ID: 1143336743

View in Genome Browser
Species Human (GRCh38)
Location 17:6177111-6177133
Sequence CCAGTTGTGAAAGGGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143336738_1143336743 -1 Left 1143336738 17:6177089-6177111 CCAAAGTAAGGCAGGTGACATAC No data
Right 1143336743 17:6177111-6177133 CCAGTTGTGAAAGGGGTGTCTGG No data
1143336732_1143336743 23 Left 1143336732 17:6177065-6177087 CCACCTCAAAGGGCCATTTCCAT No data
Right 1143336743 17:6177111-6177133 CCAGTTGTGAAAGGGGTGTCTGG No data
1143336735_1143336743 10 Left 1143336735 17:6177078-6177100 CCATTTCCATGCCAAAGTAAGGC No data
Right 1143336743 17:6177111-6177133 CCAGTTGTGAAAGGGGTGTCTGG No data
1143336737_1143336743 4 Left 1143336737 17:6177084-6177106 CCATGCCAAAGTAAGGCAGGTGA No data
Right 1143336743 17:6177111-6177133 CCAGTTGTGAAAGGGGTGTCTGG No data
1143336733_1143336743 20 Left 1143336733 17:6177068-6177090 CCTCAAAGGGCCATTTCCATGCC No data
Right 1143336743 17:6177111-6177133 CCAGTTGTGAAAGGGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143336743 Original CRISPR CCAGTTGTGAAAGGGGTGTC TGG Intergenic
No off target data available for this crispr