ID: 1143351600 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:6292019-6292041 |
| Sequence | GAGGAAGTGAGTGAGGCACC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1143351600_1143351607 | 14 | Left | 1143351600 | 17:6292019-6292041 | CCAGGTGCCTCACTCACTTCCTC | No data | ||
| Right | 1143351607 | 17:6292056-6292078 | CCAGTGTCCAGGCTGTAAGGTGG | No data | ||||
| 1143351600_1143351605 | 11 | Left | 1143351600 | 17:6292019-6292041 | CCAGGTGCCTCACTCACTTCCTC | No data | ||
| Right | 1143351605 | 17:6292053-6292075 | AAGCCAGTGTCCAGGCTGTAAGG | No data | ||||
| 1143351600_1143351604 | 3 | Left | 1143351600 | 17:6292019-6292041 | CCAGGTGCCTCACTCACTTCCTC | No data | ||
| Right | 1143351604 | 17:6292045-6292067 | TCACTGCTAAGCCAGTGTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1143351600 | Original CRISPR | GAGGAAGTGAGTGAGGCACC TGG (reversed) | Intergenic | ||