ID: 1143335816

View in Genome Browser
Species Human (GRCh38)
Location 17:6170806-6170828
Sequence CATCACATGGGGCAGCCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143335816_1143335831 30 Left 1143335816 17:6170806-6170828 CCAGCCGGCTGCCCCATGTGATG No data
Right 1143335831 17:6170859-6170881 CTCAGTTGTCCTCCATTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143335816 Original CRISPR CATCACATGGGGCAGCCGGC TGG (reversed) Intergenic
No off target data available for this crispr