ID: 1143351603

View in Genome Browser
Species Human (GRCh38)
Location 17:6292038-6292060
Sequence ACTGGCTTAGCAGTGACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143351603_1143351607 -5 Left 1143351603 17:6292038-6292060 CCTCTGGTCACTGCTAAGCCAGT No data
Right 1143351607 17:6292056-6292078 CCAGTGTCCAGGCTGTAAGGTGG No data
1143351603_1143351612 30 Left 1143351603 17:6292038-6292060 CCTCTGGTCACTGCTAAGCCAGT No data
Right 1143351612 17:6292091-6292113 CAACCTGTGGTGAAACCTACAGG No data
1143351603_1143351605 -8 Left 1143351603 17:6292038-6292060 CCTCTGGTCACTGCTAAGCCAGT No data
Right 1143351605 17:6292053-6292075 AAGCCAGTGTCCAGGCTGTAAGG No data
1143351603_1143351609 17 Left 1143351603 17:6292038-6292060 CCTCTGGTCACTGCTAAGCCAGT No data
Right 1143351609 17:6292078-6292100 GACTCCTCAACCACAACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143351603 Original CRISPR ACTGGCTTAGCAGTGACCAG AGG (reversed) Intergenic
No off target data available for this crispr