ID: 1143337926

View in Genome Browser
Species Human (GRCh38)
Location 17:6187418-6187440
Sequence CTGCAGGAGGAGAGGCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143337926_1143337930 -7 Left 1143337926 17:6187418-6187440 CCACAGGGCCTCTCCTCCTGCAG No data
Right 1143337930 17:6187434-6187456 CCTGCAGCACATGACCTACCTGG No data
1143337926_1143337931 1 Left 1143337926 17:6187418-6187440 CCACAGGGCCTCTCCTCCTGCAG No data
Right 1143337931 17:6187442-6187464 ACATGACCTACCTGGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143337926 Original CRISPR CTGCAGGAGGAGAGGCCCTG TGG (reversed) Intergenic
No off target data available for this crispr