPR TAGGATTGACTGGAATTACT AGG Intergenic
No off target data available for this crispr