ID: 1143351597

View in Genome Browser
Species Human (GRCh38)
Location 17:6292003-6292025
Sequence CACCTGGGGTGCAAAATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143351597_1143351605 27 Left 1143351597 17:6292003-6292025 CCTTAAATTTTGCACCCCAGGTG No data
Right 1143351605 17:6292053-6292075 AAGCCAGTGTCCAGGCTGTAAGG No data
1143351597_1143351607 30 Left 1143351597 17:6292003-6292025 CCTTAAATTTTGCACCCCAGGTG No data
Right 1143351607 17:6292056-6292078 CCAGTGTCCAGGCTGTAAGGTGG No data
1143351597_1143351601 -4 Left 1143351597 17:6292003-6292025 CCTTAAATTTTGCACCCCAGGTG No data
Right 1143351601 17:6292022-6292044 GGTGCCTCACTCACTTCCTCTGG No data
1143351597_1143351604 19 Left 1143351597 17:6292003-6292025 CCTTAAATTTTGCACCCCAGGTG No data
Right 1143351604 17:6292045-6292067 TCACTGCTAAGCCAGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143351597 Original CRISPR CACCTGGGGTGCAAAATTTA AGG (reversed) Intergenic