ID: 1143351601

View in Genome Browser
Species Human (GRCh38)
Location 17:6292022-6292044
Sequence GGTGCCTCACTCACTTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143351595_1143351601 11 Left 1143351595 17:6291988-6292010 CCAAAATAAGCAACTCCTTAAAT No data
Right 1143351601 17:6292022-6292044 GGTGCCTCACTCACTTCCTCTGG No data
1143351594_1143351601 12 Left 1143351594 17:6291987-6292009 CCCAAAATAAGCAACTCCTTAAA No data
Right 1143351601 17:6292022-6292044 GGTGCCTCACTCACTTCCTCTGG No data
1143351591_1143351601 29 Left 1143351591 17:6291970-6291992 CCTGCACTTGTACAACCCCCAAA No data
Right 1143351601 17:6292022-6292044 GGTGCCTCACTCACTTCCTCTGG No data
1143351592_1143351601 14 Left 1143351592 17:6291985-6292007 CCCCCAAAATAAGCAACTCCTTA No data
Right 1143351601 17:6292022-6292044 GGTGCCTCACTCACTTCCTCTGG No data
1143351593_1143351601 13 Left 1143351593 17:6291986-6292008 CCCCAAAATAAGCAACTCCTTAA No data
Right 1143351601 17:6292022-6292044 GGTGCCTCACTCACTTCCTCTGG No data
1143351590_1143351601 30 Left 1143351590 17:6291969-6291991 CCCTGCACTTGTACAACCCCCAA No data
Right 1143351601 17:6292022-6292044 GGTGCCTCACTCACTTCCTCTGG No data
1143351597_1143351601 -4 Left 1143351597 17:6292003-6292025 CCTTAAATTTTGCACCCCAGGTG No data
Right 1143351601 17:6292022-6292044 GGTGCCTCACTCACTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143351601 Original CRISPR GGTGCCTCACTCACTTCCTC TGG Intergenic