ID: 1143351599

View in Genome Browser
Species Human (GRCh38)
Location 17:6292018-6292040
Sequence AGGAAGTGAGTGAGGCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143351599_1143351604 4 Left 1143351599 17:6292018-6292040 CCCAGGTGCCTCACTCACTTCCT No data
Right 1143351604 17:6292045-6292067 TCACTGCTAAGCCAGTGTCCAGG No data
1143351599_1143351605 12 Left 1143351599 17:6292018-6292040 CCCAGGTGCCTCACTCACTTCCT No data
Right 1143351605 17:6292053-6292075 AAGCCAGTGTCCAGGCTGTAAGG No data
1143351599_1143351607 15 Left 1143351599 17:6292018-6292040 CCCAGGTGCCTCACTCACTTCCT No data
Right 1143351607 17:6292056-6292078 CCAGTGTCCAGGCTGTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143351599 Original CRISPR AGGAAGTGAGTGAGGCACCT GGG (reversed) Intergenic