ID: 1143350634

View in Genome Browser
Species Human (GRCh38)
Location 17:6285625-6285647
Sequence TGCCATGCCAATTCTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143350634_1143350639 30 Left 1143350634 17:6285625-6285647 CCAGGCCCAGAATTGGCATGGCA No data
Right 1143350639 17:6285678-6285700 AGGTTGTAAAGCCAGCCCAAAGG No data
1143350634_1143350637 10 Left 1143350634 17:6285625-6285647 CCAGGCCCAGAATTGGCATGGCA No data
Right 1143350637 17:6285658-6285680 TACATTCCATTGATCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143350634 Original CRISPR TGCCATGCCAATTCTGGGCC TGG (reversed) Intergenic
No off target data available for this crispr